Literature DB >> 34012525

Designing Two Synthetic Constructs for Real Time PCR Detection of Francisella tularensis and Ebola Virus.

Mohammadjavad Dehghan Esmat Abadi1, Hesam Motalebzadeh2, Mahmoud Barati3, Mohammadali Yaghobi1.   

Abstract

BACKGROUND: Generally, timely diagnosis of micro-organisms is very important to prevent many diseases. Many methods can detect micro-organisms like culture-based methods and molecular methods. The molecular methods are usually preferred because they provide fast and reliable results. In some cases, microbial strains are not accessible, and there is no safety to work with them; therefore, synthetic constructs which are designed according to the available sequences in databases can be used as a positive control for detection of them.
METHODS: In this study, a synthetic construct was designed for molecular detection of Francisella tularensis (F. tularensis) and the Ebola virus by multiplex real-time PCR reaction. For this, sequences were taken from databases and then multiple alignments were done by software. Also, conventional PCR and two models of real-time PCR (SYBR green and TaqMan) were applied. Finally, multiplex real-time PCR was performed.
RESULTS: The synthetic construct was designed and used for conventional PCR and multiplex PCR. The results of common PCR showed a single band at 148 bp and 167 bp in 1.5% agarose gel stained by ethidium bromide for F. tularensis and Ebola virus, respectively. Also, a dual-band at 148 and 167 bp was observed in multiplex PCR. Results of real-time PCR showed a limit of detection about 0.1 pg of plasmid/μl.
CONCLUSION: In conclusion, the designed construct can be used as a positive control for an accurate diagnosis of these micro-organisms without any biological danger for laboratory staff. So, this method is useful for diagnosis of these agents in food, water, and blood samples. Copyright
© 2021 Avicenna Research Institute.

Entities:  

Keywords:  Ebola virus; Humans; Multiplex polymerase chain reaction; Real-time polymerase chain reaction

Year:  2021        PMID: 34012525      PMCID: PMC8112141          DOI: 10.18502/ajmb.v13i2.5528

Source DB:  PubMed          Journal:  Avicenna J Med Biotechnol        ISSN: 2008-2835


Introduction

Francisella tularensis (F. tularensis) and Ebola virus are highly-infectious elements belonging to family of Francisellaceae and Filoviridae, respectively 1,2. F. tularensis is a gram-negative intracellular bacterium that causes zoonosis and tularemia or rabbit fever that are highly infectious 2. These bacteria have two strains including type A strains which are found in America and type B strains which are found in the northern hemisphere 3. However, these bacteria can survive several days in nature, but they need special conditions to grow up in microbial cultures in the laboratory. Although these bacteria are pathogenic, they can be dangerous for laboratory staff. Ebola virus is a nonsegmented single-stranded RNA virus which causes hemorrhagic fever 4. This virus has three species of Undibugyo, Zaire, and Sudan. The first outbreaks of diseases associated with Ebola appeared in 1976 in Nzara in Sudan and Yambuku in Congo 5. According to these features, the existence of a diagnostic method for accurate and safe detection of these pathogens is necessary to prevent infection. There are many diagnostic methods for the detection of bacteria and viruses like culture-based methods, immunological methods, and molecular ones. Cell culture-based methods are time-consuming and may be dangerous for laboratory staff who work on infectious elements. Immunological methods include Complement Fixation (CF) 6,7, Enzyme-Linked Immunosorbent Assay (ELISA) 8,9, and so on. These approaches use antibodies to detect the infectious micro-organisms. These are also time-consuming, because the detection is based on antibody titration and antibodies usually appear nearly 2 weeks after infection. Therefore, molecular methods are more preferred, because of fast and safe diagnosis and their accurate results. In molecular methods such as Polymerase Chain Reaction (PCR) 10–13, Loop-Mediated isothermal Amplification (LAMP) 14 Nucleic Acid Sequence-Based Amplification (NASBA) 15 and DNA micro-array 16–18, a specific region in the genomic area can be recognized. These approaches are safe because the genome of micro-organisms is used for experimental works and risk factors affecting laboratory personnel are controlled. Molecular methods like other methods have some problems; for example, LAMP methods for detection are very sensitive and due to their high sensitivity, there is a probability for false positive results or in PCR-based methods, thermocycler is necessary. But the basic problem in these methods is preparing the genome of micro-organisms. In some cases like F. tularensis and Ebola virus, micro-organism or genome of them is so rare in some countries like our country. Therefore, for solving the problem of diagnosis of infections caused by these pathogens, a new approach is introduced in this study. In this approach, conserved genomic area of micro-organism was selected and then synthesized and cloned to a plasmid vector for amplification 19. In the current study, a synthetic construct containing a specific genomic area of pathogenic elements (F. tularensis and Ebola) was designed. This vector was used for a simple PCR reaction for a separate diagnosis of these elements and multiplex PCR reaction for the detection of these elements at the same time. Also, quantitative PCR reaction was applied due to its high specificity and sensitivity. For this study, fopA and whole-genome were chosen for the detection of F. tularensis and the Ebola virus, respectively. Identification of two pathogens with different clinical symptoms by a positive control structure is the difference between this study and other studies. In fact, the purpose of designing this positive control structure is to obtain the necessary technical knowledge to design a safe positive control for very dangerous pathogens with a high probability of contamination when working with it. This positive control construct also reduces the likelihood of false positives when examining clinical specimens of the patient.

