Literature DB >> 34008927

KIN17 promotes tumor metastasis by activating EMT signaling in luminal-A breast cancer.

Qiyuan Huang1,2,3, Kashif Rafiq Zahid1, Jinsi Chen1, Xiangxiong Pang1,2, Meifeng Zhong1, Hongling Huang4, Weifeng Pan1, Jingxin Yin5, Umar Raza6, Jiamin Zeng7, Xinhong Zhu2, Tao Zeng3.   

Abstract

BACKGROUND: Breast cancer (BC), the most common cause of cancer death in women, overtook lung cancer as the leading cause of cancer worldwide in 2020. Although many studies have proposed KIN17 as a biomarker of tumorigenesis in different cancer types, its role in tumor metastasis, particularly in BC metastasis, has been underexplored. This study aimed to explore the role of KIN17 in BC metastasis.
METHODS: Survival analyses was performed to identify the association between KIN17 expression and BC patient survival in silico. Using lentivirus constructs, we developed bidirectional KIN17 expression (KD, knockdown; OE, overexpression) cellular models of luminal-A (Lum-A) breast cancer MCF-7 cells. We performed in vitro wound healing, transwell with and without Matrigel assays, and in vivo tail-vein metastasis assay to evaluate the migration and invasion abilities of MCF-7 with stable KIN17 knockdown or overexpression. Western blotting was performed to compare the changes in protein expression.
RESULTS: We found that KIN17 expression was associated with poor overall survival (OS), relapse-free survival (RFS), distant metastasis-free survival (DMFS) and post-progression survival (PPS), particularly in Lum-A breast cancer patients. Later, we found that KIN17 knockdown inhibited migration and invasion of MCF-7 cells via regulating EMT-associated signaling pathways in vitro and decreases metastatic spread of the disease in vivo. In contrast, KIN17 overexpression promoted migration and invasion of MCF-7 cells in vitro and increased the metastatic spread of the disease in vivo.
CONCLUSIONS: Overall, our findings provide preliminary data which suggests KIN17 of importance to target in metastatic Lum-A patients.
© 2021 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Entities:  

Keywords:  EMT; KIN17; Lum-A breast cancer; metastasis; migration

Mesh:

Substances:

Year:  2021        PMID: 34008927      PMCID: PMC8258367          DOI: 10.1111/1759-7714.14004

Source DB:  PubMed          Journal:  Thorac Cancer        ISSN: 1759-7706            Impact factor:   3.500


INTRODUCTION

Although the last two decades have witnessed huge success in diagnosis, prevention, and therapeutic advancements, cancer is still among the leading cause of death worldwide. Breast cancer has become the most common malignancy and leading cause of cancer‐associated death among women worldwide. Metastatic spread of disease is one of the major hallmarks of cancer and is the main culprit behind cancer associated deaths. The mortality rate of breast cancer patients has increased in China probably due to the increase in the number of patients with metastatic disease. More than 70% of breast cancer patients belong to the estrogen receptor (ER) positive subtype or luminal (Lum) subtype and are treated with adjuvant endocrine/hormonal therapy. Despite tumors in most patients being less aggressive and of low grade, cancer cells still evade therapeutic treatments and metastasize to other organs. , Therefore, better understanding of the molecular mechanism behind breast cancer progression and metastasis is needed for devising effective breast cancer treatments. KIN17 gene was first identified by Angulo et al. in 1989 as being conserved from yeast to mammals. In man, KIN17 harbors an N‐terminal zinc finger domain (27–50 nt) and a C‐terminal KOW motif (335–373 nt). , , , It is primarily expressed in heart, testicular and skeletal muscle cells with lower expression in other organs. It has been found to be involved in a diverse range of important physiological and pathological processes including DNA replication and transcription, DNA damage response to ionizing radiations, immunoglobulin isotype switching and, interestingly, tumor cell proliferation in different cancer types. , , , Previous studies have proposed elevated KIN17 expression as a promising biomarker of tumorigenesis. For instance, KIN17 has been reported to drive DNA replication and cellular proliferation during the course of breast cancer development. In line with this, knockdown of KIN17 expression has been found to promote apoptosis in triple negative breast cancer (TNBC) cells. KIN17 protein is highly expressed in hepatocellular carcinoma tissues where it has been reported to increase the expression of cyclinD1 and p27Kip1, thereby promoting the proliferation of cancer cells. In cervical cancer cells, KIN17 protein expression has been found to be markedly increased and its knockdown inhibited cell proliferation and invasion, and promoted apoptotic cell death. Recently, an independent study has found a role for KIN17 in the metastatic spread of cervical cancer where it regulated the NF‐κB‐Snail pathway to promote tumor invasion and metastasis. Overexpression of KIN17 in non‐small cell lung cancer (NSCLC) has been linked to lymph node metastasis while silencing of KIN17 inhibited the invasion and metastasis of NSCLC cells. Furthermore, KIN17 has been reported to promote proliferation, migration and invasion of thyroid cancer cells by activating the p38 MAPK signaling pathway. Although these studies strongly suggest KIN17 as an oncogene, tumor promoting and prometastatic marker in different cancer types, KIN17 regulated molecular mechanisms involved in tumor metastasis, in general, and in breast cancer metastasis, in particular, are poorly understood. In this study, we initially identified that KIN17 expression was associated with poor overall survival (OS), relapse‐free survival (RFS), distant metastasis‐free survival (DMFS) and post‐progression survival (PPS), particularly in luminal‐A (Lum‐A) breast cancer patients. In this line, we explored the role of KIN17 in Lum‐A and found that KIN17 knockdown inhibited migration and invasion of Lum‐A MCF‐7 cells via regulating EMT‐associated signaling pathways in vitro and decreased metastatic spread of the disease in vivo. On the other hand, KIN17 overexpression promoted migration and invasion of Lum‐A MCF‐7 cells in vitro and increased the metastatic spread of the disease in vivo. Overall, our findings provide preliminary data which suggest KIN17 of importance to target in metastatic Lum‐A breast cancer patients.

