Expression and Clinical Significance of miR-146a and Tumor Necrosis Factor Receptor-Associated Factor 6 (TRAF6) in Myasthenia Gravis Patient Serum.

OBJECTIVE: To investigate the expression and clinical significance of miR-146a and tumor necrosis factor receptor-associated factor 6 (TRAF6) in myasthenia gravis (MG) patient serum.
METHODS: The serum of 52 patients with MG and 60 healthy individuals was collected in our hospital. The expression of miR-146a and TRAF6 in serum was measured by real-time PCR (RT-PCR). Comparison among serum miR-146a and TRAF6 mRNA group clinical characteristics and assorted expressions was done with the correlation among the two groups evaluated. Logistics regression was used to analyze the effect of miR-146a and TRAF6 mRNA on MG development with the ROC curve applied for an investigation into the diagnostic role of miR-146a and TRAF6 mRNA expression in MG development.
RESULTS: miR-146a and TRAF6 mRNA were significantly increased in the patients with MG compared with the healthy controls. Significant differences were identified in respiratory muscle endurance, muscle weakness level, vital capacity, and maximal voluntary ventilation between the two groups. Additionally, correlation analysis has discovered a positive correlation between miR-146a and TRAF mRNA expression in patients with MG. miR-146a and TRAF6 mRNA are independent MG occurrence factors exhibited by multivariate analysis while areas under ROC curve (AUCs) of miR-146a and TRAF6 mRNA in MG diagnosis were established by ROC curve analysis with results being 0.782 and 0.703, correspondingly.
CONCLUSION: miR-146a and TRAF6 mRNA are highly expressed in MG patients and can affect MG occurrence. miR-146a is a suitable candidate marker for diagnosing MG.

1. Introduction

An autoimmune disease known as myasthenia gravis (MG) is triggered by nerve-muscle junction transmission dysfunction, which is clinically characterized by fluctuating weakness and easy fatigue [1]. The prevalence of MG is about 77-150/million, showing an increasing trend in recent years [2]. This disease mostly involves the respiratory muscles and throat muscles, causing dysmasesis, dysphagia, and dysphonia. In severe cases, it can affect the ability of daily living and bring a serious impact on families and society. At present, the clinical diagnosis of MG is mostly based on the results of antibody detection of neuromuscular junction antigens [3]. However, a lower antibody titer in some MG patients may lead to a higher rate of missed diagnosis, thus affecting the treatment and prognosis. Therefore, it is of great clinical importance to find new appropriate biomarkers for the diagnosis of MG.

A class of endogenous single-stranded noncoding small RNAs known as microRNAs (miRNAs) is 18-25 nucleotides in length and can regulate gene expression levels via specific binding and is key in biological processes [4]. Among them, miR-146a has been described to be abnormally expressed in a range of diseases and is linked to inflammatory factor production and disease severity [5]. It has been shown that miR-146a is highly expressed in PBMC of MG patients and is an important factor in immune homeostasis [6]. Zhang et al. [5] further improved clinical muscle weakness symptoms in experimental autoimmune MG mice by silencing the expression of miR-146a. In addition, Bortone et al. [7] found that miR-146a expression was significantly downregulated in the serum of patients with proliferative MG. All of these studies confirmed that miR-146a may be helpful in diagnosing MG and predicting progression. Previously, miR-146a has been identified as a nuclear factor-kb-dependent gene that could be involved in the regulation of interleukin 1 receptor-associated kinase 1 (IRAK1) and tumor necrosis factor- (TNF-) associated factor 6 (TRAF6) [8]. TRAF6 is an important signaling molecule. TRAF6 can act on the TNF receptor family and interleukin-1 receptor/Toll-like receptor (IL-1R/TLR) superfamily downstream signal transductions, to control adaptive and innate immunity as well as multiple tissue development in vivo [9].

Therefore, in this study, the relative mRNA miR-146a expression and TRAF6 in MG patient peripheral blood were detected and then compared with that of healthy subjects. In addition, the correlation between miR-146a and TRAF6 expressed in mRNA was examined. Our study is aimed at providing a scientific theoretical basis for a subsequent in-depth study on the role of miR-146a and TRAF6 mRNA in MG occurrence and development.

2. Methods

2.1. Study Subjects

A total of 52 patients with MG (test group) accepted to our hospital between January 2019 and January 2020 were chosen along with 60 healthy controls (control group). No noteworthy variation in age, gender, body mass index (BMI), and disease duration was present among the 2 groups (P > 0.05), which were comparable (Table 1).

