Literature DB >> 33987408

The G199X and V157fs mutations in the TP53 gene promote malignancy in serous ovarian cancer: an analysis using whole-exome sequencing.

Dan Su1,2, Man Nie1,2, Jun Yue1,2.   

Abstract

BACKGROUND: The carcinogenic mechanisms underlying serous ovarian cancer are not fully understood.
METHODS: Whole-exome sequencing and targeted sequencing were performed in ovarian cancer samples to identify novel molecular markers involved in the process of cell malignancy in ovarian cancer. In vitro experiments, the oncogenic roles such as cell proliferation, migration and invasion of TP53 G199X and V157fs mutations were investigated deeply.
RESULTS: The present study identified the G199X and V157fs point mutations in the tumor protein P53 gene (TP53). The rate of TP53 mutation was 59.2% in a cohort of 76 ovarian cancer patients, compared with 9.0% in a cohort of 156 healthy women. Kaplan-Meier analysis showed that patients with a TP53 mutation had a lower 5-year overall survival (OS) rate compared with patients harboring wild type TP53. In vitro experiments in an ovarian cancer cell line demonstrated that the G199X and V157fs mutants inhibited P53 protein expression, enhanced proliferation, promoted migration and increased invasion.
CONCLUSIONS: This study identified two novel markers, TP53 G199X and V157fs mutations in TP53. Functional assays indicated that these mutations enhanced the malignant phenotype in ovarian cancer cells. These novel markers will assist in the diagnosis of ovarian tumors and represent potential targets for the treatment of TP53 mutant ovarian cancers. 2021 Annals of Translational Medicine. All rights reserved.

Entities:  

Keywords:  Serous ovarian cancer; TP53 mutation; cell malignancy; survival; whole-exome sequencing

Year:  2021        PMID: 33987408      PMCID: PMC8106005          DOI: 10.21037/atm-21-583

Source DB:  PubMed          Journal:  Ann Transl Med        ISSN: 2305-5839


Introduction

Ovarian cancer represents the deadliest gynecologic malignancy (1). The World Health Organization (WHO) estimates that approximately 225,500 new ovarian cancer cases and 140,200 related deaths occur each year (2). High-grade serous ovarian cancer (HGSOC) is often detected in women at stage III or IV, with 5-year survival rates in the range of 26–42% (3). New treatments such as targeted therapy have emerged, with various targets being explored. Since the discovery of BRCA1 and BRCA2 mutations, HGSOC patients with these two mutations have been shown to benefit significantly from Olaparib compared to non-carriers (4). With the development of clinical genetics, novel candidates are urgently needed for improving ovarian cancer diagnosis and treatment. Recently, multi-gene panels have been used to assess gene mutations, with a large amount of unknown but significant variants identified. While exons only represent 1.5% of all genomic DNA, they are implicated in most human diseases. Whole exome sequencing only assesses exons or protein coding regions, however, it has already been applied in prenatal diagnosis (5). Next generation sequencing (NGS) technologies provide rapid replication of susceptible genes in large sample sizes. In addition, it can be used to examine the coding regions in the human genome that may contribute to disease predisposition. This current investigation aimed to identify candidate genes with uncommon mutations associated with serous ovarian cancer using whole-exome sequencing and targeted sequencing. In vitro experiments were conducted to detect the functions and impacts of these mutations on oncogenesis. We present the following article in accordance with the MDAR reporting checklist (available at http://dx.doi.org/10.21037/atm-21-583).

Methods

Patients and specimens

A total of 88 serous ovarian tumor and para-tumor tissue specimens were obtained from 76 individuals treated in the Department of Gynecology and Obstetrics, Sichuan Academy of Medical Sciences & Sichuan Provincial People’s Hospital, People’s Republic of China from 2015 to 2020. For whole-exome sequencing, 24 samples were obtained from 12 patients at the time of diagnosis (tumor and para-tumor tissues). Targeted deep sequencing was conducted on another 64 ovarian cancer tissue specimens obtained from pathology slides. Peripheral blood samples were collected from 156 healthy women as control samples for the targeted deep sequencing studies. All procedures performed in this study involving human participants were in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Ethics Committee of Sichuan Provincial People’s Hospital and signed informed consents were obtained from all participants.