METHODS

Survival analyses

Data for survival analyses were retrieved from online freely available KM‐plotter survival analysis database (https://kmplot.com/analysis/) and were replotted in GraphPad Prism 6.0.

Cell culture

A human breast cancer cell line MCF‐7 was obtained from National Collection of Authenticated Cell Cultures of Chinese Academy of Sciences, Shanghai, China (Serial:TCHu74). The cells were then cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc) supplemented with 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc.), 100 μg/ml penicillin, and 100 μg/ml streptomycin (Hyclone, USA). MCF‐7 cells were maintained in a humidified incubator at 37°C with 5% CO2. Subculture was performed when cells reached 80%–90% confluence.

Construction and infection of lentivirus particles containing shRNA

Lentivirus particles containing KIN17 targeting shRNA (5′‐GGAATTCCGAAATGACTTT‐3′) and respective nontargeting control (5′‐TTCTCCGAACGTGTCACGT‐3′) were constructed as described previously (Figure S1(A)). Exponentially growing MCF‐7 cells were subcultured and seeded in six‐well plates at a density of 1.3 × 105 cells/well. The following day, cells were incubated in Opti‐MEM (Gibco; Thermo Fisher Scientific, Inc.) for 30 min and then transfected with lentivirus vector containing shRNA‐KIN17 (hereon termed as MCF‐7KD) or nontargeting control vector (hereon termed as MCF‐7NC1) (Shanghai GeneChem Co., Ltd.), according to the manufacturer's protocol. Untransfected MCF‐7 cells (MCF‐7Mock) were used as a blank control. All the cells were cultured in DMEM media supplemented with 1.5 μg/ml puromycin in 5% CO2 and 95% humidity at 37°C. Enhanced green fluorescent protein (EGFP) and puromycin selection were used to measure the transfection efficiency and screen successfully transfected cells, respectively. Subsequent experiments were conducted when >90% of cells exhibited a fluorescent signal (Figure S1(B)) and the KIN17 knockdown levels were verified by Western blot (Figure S1(C)).

Construction and infection of lentivirus particles containing human gene

Lentivirus particles for KIN17 overexpression were constructed by inserting the human gene KIN17 (5′‐CGCAAATGGGCGGTAGGCGTG‐3′[GenBank ID:NM_012311]) to GV248 plasmid as GV248‐OE (Shanghai GeneChem Co., Ltd.) and control particles were constructed as GV248‐NC without inserting any sequence in GV248 plasmid (Shanghai GeneChem Co., Ltd. (Figure S1(D)). Cells were seeded and transfected as previously described. Untransfected MCF‐7 cells (MCF‐7Mock) were used as a blank control. All cells were cultured in DMEM media supplemented with 1.5 μg/ml puromycin in 5% CO2 and 95% humidity at 37°C. Enhanced green fluorescent protein (EGFP) and puromycin selection were used to measure the transfection efficiency and to screen successfully transfected cells respectively. Subsequent experiments were conducted when the>90% of cells exhibited fluorescent signal (Figure S1(E)) and the KIN17 overexpression levels were verified by western blot (Figure S1(F)).

Wound healing assay

Exponentially growing cells were seeded in culture medium containing 90% DMEM and 10% FBS at a density of 10 × 106 cells/well in six‐well plates overnight at 37°C. When the cells reached about 90% confluence, the cell layer was scratched with a 200 μl sterile pipette tip to make a wound and the wells were washed with PBS three times. Subsequently, 2 ml DMEM free of serum was added to each well. The migration ability is the gap between the two edges of the wound, which was measured under the microscope (magnification, ×10 objective lens) at 0 h, 24 h, and 48 h after scratching. All assays were done in duplicate and repeated at least three times. All the images were analyzed on Image J.