Table 1

Comparing demographic data among two groups.

Variable	Test group (n = 52)	Control group (n = 60)	P
Age (year)	33.20 ± 5.8	34.0 ± 5.7	0.464
BMI (kg/m2)	22.1 ± 2.4	22.5 ± 2.3	0.370
Disease duration (month)	2.5 ± 0.3	2.4 ± 0.5	0.211
Gender
Male	28 (53.8)	33 (55.0)	0.903
Female	24 (46.2)	27 (45.0)

2.2. Inclusion and Exclusion Criteria

The inclusion criteria of the test group were as follows: (1) patients met the diagnostic criteria of MG in the Chinese Expert Consensus on the Diagnosis and Treatment of Myasthenia Gravis [10]; (2) patients were first diagnosed as MG, with clear consciousness; (3) there is no cerebral infarction, intracranial aneurysm, intracranial arteriovenous malformation, and cerebral hemorrhage disease confirmed by CT or MRI examination; and (4) patients were informed and voluntarily participate in and cooperate with the study.

The exclusion criteria of the test group were as follows: (1) with malignant tumors and severe organic diseases, such as the heart, liver, kidney, and lung; (2) combined with congenital autoimmune diseases; (3) patients using immunosuppressive drugs; and (4) patients with incomplete information. The control group was the health examination population in our hospital during the same period as the test group. The medical ethics committee of our hospital has given permission towards the research conducted.

2.3. qRT-PCR

A total of 5 mL fasting venous peripheral blood was gathered from individual study subjects early in the morning. Centrifugation of blood samples was conducted at 3000 g/min for 15 min at −4°C, and then, the upper serum was collected placed in a freezer at −80°C for subsequent experiments. Subsequently, 200 μL of serum was taken, and total RNA was isolated according to method TRIzol. After extraction, reverse transcription was performed in regard to TaqMan MicroRNA Assay Reverse Transcription Primer instructions, with the reaction environments at 16°C, 30 min; 45°C, 30 min; and 90°C, 5 min and storage at 4°C. The expression of miR-146a and TRAF6 mRNA was quantitatively detected on an ABI7500 fluorescence real-time quantitative PCR instrument according to TaqMan MicroRNA Assay TaqMan Real-Time PCR instructions: QPCR reaction settings: 95°C, 10 min; 95°C, 15 sec; and 60°C, 60 sec; 40 cycles. Relative expression of miR-146a and TRAF6 was calculated using the 2-∆∆Ct method. The primer sequences are shown in Table 2.

Table 2

Primer sequences.

Gene	Forward (5′-3′)	Reverse (5′-3′)
miR-146a	ACTGAATTCCATGGGTTGTGTC	TGACAGAGATATCCCAGCTGAAG
TRAF6	AGGAGAAGCACCTCAGTTGTA	TCGTGTGCTAAGTACTGCGG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

2.4. Reagents and Instruments

Trichloromethane (batch number: 10006818), absolute ethanol (batch number: 10009218), and isopropanol (batch number: 80109218) were provided by Sinopharm Chemical Reagent Co., Ltd. The Reverse Transcriptase Kit (batch number: C-28025M-MLV), 10 mmol/L dNTPMIX (batch number: C-18427-013), and TRIzol Reagent (batch number: 15596-026) were provided by Invitrogen Corporation. The SYBR® Premix Ex Taq™ Kit (batch number: RR420A) was provided by TaKaRa Bio lnc. TGL-16c Tabletop Centrifuge was purchased from Shanghai Anting Scientific Instrument Factory. TGL-16 Refrigerated Centrifuge was purchased from Hunan Xiangyi Laboratory Instrument Development Co., Ltd. IMS-20 Ice Maker was provided by Changshu Xueke Electric Appliances Co., Ltd. TC-XP gene amplification instrument was purchased from Hangzhou Boer Technology Co., Ltd. SW-CJ-1FD clean bench was purchased from Suzhou Antai Airtech Co., Ltd. The StepOne™ Real-Time PCR System was provided by Life Technologies Corporation.

2.5. Statistical Analysis

SPSS 17.0 software was applied to conduct statistical analysis. The mean ± standard deviation (SD) was used to described continuous variables and analyzed using a t-test. n (%) was used to define categorical data and examined by the chi-squared test. Correlation analysis was done using Spearman rank correlation. Influencing factor analysis was performed using the binary logistics regression with the forced entry method. Diagnostic efficacy was examined with the use of the receiver operating characteristic curve (ROC) with P < 0.05 defining statistical significance.