Materials and Methods

Synthetic construct designing

In this paper, a specific construct was designed for the fast detection of two micro-organisms containing F. tularensis and Ebola virus. For this, specific sequences as targets were chosen from NCBI/EMBL. After that, multiple alignments for the selected targets were done by 6Mega BLAST, BioEdit, AliView, and Clustal W software. In the next step, selected sequences were used in SnapGene offline software for designing a plasmid vector containing these sequences. In this step, for each target, two restriction sites were designed at the ends of each target as a simple method for cloning and subcloning the segments. Accordingly, XhoI restriction sites were added to the beginning of fopA segment of F. tularensis and SacI was added to the end of the Ebola segment and both segments were ligated to each other by an EcoRI restriction site. Also, a BamHI restriction site was designed in the middle of segment to prevent false positive results in case of suspicious template. However, the amplicon sizes were different in the construct as well as the actual size in the micro-organisms to prevent vague or false positive results. The designed constructs were shown in figure 1. The base of this pUC57 structure and both pathogen fragments in the relevant plasmid were artificially cloned and lyophilized from the relevant company.
Figure 1

Designed construct in SnapGene software.

Designed construct in SnapGene software.

Designing multiplex primers and hydrolysis probes for multiplex qPCR assay

Target sequences for the reliable detection of F. tularensis and Ebola virus were selected based on previous literature and sequences available in databases. Selected targets were fopA gene (AF097542) for F. tularensis and the whole-genome for Ebola virus. Sequences retrieved from NCBI/EMBL were organized and aligned using 6 Mega BLAST software. Oligonucleotides for multiplex qPCR assays and conventional PCR assays were designed using the OligoAnalyzer online software. The design strategy for a multiplex qPCR assay was as follows. First, a hydrolysis probe and primer set were designed for each of the selected target sequences for these agents. Finally, the BLAST N analysis was performed to confirm the specificity of the target organisms.

Construct synthesis and plasmid extraction

After target selection and construct designing, target segments were sent for synthesis of DNA segments and cloning to plasmid vectors then transforming to Escherichia coli (E. coli) DH5α. After synthesis of the segments, the bacteria were cultured overnight on LB-broth media containing ampicillin as a selection marker for carrier bacteria. In the next step, plasmid extraction was performed and the extracted constructs were used for PCR amplification.

Conventional PCR

The common PCR method was performed in a volume of 20 μl, containing 10 μl of PCR master mix (Amplicon, Denmark), 1 μl from each primer (10 pM), 4 μl of plasmid as a template (100 pg), and 4 μl of sterile water. PCR reaction was performed based on the following program: initial denaturation at 95°C for 5 min, 30 cycles of denaturation at 94°C for 30 s, primer annealing at 62°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min. In the end, PCR products were analyzed by 2% agarose gel stained by ethidium bromide. Primer sequences and properties were shown in table 1.
Table 1