Transwell migration assay

Cell migration capacity was measured by culturing cells in 8.0 μm transwell chambers (Costar, Corning Incorporated), which was put into the 24‐well cell culture plate. Briefly, the upper chambers were seeded with equal numbers of cells (5 × 105 cells/200 μl) in DMEM free of serum culture medium, and the lower chambers were filled with DMEM medium supplemented with 30% FBS as a chemoattractant. The plates were incubated in a humidified incubator at 37°C for 24 h. Cells that migrated through the membrane filter to the lower surface were fixed with methanol (Guangdong Guanghua Sci‐Tech Co., Ltd.) at room temperature for 30 min and then stained with 0.1% crystal violet solution (Shanghai GeneChem Co., Ltd.) at room temperature for 30 min. After washing three times with PBS, the cells in the upper chambers were then wiped away and images of the migrated cells taken under inverted microscope (magnification, ×20 objective lens). Numbers of migrated cells were counted on Image J. All the assays were done in duplicate and repeated at least three times.

Transwell invasion assay

The transwell invasion assay was performed in transwell chambers (Costar, Corning Incorporated) on 24‐well cell culture plates. The upper and lower culture compartments were separated by polycarbonate filters with 8‐μm pore diameter. Different from the transwell migration assay, the filters were precoated with Matrigel (BD Biosciences) for 1 h at 37°C. Equal numbers of cells (5 × 105 cells) in serum‐free DMEM were added to the upper chamber. The lower chamber was filled with DMEM medium containing 30% FBS for inducing cell invasion, and plates were incubated at 37°C for 48 h. Invaded cells were fixed, stained, photographed and counted following the protocol described in the transwell migration assay. All the assays were performed in duplicate and repeated at least three times.

Western blotting

Protein extraction from tissues and cells and western blot assay was performed as previously described. Briefly, using RIPA lysis buffer (Keygen Biotech) to cleave cells or tissues and extract their total protein, the total protein concentration was then quantified on NanoDrop 2000. Then, 100 μg protein were loaded and separated by 10%–12% SDS‐PAGE and transferred onto polyvinylidene fluoride membranes (EMD Millipore), and incubated with antibodies: KIN17 (K58) (1:1000, Santa Cruz Biotechnology, cat. no. sc‐32 769); GAPDH (1:25000; proteintech, cat. no. 60004‐1‐Ig); AKT(1:1000, DB BIOTECH, cat. no.DB126‐0.1); p‐AKT(1:1000, DB BIOTECH, cat. no. DB127‐0. 1); TCF8/ZEB1 (1:1000, Cell Signaling Technology, cat. no.3396); N‐cadherin (1:1000, Cell Signaling Technology, cat. no.#13 116); E‐cadherin (1:1000, Cell Signaling Technology, cat. no.3195); β‐catenin (1:1000, Cell Signaling Technology, cat. no.8480); Vimentin (1:1000, Cell Signaling Technology, cat. no.5741); Snail (1:1000, Cell Signaling Technology, cat. no.3879); Claudin‐1 (1:1000, Cell Signaling Technology, cat. no.13 255)., HRP‐linked antibody anti‐rabbit IgG (1:5000, Cell Signaling Technology, cat. no.7074); HRP‐linked antibody anti‐mouse IgG (1:5000, Cell Signaling Technology, cat. no.7076 were used as secondary antibodies and signals were detected by ECL enhanced chemiluminescence substrate (Thermo Fisher Scientific, Inc.). Images were captured on the Image Quant RT ECL imager (GE Healthcare Life Sciences). For analysis, protein levels were normalized to GAPDH on the same gels. All the band intensities were quantified by Image Lab 6.0 imaging software (Bio‐Rad Laboratories, Inc.)

Xenograft tumor model

Five weeks old female BALB/c nude mice were purchased from the Southern Medical University Laboratory Animal Center and raised under standard laboratory conditions. After one week of adaptation, the metastasis experiment was performed. Breast cancer cells of MCF‐7 in KD and OE groups (2.0 × 106 cells/mice in 200 μl DMEM) were intravenously injected through the tail vein of the mice. The mice were weighed and received estradiol supplementation (0.4 mg/kg) every seven days for 35 days after cell injection. After six weeks, the mice were anesthetized and anatomized, and the metastatic liver nodules were calculated. Livers were excised for western blotting and hematoxylin and eosin staining. All animal experiments were conducted according to the instructions approved by the Nanfang Hospital Animal Ethics committee of Southern Medical University.