3. Results

3.1. miR-146a Location and Conservation

miR-146a is positioned on region 34 in humans, band 3 in the q (long) arm of chromosome 9 (136670602-136670686), with a length of about 85 bp. Its nucleotide sequence is highly conserved among seven species: human, chicken, dog, mouse, elephant, African clawed frog, and rhesus monkey, as shown in Figure 1.

Figure 1

Location and conservation analysis of miR-146a in the human genome.

3.2. Relative Expression of miR-146a and TRAF6 mRNA

A noteworthy variance was observed in relative mRNA expression of miR-146a and TRAF6 among the 2 groups (P < 0.05) with relative mRNA expression of miR-146a and TRAF6 in the test group higher in comparison to the control group (Figure 2).

Figure 2

Comparing relative miR-146a and TRAF6 expressed mRNA concerning the two groups. ∗P < 0.01 vs. control group; #P < 0.05 vs. control group.

3.3. Comparison of Clinical Characteristics among the 2 Groups

There were substantial variances in respiratory muscle endurance, muscle weakness level, vital capacity, and maximal voluntary ventilation between the two groups (P < 0.05). All these indexes in the test group were lower when compared to the control group (Table 3).

Table 3

Comparing respiratory function indexes concerning 2 groups.

Variable	Test group (n = 52)	Control group (n = 60)	t value	P
Respiratory muscle endurance (%)	72.5 ± 10.8	83.7 ± 12.7	4.986	<0.001
Muscle weakness level (score)	13.4 ± 3.8	11.0 ± 1.5	4.506	<0.001
Vital capacity (%)	83.4 ± 7.5	90.3 ± 9.4	4.249	<0.001
Maximal voluntary ventilation (%)	91.4 ± 6.6	95.7 ± 7.8	3.123	0.002

3.4. Correlation among Serum miR-146a and TRAF6 mRNA Expression

A positive correlation among serum miR-146a and TRAF6 mRNA expression in the test group (P < 0.05) was observed, while no momentous correlation among the two in the control group (P > 0.05) was observed (Table 4).

Table 4

Correlation between serum miR-146a and TRAF6 mRNA expression.

Serum miR-146a expression	Relative expression of TRAF6 mRNA
	r s	P
Test group	2.826	<0.001
Control group	1.211	0.002

3.5. Multivariate Analysis of Serum miR-146a and TRAF6 mRNA Expression Effects on MG Development

The results of multivariate analysis of the effect on MG development showed that miR-146a and TRAF6 mRNA were both independent factors for MG development after adjusting for confounders (P < 0.05). Higher expressed miR-146a and TRAF6 mRNA led to an increased risk of MG occurrence (Table 5).

Table 5

Effect of expressed miR-146a and TRAF6 mRNA on MG occurrence.

Variable	Model I			Model II
	OR	95% CI	P	OR	95% CI	P
miR-146a	2.125	1.741~2.852	<0.001	1.996	1.652~2.385	<0.001
TRAF6 mRNA	1.879	1.455~2.223	0.003	1.527	1.239~1.775	0.014

Model I: no adjustment. Model II: adjusting respiratory muscle endurance, muscle weakness level, vital capacity, and maximal voluntary ventilation.

3.6. Effect Serum miR-146a and TRAF6 mRNA Expression in MG Diagnosis

ROC curve analysis showed that the area under the ROC curve (AUC) of serum miR-146a and TRAF6 mRNA expression in the detection of MG was 0.782 and 0.703, correspondingly (P < 0.05). Sensitivity, specificity, and Youden index of serum miR-146a expression in the diagnosis of MG were 73.2%, 67.6%, and 0.408, respectively, while those of TRAF6 mRNA expression were 60.7%, 71.6%, and 0.323, respectively (Table 6).

Table 6

ROC curve analysis of expressed serum miR-146a and TRAF6 mRNA in MG diagnosis.