DNA isolation and whole-exome sequencing

DNA was extraction from primary ovarian cancers and matched para-tumor tissue specimens from the same individuals. The TruSeq DNA Sample Preparation Kit (Illumina) was used for preparation of the DNA library. Exomes were enriched in-solution with Agilent SureSelectXT Human All Exon Kit V6, and DNA sequencing was performed with a SureSelectXT Reagent kit on a Hiseq2000 Sequencing System (Illumina).

Targeted gene sequencing

The candidate gene was screened to detect mutations in 220 samples (including 64 cancer tissues and 156 normal blood samples) using Illumina cBot Cluster Station/Illumina Hiseq. Nextera Rapid Capture Exome Kit (Illumina) was utilized for library construction and exome enrichment. NGS results were primarily assessed by generating FASTQ files and assessing data quality. The obtained reads underwent alignment with the human reference genome hg19.

Copy number (CN) variation detection

Approximately 250 ng of DNA/specimen was used for hybridization using CytoScan 750K Array (Affymetrix) according to the manufacturer’s instructions. Data analysis was performed using the Picard Software (https://broadinstitute.github.io/picard/), and the SNP-FASST2 segmentation algorithm was applied for normalization. After normalization, Nexus v7.5 was used to visualize probe intensity and allele ratio. All primers and probes were provided by Applied Biosystems.

Patient data

Patient data were obtained from the medical records system and follow-up records. Collated data included drugs administered, physical examinations, and laboratory results. Follow-up duration was the time from surgical treatment to disease progression/relapse, death, final hospital visit, or phone call. Overall survival (OS) was assessed from the date of surgical treatment to death. The cut-off time for survival analysis was February 2021.

Cell culture and transfection

Ovarian cancer A2780 cells were purchased from BNCC (BeNa Culture Collection, Beijing, China) and cultured in complete Roswell Park Memorial Institute (RPMI)-1640 medium. A2780 cells lack endogenous TP53 expression (6). For transfection, plasmids were purchased from YouBio (Changsha, China). TP53 bearing the G199X (7578254:C>A) and V157fs (7578459-7578459:ins A) mutations were introduced into the pcDNA3.1 plasmid using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, USA). The following primers were used: CCGAGTGGAATGAAATTTGCG (forward) and ATAAGATGCTGAGGAGGG (reverse) for G199X, and TCCGCGCCATGGCCATCTACAAGCAGTCAC (forward) and ACGCGGGTGCCGGGCGGG (reverse) for V157fs. The resulting constructs were confirmed by Sanger sequencing and were transfection into A2780 cells with Lipofectamine 3000 (Invitrogen, USA) as per the manufacturer’s protocols. Meanwhile, wild-type TP53 and empty vector plasmids were transfected as controls.

Western blot analysis

After 48 hours of transfection, A2780 cells were collected and lysed. The lysates underwent fractionation, electroblotting, and overnight incubation at 4 °C with primary antibodies targeting P53 (1:200; mouse monoclonal) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH 1:1,000). Subsequently, goat anti-mouse secondary antibodies (1:1,000) were probed at 25 °C for 1 hour, and the membranes were exposed to films. Immunoreactivity was determined using Fusion FX7 Spectra (Vilber, France). All antibodies were purchased from Cell Signaling Technology (USA).

Cell Counting Kit-8 (CCK-8) assay

The CCK-8 assay was performed to assess cell proliferation. Briefly, cells were plated into 96-well plates at 1×104 cells per well in triplicates, and transfected with plasmids bearing the G199X or V157fs mutation, or the empty vector. After 48 hours, 10 µL CCK-8 reagent (Boster, USA) was added per well, followed by incubation at 37 °C for 1 hour. Optical density at 450 nm was obtained after 12, 24, 36, and 48 hours on a Model 680 Microplate Reader (Bio-Rad, USA).

Scratch wound-healing assay

The scratch wound-healing assay was conducted to assess cell migration. Cells in 6-well plates were grown to 80% confluency, and a scratch was created with a 10-µL pipette tip on the cell monolayer to obtain a cell-free zone. Cells were then incubated in serum-free culture medium. Cells migrating into the cell-free zone were monitored after 24 hours under an OLYMPUS IX71 inverted microscope (Olympus, Japan), and the percentage of wound closure was analyzed with ImageJ software.