Statistical analysis

All the experiments were duplicated and repeated at least three times. Statistical analyses were performed using Graph Pad prism 7.0. Two‐tailed Student's t‐tests were used for the comparison between two groups of independent samples. One‐way ANOVA was used for the comparison of the mean values between multiple groups. Under the condition of homogeneity of variance, LSD was used for the multiple comparison analysis between groups. In the case of heterogeneity of variances, Dunnett's T3 method was used for multiple comparative analyses among groups. Data are presented as mean ± SEM. p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

RESULTS

KIN17 is associated with poor survival in Lum‐A breast cancer patients

In order to study KIN17 in the context of breast cancer metastasis, we first confirmed the association between KIN17 expression and breast cancer patient survival, and found that high KIN17 expression is associated with poor overall survival in breast cancer patients (Figure 1(a)). As breast cancer is divided into four major subtypes, we checked the association of KIN17 expression with the survival of breast cancer patients representing different subtypes and found that high KIN17 in particular is significantly associated with poor OS in Lum‐A breast cancer patients (Figure 1(b), (c)). Surprisingly, high KIN17 expression was also found to be associated with poor relapse‐free survival (RFS), distant metastasis‐free survival (DMFS) and post‐progression survival (PPS) (Figure 1(d)–(f)) in Lum‐A breast cancer patients suggesting a close link between KIN17 expression and metastatic spread of the disease.
FIGURE 1

KIN17 is associated with poor survival in luminal‐A (Lum‐A) breast cancer patients. (a) Kaplan–Meier survival plot representing the percentage of overall survival (OS) in breast cancer patients from TCGA database based on low versus high KIN17 expression. (b) HR and p‐value associated with OS in different subtypes of breast cancer based on low versus high KIN17 expression. (c–f) Kaplan–Meier survival plots representing the percentage OS (c), relapse‐free survival (RFS) (d), distant metastasis‐free survival(DMFS) (e) and post‐progression survival (PPS) (f) in Lum‐A breast cancer patients based on low versus high KIN17 expression. Data for (a–f) were retrieved from the KM‐plotter online survival analysis tool

KIN17 is associated with poor survival in luminal‐A (Lum‐A) breast cancer patients. (a) Kaplan–Meier survival plot representing the percentage of overall survival (OS) in breast cancer patients from TCGA database based on low versus high KIN17 expression. (b) HR and p‐value associated with OS in different subtypes of breast cancer based on low versus high KIN17 expression. (c–f) Kaplan–Meier survival plots representing the percentage OS (c), relapse‐free survival (RFS) (d), distant metastasis‐free survival(DMFS) (e) and post‐progression survival (PPS) (f) in Lum‐A breast cancer patients based on low versus high KIN17 expression. Data for (a–f) were retrieved from the KM‐plotter online survival analysis tool

KIN17 promotes migration of Lum‐A breast cancer cells in vitro

In order to investigate the role of KIN17 in Lum‐A breast cancer metastasis in vitro and in vivo, we first developed a stable KIN17 knockdown and overexpression cell line using well‐established Lum‐A breast cancer MCF‐7 cell line models; herein referred to as MCF‐7KD and MCF‐7OE, respectively (Figure S1; For details, see Supplementary Information). We then investigated the effect of KIN17 knockdown and overexpression of Lum‐A breast cancer cell migration using wound healing and transwell migration assays. MCF‐7KD cells showed lower wound healing ability compared with MCF‐7NC1 cells and MCF‐7Mock cells after 24 and 48 h of the scratch assay, while no significant change was observed between MCF‐7NC1 and MCF‐7Mock cells (Figure 2(a)). In contrast, MCF‐7OE cells exhibited notably higher wound healing ability compared with MCF‐7NC2 cells and MCF‐7Mock cells after 48 h of the scratch assay, while no change was found between MCF‐7NC2 and MCF‐7Mock cells (Figure 2(b)). We also observed similar results in the transwell migration assay where we found that KIN17 knockdown evidently inhibited migration (Figure 2(c)), whereas KIN17 overexpression significantly promoted migration of MCF‐7 cells (Figure 2(d)). Overall, these results suggest that high KIN17 expression promotes migration in Lum‐A breast cancer MCF‐7 cells.
FIGURE 2

KIN17 promotes migration of luminal‐A (Lum‐A) breast cancer cells in vitro. (a and b) Representative images (10x) (left) and quantification (right) of scratch assays performed using MCF‐7KD (a), MCF‐7OE (b) cells compared with respective controls. Images were taken at 0, 24 and 48 h time points. (c and d) Representative images (20x) and quantification of transwell assays without Matrigel performed using MCF‐7KD (c), MCF‐7OE (d) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4

KIN17 promotes migration of luminal‐A (Lum‐A) breast cancer cells in vitro. (a and b) Representative images (10x) (left) and quantification (right) of scratch assays performed using MCF‐7KD (a), MCF‐7OE (b) cells compared with respective controls. Images were taken at 0, 24 and 48 h time points. (c and d) Representative images (20x) and quantification of transwell assays without Matrigel performed using MCF‐7KD (c), MCF‐7OE (d) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4