Primer and probes sequences and properties

Primer and probeSequenceTarget organismAmplicon size of constructAmplicon size of micro-organism
F.TTGCAGCTAATAATTTCATTGCTCCF. tularensi148 bp110 bp
R.TCTACACCTAAGTACCACTGGC
ProbeTACTTATAGCGCTTTGACTAACAAGGACAATACTTG

F.EGATGCCAACGATGCTGTGAEbola167 bp129 bp
F.TTGCAAGAGGATGGAGACGAA
ProbeCAGTGGCTCAAGCTCGTTTTTCAGGTC
Primer and probes sequences and properties

Multiplex PCR reaction

The multiplex PCR assay was performed via designed primers as follows: 10 μl of PCR master mix (Amplicon, Denmark), 1 μl from each primer (10 pM), 4 μl of plasmid as a template (100 pg), and 4 μl of sterile water. In this step, 2 sets of primers were used according to the targets in the plasmid vector.

Development of real-time PCR

At first, monoplex real-time PCR was done for each segment. In the next step, multiplex real-time PCR was performed by SYBR green. For SYBR green-based qPCR reaction, a mixture with volume of 10 μl was prepared as follows: 5 μl of SYBR green, 0.5 μl from each primer (10 pM), 2 μl of plasmid vector as a template (100 pg), and 2 μl of sterile water. Finally, multiplex real-time PCR was performed using a designed TaqMan probe. The probes sequences were shown in table 1.

Sensitivity

The sensitivity of the reaction was tested by making a serial dilution from 100 pg to 0.1 pg of plasmid template for common PCR, multiplex PCR, and real-time PCR assays.

Results

Conventional PCR assay

Conventional PCR was performed to confirm the primer and constructs. Also, results showed a specific band at 148 bp and 167 bp for F. tularensis and Ebola virus, respectively. Also, the sensitivity of the reaction was analyzed using a serial dilution of an extracted plasmid. The results of conventional PCR were shown in figure 2.
Figure 2

A) Analysis of the sensitivity of conventional PCR for F. tularensis fopA gene in 1.5% agarose gel stained by ethidium bromide. Lane (M) 100 bp DNA marker, lane (1) negative control, lane (2) 10 ng of DNA, lane (3) 1 ng of DNA, lane (4) 100 pg of DNA, lane (5) 10 pg of DNA, lane (6) 1 pg of DNA, lane (7) 0.1 pg of DNA . B) Analysis of the sensitivity of the PCR reaction for Ebola virus in 1.5% agarose gel stained by ethidium bromide. Lane (1) 10 ng of DNA, lane (2) 1 ng of DNA, lane (3) 100 pg of DNA, lane (4) 10 pg of DNA, lane (5) 1 pg of DNA, lane (6) 0.1 pg of DNA, lane (7) negative control and lane (M) 100 bp DNA marker.

A) Analysis of the sensitivity of conventional PCR for F. tularensis fopA gene in 1.5% agarose gel stained by ethidium bromide. Lane (M) 100 bp DNA marker, lane (1) negative control, lane (2) 10 ng of DNA, lane (3) 1 ng of DNA, lane (4) 100 pg of DNA, lane (5) 10 pg of DNA, lane (6) 1 pg of DNA, lane (7) 0.1 pg of DNA . B) Analysis of the sensitivity of the PCR reaction for Ebola virus in 1.5% agarose gel stained by ethidium bromide. Lane (1) 10 ng of DNA, lane (2) 1 ng of DNA, lane (3) 100 pg of DNA, lane (4) 10 pg of DNA, lane (5) 1 pg of DNA, lane (6) 0.1 pg of DNA, lane (7) negative control and lane (M) 100 bp DNA marker.

Multiplex PCR assay and sensitivity of the reaction

After designing the primers and construct, a multiplex PCR reaction was performed. According to this, a dual-band at 148 and 167 bp was observed. Also, the sensitivity analysis of the reaction was done and the results were shown in figure 3.
Figure 3

Analysis of the multiplex PCR and sensitivity of the reaction in 1.5% agarose gel stained by ethidium bromide. From left to right, lane (1) 10 ng of DNA, lane (2) 1 ng of DNA, lane (3) 100 pg of DNA, lane (4) 10 pg of DNA, lane (5) 1 pg of DNA, lane (6) 0.1 pg of DNA, lane (7) negative control and lane (M) 100 bp DNA marker.