Transwell assay

The transwell assay was performed to evaluate cell invasion ability. Briefly, after Matrigel (Corning, USA) coating, 2×105 cells were suspended in serum-free culture and added to the upper chambers. After a 48-hour incubation at 37 °C, the cells remaining in the upper chambers were gently swabbed. Cells that had migrated through the membrane underwent methanol fixation and crystal violet (0.1%) staining. Ten randomly selected high-power fields (×400) per specimen were analyzed under an OLYMPUS IX71 inverted microscope (Olympus).

Statistical analysis

The SPSS 22.0 software was used for data analysis. Results are expressed as mean ± standard error of the mean (SEM). The association of mutations with clinical features was examined by the χ2 test. OS was analyzed using the Kaplan-Meier test. Student’s t-test was performed for comparisons. Results were considered statistically significant when P<0.05.

Results

Whole-exome sequencing detected mutated genes in ovarian cancer samples

Whole-exome sequencing was performed to examine 12 pairs of serous ovarian cancer tissue specimens and case-matched normal tissue samples to profile somatic mutations. In the present study, 52,464 somatic single nucleotide variants (SNVs), including 27,130 nonsynonymous and 25,334 synonymous SNVs, were identified in ovarian cancer exomes. Of these, 484 were non-frameshift deletions, 347 were stop-gain mutations, 270 were frameshift deletions, 327 were non-frameshift insertions, 172 were frameshift insertions, and 27 were stop-loss mutations. The C>T substitution had the highest frequency among substitution types in serous ovarian cancer. Moreover, C>T mutations at the TCN sites dominated in the trinucleotide signature, particularly in TCA containing sequences ().
Figure 1

Somatic single nucleotide variant (SNV) signature in ovarian cancer. The 52,464 somatic SNVs (including 27,130 nonsynonymous and 25,334 synonymous SNVs) were identified in ovarian cancer exomes.

Somatic single nucleotide variant (SNV) signature in ovarian cancer. The 52,464 somatic SNVs (including 27,130 nonsynonymous and 25,334 synonymous SNVs) were identified in ovarian cancer exomes. In total, 25 non-silent mutations were most frequently detected in ovarian cancer samples, including in the mucin 4 (MUC4; 66.7%), titin (TTN; 50.0%), TP53 (41.7%), and serine protease 3 (PRSS3; 41.7%) genes (). Since TP53 mutations have been reported to occur in more than 50% of human tumors (7), TP53 was selected as a candidate gene for subsequent analyses. A total of 5 point mutations in the TP53 gene was identified in 5 cases, including p.R123W (7577094:G>A), p.R273H (7577120:C>T), p.G199X (7578254:C>A), p.H154R (7578271:T>C), and V157fs (7578459-7578459:ins A). Among them, 3 mutations were synonymous or hotspots, while the remaining 2, named G199X and V157fs, were newly discovered. G199X is a stop-gain mutation while V157fs is a frameshift insertion. Although TP53 mutations have been shown to be related to ovarian cancer, G199X (7578254:C>A) and V157fs (7578459-7578459:ins A) have not been previously reported.
Figure 2

Gene mutations in ovarian cancer. The top bar plot shows the average number of somatic mutations. The bottom left plot shows the somatic mutation frequency. Rows represent individual genes and columns represent individual tumors in the bottom middle plot. Mutations are colored according to mutation type in the bottom right plot.

Gene mutations in ovarian cancer. The top bar plot shows the average number of somatic mutations. The bottom left plot shows the somatic mutation frequency. Rows represent individual genes and columns represent individual tumors in the bottom middle plot. Mutations are colored according to mutation type in the bottom right plot.

Next-generation sequencing (NGS) detected TP53 mutations in clinical samples

NGS was used to sequence TP53 in 220 samples, including another 64 cases confirmed with high-grade (III–IV serous ovarian cancer by pathology after surgery, and 156 blood samples from healthy women. Combining the whole-exome data and the targeted sequencing data, a total of 76 specimens were assessed (12 samples in the whole-exome analysis and 64 samples in targeted gene sequencing). A total of 45 samples showed TP53 mutations (5 in the whole-exome analysis and 40 in the targeted gene sequencing analysis). TP53 mutations were identified in 59.2% (45 of 76) of the cancer cases. In the control group including 156 healthy women, the TP53 mutation rate in blood samples was approximately 9.0%, which was much lower than that of the ovarian cancer group.