KIN17 promotes invasion in Lum‐A breast cancer cells in vitro

Next, to determine the role of KIN17 in regulating invasion of Lum‐A breast cancer MCF‐7 cells, we performed transwell invasion assay with Matrigel. The results showed that knockdown of KIN17 significantly suppressed the invasion of MCF‐7 cells through Matrigel in contrast to MCF‐7NC1 and MCF‐7Mock cells (Figure 3(a)). In line with this, we also performed the transwell invasion assay in the OE group of MCF‐7 cells. Results showed that increased expression of KIN17 significantly upregulated the invasion ability of MCF‐7 cells. In contrast, there was no significant change between the MCF‐7NC2 and MCF‐7Mock cells in terms of number of cells invaded through Matrigel (Figure 3(b)). Together, these data suggest that high KIN17 expression promotes invasion in Lum‐A breast cancer MCF‐7 cells.
FIGURE 3

KIN17 promotes invasion capacity of luminal‐A (Lum‐A) breast cancer cells in vitro. (a and b) Representative images (20x) and quantification of transwell assays with Matrigel performed using MCF‐7KD (a), MCF‐7OE (b) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 4

KIN17 promotes invasion capacity of luminal‐A (Lum‐A) breast cancer cells in vitro. (a and b) Representative images (20x) and quantification of transwell assays with Matrigel performed using MCF‐7KD (a), MCF‐7OE (b) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 4

KIN17 hyperactivates EMT‐associated signaling pathways in Lum‐A breast cancer cells in vitro

Based on our findings that KIN17 plays a crucial role in controlling migration and invasion of Lum‐A MCF‐7 cells, we were interested in investigating the underlying molecular mechanisms. In this line, we checked the activation of different prosurvival and epithelial‐to‐mesenchymal transition (EMT) markers already known to be involved in breast cancer metastasis including AKT, TCF‐8, N‐cadherin, β‐catenin, vimentin, Snail, and Claudin‐1. We found no changes in activation of prosurvival and prometastatic markers AKT upon knockdown and overexpression of regulation the KIN17 protein levels in MCF‐7 cells compared to respective controls (Figure 4(a), (b)). Interestingly, protein expression of EMT‐associated β‐catenin, Vimentin, and claudin‐1 were significantly decreased in MCF‐7KD cells compared with MCF‐7NC1and MCF‐7Mock cells (Figure 4(c)), whereas expression of the same EMT‐associated markers were significantly upregulated in MCF‐7OE cells compared with MCF‐7NC2 and MCF‐7Mock cells (Figure 4(d)). Moreover, TCF‐8, N‐cadherin, and Snail, the other EMT‐associated proteins, were also slightly changed upon KIN17 knockdown and overexpression (Figure 4(c), (d)). Together, these results confirm that high KIN17 promotes metastatic Lum‐A breast cancer MCF‐7 cells by hyperactivating EMT‐associated signaling pathways.
FIGURE 4

KIN17 hyperactivates EMT‐associated signaling pathways in luminal‐A (Lum‐A) breast cancer cells in vitro. (a–d) Western blots (left) and their quantitative analyses (right) showing change in expression of protein involved in with AKT (a and b) and EMT‐associated signaling pathway (c and d) in MCF‐7KD (a and c), MCF‐7OE (b and d) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–6

KIN17 hyperactivates EMT‐associated signaling pathways in luminal‐A (Lum‐A) breast cancer cells in vitro. (a–d) Western blots (left) and their quantitative analyses (right) showing change in expression of protein involved in with AKT (a and b) and EMT‐associated signaling pathway (c and d) in MCF‐7KD (a and c), MCF‐7OE (b and d) cells compared with respective controls. Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, KIN17 knockdown; OE, KIN17 overexpression. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–6