Analysis of the multiplex PCR and sensitivity of the reaction in 1.5% agarose gel stained by ethidium bromide. From left to right, lane (1) 10 ng of DNA, lane (2) 1 ng of DNA, lane (3) 100 pg of DNA, lane (4) 10 pg of DNA, lane (5) 1 pg of DNA, lane (6) 0.1 pg of DNA, lane (7) negative control and lane (M) 100 bp DNA marker.

SYBR green qPCR assay

After the common PCR was done and results confirmed the primers and designed constructs, the SYBR green PCR assay was performed and the results were shown in figure 4.
Figure 4

A) Analysis of SYBR green real-time PCR of fopA gene of F. tularensis using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined. B) Analysis of SYBR green real-time PCR of Ebola virus using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined.

A) Analysis of SYBR green real-time PCR of fopA gene of F. tularensis using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined. B) Analysis of SYBR green real-time PCR of Ebola virus using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined.

TaqMan qPCR assay

In the next step, the segments were used in a Taq-Man qPCR reaction with a designed probe. The results were shown in figure 5.
Figure 5

A) Analysis of TaqMan real-time PCR of fopA gene of F. tularensis using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined. B) Analysis of TaqMan real-time PCR of Ebola virus using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined.

A) Analysis of TaqMan real-time PCR of fopA gene of F. tularensis using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined. B) Analysis of TaqMan real-time PCR of Ebola virus using Corbett Rotor-Gene 6000. A serial dilution from 100 pg to 0.1 pg of plasmid was examined.

Discussion

F. tularensis and Ebola virus are high-infectious elements that cause rabbit fever and Ebola hemorrhagic fever. Several methods may detect these microbes. One of the most common diagnostic methods for bacterial detection is culturing, but this approach is not proposed in some cases like F. tularensis, because of infectious and fastidious growth conditions. However, there are many serological methods like ELISA, IFA, CFT, and so on for the common detection of both bacterial and viral infections in humans and animals. Berdal et al studied the serological methods such as rapid immunochromatography, ELISA, and the common PCR for diagnosis of F. tularensis after the outbreak in Norway in 2009 20. One of the most important problems in these approaches is that they are time-consuming and need special laboratory conditions like the current cases that required BSL3 conditions 21. Immunological methods work on IgG and IgM antibodies although antibodies may appear 2–3 weeks after the infection. However, these methods are not suitable in some cases like food poisoning, because they are time-consuming. For example, in these cases, the resulting rate and the reliability of the reaction is very important because the health of water and foods is vital in human life. In past years, the invention of the thermocycler and the appearance of molecular biology approaches established advanced progress in the field of diagnosis and molecular typing of microbes. In this study, a positive control was designed for the rapid and reliable detection of F. tularensis and the Ebola virus by multiplex real-time PCR reaction. Primers and probes were designed for an accurate diagnosis of the target organisms. In this work, TaqMan probes were used to increase the diagnosis range of different strains. There are so many designed constructs with different goals like detection or identification of some microbes in laboratories or producing subunit vaccines against pathogens. For example, Caasi et al designed a positive control for PCR reaction of Barley yellow dwarf virus, Soil-borne wheat mosaic virus, Triticum mosaic virus, and Wheat streak mosaic virus 22. Also, Pourmahdi et al studied the molecular diagnosis of Yersinia pestis and F. tularensis by multiplex PCR in a synthetic construct and reported the sensitivity of about 36×10 −3 ng/μl 23. In another study, Sohni et al designed an internal amplification control for the Bacillus anthracis rpoB gene, detected by TaqMan real-time polymerase chain reaction and reported a limit of detection about 5 fg/μl 19. In 1996, Junhui et al studied the PCR detection of F. tularensis and they compared the sensitivity of the PCR method with the culture-based method to detect bacteria. They chose 3 sets of primers for PCR reaction 24. In a previous study, Euler et al studied real-time PCR detection of F. tularensis by a new detection approach. They used a recombinase polymerase for isothermal real-time PCR amplification and they chose Tul4 as a target for amplification. Also, they reported a sensitivity of about 102 molecules for their diagnostic method 25. In the case of detection of the Ebola virus, Towner et al diagnosed Ebola virus by RT–PCR in BSL4 conditions and they reported a limit of detection about 3–38 RNA copies for their method 26. In another study, Weidmann et al studied molecular detection of Zaire Ebola virus, Ebola Sudan virus and Marburg virus (MBGV) by a RT-PCR assay 27.