TP53 mutations and clinical outcomes

The 76 ovarian cancer patients were followed up to assess their clinical data. Patients with TP53 mutations (n=45) had significantly poorer prognosis compared to patients with wild type TP53 (n=31), with Kaplan-Meier analysis showing a median survival of 34 and 41 months, respectively (χ=4.176, P=0.041; ). The 5-year OS rate was significantly lower (approximately 33.3%) in the TP53 mutation group compared with the TP53 wild type group (45.2%, P<0.05).
Figure 3

The impact of TP53 mutations on clinical outcomes. Cases with TP53 mutations (n=45) demonstrated poorer overall survival compared to cases with TP53 wild type (n=31).

The impact of TP53 mutations on clinical outcomes. Cases with TP53 mutations (n=45) demonstrated poorer overall survival compared to cases with TP53 wild type (n=31).

TP53 G199X and V157fs mutants inhibited P53 expression

To verify the tumorigenicity of TP53 mutations, the TP53 mutants were overexpressed in the P53-defective human serous ovarian cancer cell line A2780. Cells were transfected with plasmids harboring the G199X (7578254:C>A) mutant or the V157fs (7578459-7578459:ins A) mutant. Western blot analysis showed that transfection with wild typeTP53 resulted in increasing P53 protein expression in A2780 cells compared with control cells (empty vector). Overexpression of the G199X or V157fs mutant resulted in no detectable P53 protein expression (). These results demonstrated that the TP53 G199X and V157fs mutants inhibited P53 expression in A2780 cells.
Figure 4

The proliferation, migration, and invasion effects of TP53mutants (G199X and V157fs) on A2780 cells. (A) Transfection with the TP53 mutants(G199X and V157fs) inhibited P53 expression in A2780 cells; (B) the CCK-8 assay demonstrated that transfection with TP53 mutants (G199X and V157fs) promoted cell proliferation; (C) the scratch wound-healing assay showed that transfection with TP53 mutants (G199X and V157fs) promoted cell migration. Left panel, representative images (×100); right panel, quantitative analysis (*, P<0.05); (D) the transwell chamber assay revealed that transfection with TP53 mutants (G199X and V157fs) increased cell invasion. Left panel, representative images (stained with HE, ×100); right panel, quantitative analysis (**, P<0.01).

The proliferation, migration, and invasion effects of TP53mutants (G199X and V157fs) on A2780 cells. (A) Transfection with the TP53 mutants(G199X and V157fs) inhibited P53 expression in A2780 cells; (B) the CCK-8 assay demonstrated that transfection with TP53 mutants (G199X and V157fs) promoted cell proliferation; (C) the scratch wound-healing assay showed that transfection with TP53 mutants (G199X and V157fs) promoted cell migration. Left panel, representative images (×100); right panel, quantitative analysis (*, P<0.05); (D) the transwell chamber assay revealed that transfection with TP53 mutants (G199X and V157fs) increased cell invasion. Left panel, representative images (stained with HE, ×100); right panel, quantitative analysis (**, P<0.01).

TP53 G199X and V157fs mutants promoted A2780 cell proliferation

To assess the effect of TP53 mutations on cell proliferation, the CCK-8 assay was performed in A2780 cells. Overexpression of the G199X and V157fs mutants resulted in increased A2780 cell proliferation compared with control cells (P<0.05; ), while overexpression of wild type TP53 suppressed cell proliferation compared with control cells. These findings suggested that the TP53 G199X and V157fs mutants increased the cell proliferation ability of A2780 cells.

TP53 G199X and V157fs mutants promoted A2780 cell migration

To determine the effects of the TP53 G199X and V157fs mutants on cell migration, a scratch wound-healing assay was carried out. After 24 hours, migration was higher in cells expressing G199X and V157fs compared with cells transfected with wild type TP53 (). The cells in the V157fs and G199X groups had migrated to filled half of their respective scratched areas, while little change was observed in the wild-type group. This suggested that the TP53 G199X and V157fs mutations enhanced the migratory ability of ovarian cancer cells.

TP53 G199X and V157fs mutants increased A2780 cell invasion

The effects of the TP53 G199X and V157fs mutants on cell invasion were determined using Matrigel™ in the transwell assays. After transfection, cells expressing TP53 G199X and V157fs invaded significantly more compared to the wild-type and control counterparts (). These results suggested that the TP53 G199X and V157fs mutations increased the invasive properties of ovarian cancer cells.