KIN17 promotes Lum‐A breast cancer metastasis in vivo

After establishing an important role for KIN17 in Lum‐A breast cancer metastasis in vitro, we aimed to validate our findings in vivo. In this line, we performed a tail‐vein metastasis assay using MCF‐7KD and MCF‐7OE cells together with respective controls in vivo. We found that the mice injected with MCF‐7KD cells remained healthy compared to those injected with control MCF‐7NC1 cells which became stressed and began to lose bodyweight after four weeks of tail vein injection of cells (Figure 5(a), (b)). The liver of mice injected with MCF‐7KD cells showed a lower number of metastatic nodules at the liver surface compared to those injected with control MCF‐7NC1 cells (Figure 5(c)). KIN17 protein expression was consistently decreased in metastatic nodules isolated from the livers of mice injected with MCF‐7KD mice compared to those injected with control MCF‐7NC1 cells (Figure 5(d)). In addition, KIN17 knockdown was accompanied by reduced levels of inflammatory infiltration and lesser degeneration of liver tissue (Figure 5(e), (f)). In contrast to this, we found that the mice injected with MCF‐7OE cells became stressed and began to lose bodyweight after four weeks of tail vein injection of cells compared to those injected with control MCF‐7NC2 cells (Figure 6(a), (b)). The liver of mice injected with MCF‐7OE cells showed a higher number of metastatic nodules at the liver surface compared to those injected with control MCF‐7NC2 cells (Figure 6(c)). KIN17 protein expression was consistently increased in metastatic nodules isolated from livers of mice injected with MCF‐7OE mice compared to those injected with control MCF‐7NC1 cells (Figure 6(d)). In addition, KIN17 overexpression was accompanied by increased levels of inflammatory infiltration and the higher degeneration of liver tissue (Figure 6(e), (f)). These findings suggest that higher KIN17 expression actively promotes, whereas its downregulation demotes the metastatic spread of Lum‐A breast cancer MCF‐7 cells in vivo.
FIGURE 5

KIN17 knockdown inhibits metastasis of luminal‐A (Lum‐A) breast cancer cells in vivo. (a) Photograph of representative mice six weeks after tail vein injection of MCF‐7NC1 and MCF‐7KD cells. (b) Graph showing change in bodyweight of mice six weeks after tail vein injection of MCF‐7NC1 and MCF‐7KD cells. (c) Image showing representative liver from mice which received MCF‐7NC1 and MCF‐7KD through tail‐vein injection. Mice were sacrificed and livers were collected six weeks after injection. (d) Western blot (top) and their quantitative analysis (bottom) showing KIN17 expression in metastatic nodules from the livers of mice injected with MCF‐7NC1 and MCF‐7KD cells. (e and f) Representative HE staining images of liver tissues from mice injected with MCF‐7NC1 (e), and MCF‐7KD (f) cells. NC, negative control; KD: knockdown. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4

FIGURE 6

KIN17 overexpression promotes metastasis of luminal‐A (Lum‐A) breast cancer cells in vivo. (a) Photograph of representative mice six weeks after tail vein injection of MCF‐7NC2 and MCF‐7OE cells. (b) Graph showing change in bodyweight of mice six weeks after tail vein injection of MCF‐7NC2 and MCF‐7OE cells. (c) Image showing representative liver from mice which received MCF‐7NC2 and MCF‐7OE cells through tail‐vein injection. Mice were sacrificed and livers were collected six weeks after injection. (d) Western blot (top) and their quantitative analysis (bottom) showing KIN17 expression in metastatic nodules from the livers of mice injected with MCF‐7NC2 and MCF‐7OE cells. (e and f) Representative hematoxylin & eosin (H&E) staining images of liver tissues from mice injected with MCF‐7NC2 (e), and MCF‐7OE (f) cells. NC, negative control; KD, knockdown. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4

KIN17 knockdown inhibits metastasis of luminal‐A (Lum‐A) breast cancer cells in vivo. (a) Photograph of representative mice six weeks after tail vein injection of MCF‐7NC1 and MCF‐7KD cells. (b) Graph showing change in bodyweight of mice six weeks after tail vein injection of MCF‐7NC1 and MCF‐7KD cells. (c) Image showing representative liver from mice which received MCF‐7NC1 and MCF‐7KD through tail‐vein injection. Mice were sacrificed and livers were collected six weeks after injection. (d) Western blot (top) and their quantitative analysis (bottom) showing KIN17 expression in metastatic nodules from the livers of mice injected with MCF‐7NC1 and MCF‐7KD cells. (e and f) Representative HE staining images of liver tissues from mice injected with MCF‐7NC1 (e), and MCF‐7KD (f) cells. NC, negative control; KD: knockdown. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4 KIN17 overexpression promotes metastasis of luminal‐A (Lum‐A) breast cancer cells in vivo. (a) Photograph of representative mice six weeks after tail vein injection of MCF‐7NC2 and MCF‐7OE cells. (b) Graph showing change in bodyweight of mice six weeks after tail vein injection of MCF‐7NC2 and MCF‐7OE cells. (c) Image showing representative liver from mice which received MCF‐7NC2 and MCF‐7OE cells through tail‐vein injection. Mice were sacrificed and livers were collected six weeks after injection. (d) Western blot (top) and their quantitative analysis (bottom) showing KIN17 expression in metastatic nodules from the livers of mice injected with MCF‐7NC2 and MCF‐7OE cells. (e and f) Representative hematoxylin & eosin (H&E) staining images of liver tissues from mice injected with MCF‐7NC2 (e), and MCF‐7OE (f) cells. NC, negative control; KD, knockdown. *p < 0.05, **p < 0.01 and ***p < 0.001, n = 3–4