Variable	AUC	Standard error	95% CI	P	Sensitivity	Specificity	Youden index
miR-146a	0.782	0.032	0.672~0.893	<0.001	73.2%	67.6%	0.408
TRAF6 mRNA	0.703	0.037	0.631~0.865	0.011	60.7%	71.6%	0.323

4. Discussion

MG is an acquired T cell-dependent autoimmune disease, and acetylcholine receptor antibody (AChR-Ab) is the main serological marker for MG in clinical practice [11]. Although AChR-Ab is widely used in clinical diagnosis, it is not sensitive and has no correlation with the disease severity, which cannot distinguish different types of MG. Therefore, it is important to find serological markers with higher diagnostic value for early diagnosis of MG, so as to guide clinical personalized treatment and to prevent poor prognosis. The innovation of this study is that by determining the expression and clinical significance of miR-146a and TRAF6 mRNA in MG, miR-146a and TRAF6 mRNA are abnormally exceedingly expressed in MG, and miR-146a and TRAF6 may be key in the occurrence of MG through interaction. In addition, miR-146a and TRAF6 can be used as candidate markers for the early diagnosis of MG. Higher expression of miR-146a and TRAF6 indicates an increased risk of MG occurrence.

miR-146a is a kind of endogenous single-stranded noncoding small RNA. In previous studies [12, 13], miR-146a has proven to be crucial in inflammation and immune response. It can negatively regulate the innate immune intensity of the body by acting on TRAF6, an important molecule in the Toll-like receptor 4 antibody (TLR4)/myeloid differentiation factor 88 (MyD88)/nuclear factor-B (NF-B) signaling pathway. Therefore, the increased levels of miR-146a and TRAF6 expressed can enhance immune suppression and weaken the innate immune intensity, thus increasing the risk of occurrence of the immune-related disease MG from the research conducted; the serum miR-146a and TRAF6 mRNA levels expressed in MG patients were higher when in comparison with healthy subjects. Meanwhile, respiratory muscle function in MG patients was lower when in comparison with healthy controls, suggesting that the serum miR-146a and TRAF6 mRNA levels expressed in MG patients were abnormally increased. Collectively, both serum miR-146a and TRAF6 may be paramount in MG occurrence and can be selected as candidate diagnostic markers for MG in clinical practice. In addition, MG mostly involves respiratory muscle function, resulting in significantly lower respiratory function than the healthy subjects and poor prognosis if without timely treatment. Therefore, early diagnosis of MG is of great significance.

TRAF6 is a group formed of six intimately linked TRAF proteins, which are widely present in the CD4+ Treg stage in vivo and can mediate the expression of Treg in the periphery and maintain its function [14, 15]. TRAF6 can also play an important role in immunity as a critical adaptor molecule of both TNFR and Toll-like/IL-1 receptor (TIR) superfamily [16]. It is found that upregulated miR-146a acts on TRAF6 to achieve negative feedback regulation of TLR signaling pathways, thereby preventing excessive inflammation [17]. In this study, a positive correlation among serum miR-146a and TRAF6 mRNA (P < 0.05) was observed. High expression of serum miR-146a and TRAF6 mRNA was an independent risk factor for MG occurrence (P < 0.05). The above results suggested that miR-146a might promote TRAF6 mRNA expression to be involved in immune-related signaling pathways downstream of TRAF6, causing the destruction of AChR in the postsynaptic membrane by autoantibodies, thus leading to MG occurrence.

In routine examinations for the diagnosis of MG in clinical practice, 50% and more are negative results, making it difficult to determine the diagnosis. And the efficiency of electrophysiological tests and serum antibody examination used in recent years is low, which are often taken at a certain time [18]. Bedside examinations such as the fatigue test, eyes-closed resting test, orbital cooling (ice test), and sleep test are also unsatisfactory options for the diagnosis of MG, which have high false positive rates [19]. In this study, the AUC of serum miR-146a and TRAF6 mRNA expression in MG diagnosis was 0.782 and 0.703, correspondingly, suggesting a good diagnostic effect. Our results suggest that the detection of serum miR-146a and TRAF6 mRNA levels expressed in MG suspected patients in clinical practice can diagnose MG early, and timely treatment measures can be performed.

However, the research conducted contains some limitations. First, a minor sample size from only one hospital was used, so there may be selection bias. Second, the expressions of miR-146a and TRAF6 mRNA among patients with different types of MG are not compared, so the reliability of the conclusion in this study is limited. Third, the mechanism was not examined in this study; therefore, miR-146a and TRAF6 mRNA-specific role in MG occurrence and development cannot be explained. Finally, miR-146a and TRAF6 mRNA diagnostic efficacy was not compared with that of common diagnostic indicators for MG. Further multicenter studies with a larger sample size are still needed.