Discussion

The 5-year OS rate for HGSOC patients is approximately 45%. However, vastly different outcomes are associated with the various stages of the disease. While stage I and II HGSOC patients have a 5-year OS rate exceeding 70%, the OS for individuals with late stage (III and IV) disease is only 26–42% (3). Novel treatments such as gene therapy have emerged in recent years. The United States Food and Drug Administration (FDA) has approved Olaparib, a poly-ADP ribose polymerase (PARP) suppressor, as third-line or later-line treatment for germline BRCA mutant (gBRCAmt) ovarian cancer (8). Olaparib has been shown to prolong the progression-free survival (PFS) of patients with gBRCAmt or somatic BRCA1/2 mutant (sBRCAmt) cells. A methylated derivative and structural analogue ofPRIMA-1, i.e., APR-246, and a third generation thiosemicarbazone developed by Critical Outcome Technologies Inc. (COTI-2) COTI-2 were reported to reactive mutant p53 protein by converting it to a form exhibiting wildtype properties. A phase I/IIa clinical trial to advanced serous ovarian cancer with APR-246 reported no major adverse effect (9). Multiple additional genes harboring low-penetrance mutations, including ATM (ataxia telangiectasia-mutated gene), BARD1 (BRCA1-associated RING domain protein 1), BRIP1 (BRCA1 interacting protein C-terminal helicase 1), CHEK2 (checkpoint kinase 2), PALB2 (partner and localizer of BRCA2), RAD51C (RAD51paralog C), and RAD51D (RAD51paralog D), have been linked to a greater risk of ovarian cancer (2). Gene mutations have been tested concurrently by multiple assays to identify unknown significant variants for disease diagnosis and treatment. The present study identified two point mutations in the TP53 gene in ovarian cancer tissues using whole-exome sequencing combined with NGS. Plasmids carrying TP53 wild-type, or the TP53 mutants G199X and V157fs, were transfected into A2780 cells. The TP53 mutations G199X and V157fs both inhibited P53 protein expression. In addition, these mutations promoted cell migration, invasion, and proliferation in ovarian cancer cells. Furthermore, the TP53 mutation status was correlated to the OS in ovarian cancer patients and may represent a predictive indicator. In this study cohort, the TP53 mutation rate in patients with serous ovarian cancer was 59.2%. The Cancer Genome Project revealed high-grade serous ovarian adenocarcinoma featured TP53 mutations in 96% of the cases studied (10). However, Song et al. (11) reported relatively lower TP53 mutation rates in Chinese HGSOC patients with a rate of 52.3%. The latter is similar to the mutation rate observed in our study. This variance has been reported with other cancers. Gouas et al. (12) reported that the rate ofTP53 mutation was 75% in hepatocellular carcinoma patients in high-incidence areas of China or East Africa. However, incidences of TP53 mutation are rarer in hepatocellular carcinoma in Europe and the United States, and this may be due to site-specific mutagenesis by aflatoxin. The differences in the mutation rate of TP53 may be due to different mutation sites caused by variations in diet, living habits, and even geographical differences, and this warrants further research. The whole-exome sequencing data for ovarian cancer samples detected five point mutations in the TP53 gene in five cases, including p.R123W (7577094:G>A), p.R273H (7577120:C>T), p.G199X (7578254:C>A), p.H154R (7578271:T>C), and p.V157fs (7578459-7578459:ins A). Among them, 3 mutations were synonymous or hotspots, while the remaining 2 mutations, namely G199X and V157fs, had not been previously discovered. Prior evidence suggested that theTP53 R273H, R248Q, R175H, and R248W point mutations were the four most frequent mutations (or “hotspots”) in many cancers, including bladder, lung, liver, breast, larynx, and skin cancers (13). In ovarian cancer, TP53 mutations includingp.E298X, p.R248Q, p.Y163C, c.997delG, and c.833delC have been reported (14,15). Other studies have shown that approximately 75% of TP53 mutations were of the missense type. TP53 point mutations in most cancers are most often detected in the amino acid codons of this gene. Approximately 80% are clustered between exons 5 and 8, which encodes the highly conserved DNA binding domain of the P53 protein. In our study, G199X in exon 6 and V157fs in exon 5 were stop-gain mutations and frame-shift insertions, respectively. The mutations generated 3 different phenotypes according to their impacts on P53 protein function, including loss of function, dominant negative, and gain of function (16). In 10,522 cancer genomes from The Cancer Genome Atlas, more than 91% of TP53-mutant cancers exhibit second allele loss by mutation, chromosomal deletion, or copy-neutral loss of heterozygosity. TP53 mutations are associated with enhanced chromosomal instability, including increased amplification of oncogenes and deep deletion of tumor suppressor genes. Tumors with TP53 mutations differ from their non-mutated counterparts in RNA, miRNA, and protein expression patterns, with mutant TP53 tumors displaying enhanced expression of cell cycle progression genes and proteins (17). In this study, patients with the TP53 G199X and V157fs mutations showed reduced OS, suggested that TP53 mutations induced gene signatures with poor prognosis in ovarian cancer, consistent with the current observations. Between 65–90% of studies in the literature have reported that TP53 mutations are linked to poor prognosis in cancers such as breast, head and neck, bladder, colorectal, and hematological