DISCUSSION

Breast cancer is classified into four major subtypes namely luminal‐A (ER+, PR+, HER2−), luminal‐B (ER+, PR+, HER2+), HER2+ (ER−, PR−, and HER2+) and basal‐like (ER−, PR−, HER2−, cytokeratin 5/6 positive, and/or HER1+). Each subtype exhibits a varying response to anticancer drugs. Almost 70% of breast cancer patients are confirmed to be the luminal‐A subtype. These patients usually show a good response towards hormonal therapy. However, nearly 25% of cases experience recurrent and metastatic disease. Although many new molecular targets have been identified and proposed to be targeted in the clinical to treat breast cancer, in general, and in Lum‐A breast cancer, in particular, very few have been fruitful in tackling metastatic disease. Here, using in silico, in vitro and in vivo approaches, we show that KIN17 is a key player involved in the metastatic spread of Lum‐A breast cancer MCF‐7 cells. Previous studies have shown that KIN17 plays an oncogenic role in certain tumor types via promoting tumors growth and cell proliferation and by demoting apoptotic cell death. , , , The last two decades have witnessed gene expression and proteomic profiling as powerful tools in gene‐to‐disease associations and in the identification of biomarkers of disease onset and progression. In our study, we also established a link between Lum‐A breast cancer and KIN17 gene expression through in silico approaches. The same data also suggested KIN17 plays a role in the metastatic spread of Lum‐A breast cancer MCF‐7 cells (Figure 1), which we later validated through in vitro and in vivo approaches. Metastasis is a multistep process in which selected cancer cells initially dissociate from their primary site, migrate out, undergo EMT, infiltrate into and survive in circulation and later extravasate from the circulation to develop microtumor niches at a distant site leading to metastatic tumor. Although EMT is an essential step during development, aggressive cancer cells adapt EMT‐like characteristics to gain fibroblast‐like properties such as reduced intracellular adhesion and increased motility. , This tightly regulated process is associated with a number of cellular and molecular events and involves downregulation of adhesive epithelial markers and upregulation of mesenchymal markers. , , , For instance, E‐cadherin, being an epithelial marker, is considered an active suppressor of invasion and growth of many cancer types of epithelial origin, whereas N‐cadherin has been found to be associated with increased EMT and metastatic spread in solid cancers. We could not detect E‐cadherin in our in vitro experiments, or find any significant difference in N‐cadherin expression between KIN17 knockdown/overexpression cells respective control (Figure 4). This led us to investigate other EMT associated pathways to confirm the involvement of KIN17 in EMT. Vimentin is another important player in EMT whose dynamic structural changes and spatial reorganization in response to extracellular stimuli assists in coordinating various signaling pathways to promote metastasis. Whilst Vimentin was found to be decreased upon KIN17 knockdown, it was upregulated upon KIN17 overexpression, suggesting Vimentin is an important player of EMT downstream of KIN17. A similar pattern was also observed for β‐catenin which is a key downstream effector in the Wnt signaling pathway and has been implicated in the metastatic spread of cancer cells. How the mesenchymal markers are regulated by KIN17 at molecular level needs further investigation. In conclusion, we found that KIN17 was associated with poor survival in Lum‐A breast cancer patients in silico for which our in vitro data provide evidence that KIN17 is involved in regulating migration and invasion of Lum‐A breast cancer MCF‐7 cells through promoting acquisition of EMT like phenotype, which we also validated in vivo. Overall, these results suggest that it is important to target KIN17 in metastatic Lum‐A breast cancer patients.

CONFLICT OF INTEREST

The authors declare no competing financial interests. Figure S1. Construction and verification of breast cancer cell line MCF‐7 with KIN17 knockdown or overexpression. (a and d) The components of KIN17 knockdown (a) and overexpression (d) lentivirus vectors used to infect MCF‐7 cells in this study. (b and e) Images showing morphological features (top) and EGFP based infection efficiency (bottom) of KIN17 knockdown (b) and overexpression (e) vectors. (c and f) Western blots (left) and their quantitative analyses (right) showing change in KIN protein expression upon knockdown (c) and overexpression (e) compared to respective controls. LTR, lentiviral long terminal repeat; WPRE, woodchuck hepatitis post‐transcriptional regulatory element; Puro, selection gene of puromycin; T2A, 2A peptide from Thosea Asigna virus capsid protein; F2A, 2A peptide from Foot Mouth Disease Virus capsid protein; EGFP, enhanced green fluorescent protein; CMV, cytomegalovirus; hU6, human U6 promoter; EF1, EF1 promoter; Mock, untransfected MCF‐7 cells, blank control; NC, negative control; KD, knockdown; OE, overexpression. *p < 0.05 and **p < 0. 01, n = 3. Click here for additional data file.
  37 in total

1.  KIN17, a mouse nuclear protein, binds to bent DNA fragments that are found at illegitimate recombination junctions in mammalian cells.