Conclusion

According to the previous study in the field of detection of these micro-organisms and the reported data, our new designed construct and multiplex real-time PCR may be useful for a safe detection of these microbes simultaneously. These tools could be used as diagnosis kits for a rapid and safe detection of these microbes in contaminated or suspicious food and water or dairy products. Also, it could be used in laboratory to prevent the contamination without the need for BSL 3 and 4 laboratory conditions which leads to reduction of laboratory costs.
  26 in total

1.  Recombinase polymerase amplification assay for rapid detection of Francisella tularensis.

Authors:  Milena Euler; Yongjie Wang; Peter Otto; Herbert Tomaso; Raquel Escudero; Pedro Anda; Frank T Hufert; Manfred Weidmann
Journal:  J Clin Microbiol       Date:  2012-04-18       Impact factor: 5.948

2.  NASBA technology: isothermal RNA amplification in qualitative and quantitative diagnostics.

Authors:  J W Romano; K G Williams; R N Shurtliff; C Ginocchio; M Kaplan
Journal:  Immunol Invest       Date:  1997 Jan-Feb       Impact factor: 3.657

3.  Early recognition of atypical Francisella tularensis strains lacking a cysteine requirement.

Authors:  K Bernard; S Tessier; J Winstanley; D Chang; A Borczyk
Journal:  J Clin Microbiol       Date:  1994-02       Impact factor: 5.948

4.  Agglutinins and antibodies to Francisella tularensis outer membrane antigens in the early diagnosis of disease during an outbreak of tularemia.

Authors:  L Bevanger; J A Maeland; A I Naess
Journal:  J Clin Microbiol       Date:  1988-03       Impact factor: 5.948

5.  Detection of Ebola virus envelope using monoclonal and polyclonal antibodies in ELISA, surface plasmon resonance and a quartz crystal microbalance immunosensor.

Authors:  Jae-Sung Yu; Hua-Xin Liao; Aren E Gerdon; Brian Huffman; Richard M Scearce; Mille McAdams; S Munir Alam; Paul M Popernack; Nancy J Sullivan; David Wright; David E Cliffel; Gary J Nabel; Barton F Haynes
Journal:  J Virol Methods       Date:  2006-07-20       Impact factor: 2.014

6.  Detection of Francisella tularensis in ulcers of patients with tularemia by PCR.

Authors:  A Sjöstedt; U Eriksson; L Berglund; A Tärnvik
Journal:  J Clin Microbiol       Date:  1997-05       Impact factor: 5.948

7.  COMPARATIVE STUDIES OF FRANCISELLA TULARENSIS AND FRANCISELLA NOVICIDA.

Authors:  C R OWEN; E O BUKER; W L JELLISON; D B LACKMAN; J F BELL
Journal:  J Bacteriol       Date:  1964-03       Impact factor: 3.490

8.  Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome.

Authors:  Jonathan S Towner; Pierre E Rollin; Daniel G Bausch; Anthony Sanchez; Sharon M Crary; Martin Vincent; William F Lee; Christina F Spiropoulou; Thomas G Ksiazek; Mathew Lukwiya; Felix Kaducu; Robert Downing; Stuart T Nichol
Journal:  J Virol       Date:  2004-04       Impact factor: 5.103

Review 9.  Towards detection and diagnosis of Ebola virus disease at point-of-care.

Authors:  Ajeet Kaushik; Sneham Tiwari; Rahul Dev Jayant; Aileen Marty; Madhavan Nair
Journal:  Biosens Bioelectron       Date:  2015-08-20       Impact factor: 10.618

Review 10.  Tularaemia: a challenging zoonosis.

Authors:  C L Carvalho; I Lopes de Carvalho; L Zé-Zé; M S Núncio; E L Duarte
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2014-01-13       Impact factor: 2.268

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.