malignancies. In a large-scale study of 264 HGSOC cases, Brachova et al. (18) concluded that individuals harboring oncomorphicTP53 mutations had markedly reduced PFS. Previous investigations have also demonstrated that TP53 mutations can promote drug resistance in a growing array of clinical malignancies (13). However, many studies still reported a lack of such associations, and few reported a contrary trend. For instance, in brain, lung, and ovarian cancers, 50% of reports detected no association between TP53 mutations and patient outcomes. In fact, some studies have even shown thatTP53 mutations may be associated with good prognosis (13). Kang et al. (19) found no marked differences in OS and PFS between gain of function (GOF) by missense mutations in exons 4–9 and no evidence GOF (NE-GOF) mutp53 patients. One possible reason was that the TP53 mutation resided in a different exon or functional domain, even in the non-specific residue (7,20). According to prognostic related genes, 1915, 1194, 822, 423 and 291 were identified good prognostic genes for the HGSCs and LGSCs. Additionally, 2075, 2274, 724, 535 and 303 genes were identified bad prognostic (21). Nakayama (22) revealed global gene upregulation by mutant p53using RNA sequencing analyses and concluded that mutant p53 inducing colorectal cancer progression was not only by a cell intrinsic mechanism, but also by the generation or activation of the microenvironment. Tumor microenvironment (TME) including immune cells and immunoregulatory molecules are involved both in anti-tumor immune responses of the host and in immunosuppressive mechanisms promoting cancerprogression.TP53 mutation was enriched in samples with higher aneuploidy, which was anti-correlated with expression of immune signaling genes (23). Tumor-infiltrating lymphocytes (TILs) infiltrate to the tumor epithelium (intraepithelial, i.e., TILs) or locate at the peritumoral stroma (stromal, sTILs) (24). Tumor-associated macrophages (TAMs) are further divided into M1 and M2subtypes, of which M1 TAMs contribute to elimination of cancer cells, whereas anti-inflammatory M2 type is involved with tissue repair, angiogenesis and cancer progression (25). TP53 acts as a physiological break forM2 macrophages polarization (26). CD8+ T cells play a critical role in controlling the metastasis and prognosis of cancer (27,28), such as in ovarian cancer (29). Jäntti et al. (29) detected that combined high intraepithelial CD8 and granzyme B expression correlated with prolonged PFS of high-grade serous ovarian cancer patients. Yang et al. (30) reported that the patients with higher CD274, CD8A, GZMA, HLA-A, HLA-B, HLA-C, IRF1, and PRF1 expression levels had significantly longer overall survival in the high-grade serous carcinoma. Ovarian Serous Cystadenocarcinoma (OV) patients with mutant TP53 had significantly higher macrophages infiltration than those with wild-type TP53 (P value <0.05) and poor prognosis associated (21). In the present study, the TP53 G199X and V157fs mutations triggered malignancy by promoting cell migration, invasion, and proliferation. TP53 encodes the P53 protein and is a tumor suppressor gene. P53 regulates cell proliferation, DNA repair, programmed cell death, genomic stability, senescence, and metabolic homeostasis (31). Liu et al. (32) reported that TP53 mutations could lead to dysfunction of the tumor suppressor Rb protein (pRb), which may cause cervical cancer. The possible mechanisms by which TP53 mutations enhance cell proliferation may lie in regulation of the nuclear transcription factor Y (NF-Y) target genes [CCNA (cyclin A), CCNB2 (cyclin B2), CDK1 (cyclin-dependent kinases 1), and CDC25C (cell division cyclin 25 homolog C)] (33), MAP2K3 (mitogen-activated protein kinase 3) (34), and MAD1L1 (MAD1 mitotic arrest deficient-like 1) (35). Mutant TP53 variants were associated with higher levels of immune cells such as stromal CD3+, CD4+ and FOXP3+ cells in breast ductal carcinoma in situ and increased the growth rate of tumors (36). In addition, mutant P53 up-regulated invasiveness may be mediated through NF-κB target genes, including chemokine (C-X-C motif) ligand 1 (CXCL1), interleukin 1β and metalloproteinase 3 (MMP3) (13). As to migration and metastasis, mutant p53 in vivo could form a complex with phosphorylated Smad2 and p63, simultaneously blocking wild-type p63 transcriptional targets while activating oncogenic genes, such as SHARP1(split and hairy related protein-1), Dicer, and cyclin G2 (37). Weissmueller et al. (38) demonstrated that mutant p53 could directly bind to p73, preventing p73-mediated inactivation of platelet-derived growth factor β (PDGFβ), resulting in an invasive and metastatic phenotype in a pancreatic cancer mouse model. Our future studies will investigate whether TP53 G199X and V157fs mutations cause tumorigenesis through the above-mentioned pathways or genes. Overall, the present study identified high rates of TP53 G199X and V157fs mutations in ovarian cancer using whole-exome sequencing. These mutations are related to tumorigenesis by promoting tumor cell migration, invasion, and proliferation. Moreover, such mutations were associations with poor prognosis. The current findings suggest that TP53 mutations may provide novel insights into ovarian cancer and may serve as potential diagnostic and therapeutic targets. However, the limited number of patients in the present study precluded the possibility of exploring this further, and future large-scale studies are warranted. The article’s supplementary files as
  38 in total