Authors:  A Mazin; E Milot; R Devoret; P Chartrand
Journal:  Mol Gen Genet       Date:  1994-08-15

Review 2.  Molecular Classification of Breast Cancer.

Authors:  Julia Y S Tsang; Gary M Tse
Journal:  Adv Anat Pathol       Date:  2020-01       Impact factor: 3.875

3.  Astrocytic Epoxyeicosatrienoic Acid Signaling in the Medial Prefrontal Cortex Modulates Depressive-like Behaviors.

Authors:  Wenchao Xiong; Xiong Cao; Yuanning Zeng; Xihe Qin; Minzhen Zhu; Jing Ren; Zhou Wu; Qiyuan Huang; Yuan Zhang; Mengyao Wang; Lianwan Chen; Gustavo Turecki; Naguib Mechawar; Wenjun Chen; Guoliang Yi; Xinhong Zhu
Journal:  J Neurosci       Date:  2019-03-22       Impact factor: 6.167

Review 4.  Metastasis review: from bench to bedside.

Authors:  Ali Mohammad Alizadeh; Sadaf Shiri; Sadaf Farsinejad
Journal:  Tumour Biol       Date:  2014-08-08

5.  N-cadherin promotes epithelial-mesenchymal transition and cancer stem cell-like traits via ErbB signaling in prostate cancer cells.

Authors:  Min Wang; Dong Ren; Wei Guo; Shuai Huang; Zeyu Wang; Qiji Li; Hong Du; Libing Song; Xinsheng Peng
Journal:  Int J Oncol       Date:  2015-11-26       Impact factor: 5.650

Review 6.  Hallmarks of cancer: the next generation.

Authors:  Douglas Hanahan; Robert A Weinberg
Journal:  Cell       Date:  2011-03-04       Impact factor: 41.582

7.  A mechanically active heterotypic E-cadherin/N-cadherin adhesion enables fibroblasts to drive cancer cell invasion.

Authors:  Anna Labernadie; Takuya Kato; Agustí Brugués; Xavier Serra-Picamal; Stefanie Derzsi; Esther Arwert; Anne Weston; Victor González-Tarragó; Alberto Elosegui-Artola; Lorenzo Albertazzi; Jordi Alcaraz; Pere Roca-Cusachs; Erik Sahai; Xavier Trepat
Journal:  Nat Cell Biol       Date:  2017-02-20       Impact factor: 28.824

8.  Kin17 facilitates multiple double-strand break repair pathways that govern B cell class switching.

Authors:  Michael X Le; Dania Haddad; Alexanda K Ling; Conglei Li; Clare C So; Amit Chopra; Rui Hu; Jaime F Angulo; Jason Moffat; Alberto Martin
Journal:  Sci Rep       Date:  2016-11-17       Impact factor: 4.379

9.  The kin17 Protein in Murine Melanoma Cells.

Authors:  Anelise C Ramos; Vanessa P Gaspar; Sabrina M G Kelmer; Tarciso A Sellani; Ana G U Batista; Quirino A De Lima Neto; Elaine G Rodrigues; Maria A Fernandez
Journal:  Int J Mol Sci       Date:  2015-11-24       Impact factor: 5.923

10.  Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer.

Authors:  Xiaofeng Zheng; Julienne L Carstens; Jiha Kim; Matthew Scheible; Judith Kaye; Hikaru Sugimoto; Chia-Chin Wu; Valerie S LeBleu; Raghu Kalluri
Journal:  Nature       Date:  2015-11-11       Impact factor: 49.962

View more
  3 in total

1.  BTG2 as a tumor target for the treatment of luminal A breast cancer.

Authors:  Runzhi Wang; Ronghua Wang; Jinjun Tian; Jian Wang; Huaxiao Tang; Tao Wu; Hui Wang
Journal:  Exp Ther Med       Date:  2022-03-21       Impact factor: 2.447

2.  Exosomal miR-552-5p promotes tumorigenesis and disease progression via the PTEN/TOB1 axis in gastric cancer.

Authors:  Lingyu Zhu; Suisui Zhang; Songda Chen; Huijie Wu; Mengjie Jiang; Aiqun Liu
Journal:  J Cancer       Date:  2022-01-01       Impact factor: 4.207

3.  KIN17 promotes tumor metastasis by activating EMT signaling in luminal-A breast cancer.

Authors:  Qiyuan Huang; Kashif Rafiq Zahid; Jinsi Chen; Xiangxiong Pang; Meifeng Zhong; Hongling Huang; Weifeng Pan; Jingxin Yin; Umar Raza; Jiamin Zeng; Xinhong Zhu; Tao Zeng
Journal:  Thorac Cancer       Date:  2021-05-19       Impact factor: 3.500

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.