1.  Integrated Analysis of TP53 Gene and Pathway Alterations in The Cancer Genome Atlas.

Authors:  Lawrence A Donehower; Thierry Soussi; Anil Korkut; Yuexin Liu; Andre Schultz; Maria Cardenas; Xubin Li; Ozgun Babur; Teng-Kuei Hsu; Olivier Lichtarge; John N Weinstein; Rehan Akbani; David A Wheeler
Journal:  Cell Rep       Date:  2019-07-30       Impact factor: 9.423

2.  Characterization of immunoreactivity with whole-slide imaging and digital analysis in high-grade serous ovarian cancer.

Authors:  Tiina Jäntti; Satu Luhtala; Johanna Mäenpää; Synnöve Staff
Journal:  Tumour Biol       Date:  2020-11

3.  Molecular profiles of BRCA1-associated ovarian cancer treated by platinum-based therapy: Analysis of primary, residual and relapsed tumors.

Authors:  Anna P Sokolenko; Ilya V Bizin; Elena V Preobrazhenskaya; Tatiana V Gorodnova; Alexander O Ivantsov; Aglaya G Iyevleva; Elena L Savonevich; Khristina B Kotiv; Ekaterina Sh Kuligina; Evgeny N Imyanitov
Journal:  Int J Cancer       Date:  2019-11-29       Impact factor: 7.396

4.  A unique role for p53 in the regulation of M2 macrophage polarization.

Authors:  L Li; D S W Ng; W-C Mah; F F Almeida; S A Rahmat; V K Rao; S C Leow; F Laudisi; M T Peh; A M Goh; J S Y Lim; G D Wright; A Mortellaro; R Taneja; F Ginhoux; C G Lee; P K Moore; D P Lane
Journal:  Cell Death Differ       Date:  2014-12-19       Impact factor: 15.828

5.  Neoadjuvant chemotherapy (NACT) increases immune infiltration and programmed death-ligand 1 (PD-L1) expression in epithelial ovarian cancer (EOC).

Authors:  S J L Mesnage; A Auguste; C Genestie; A Dunant; E Pain; F Drusch; S Gouy; P Morice; E Bentivegna; C Lhomme; P Pautier; J Michels; A Le Formal; B Cheaib; J Adam; A F Leary
Journal:  Ann Oncol       Date:  2017-03-01       Impact factor: 32.976

6.  PARP inhibitors for BRCA wild type ovarian cancer; gene alterations, homologous recombination deficiency and combination therapy.

Authors:  Koji Matsumoto; Meiko Nishimura; Takuma Onoe; Hideki Sakai; Yusaku Urakawa; Takashi Onda; Nobuo Yaegashi
Journal:  Jpn J Clin Oncol       Date:  2019-08-01       Impact factor: 3.019

Review 7.  When mutants gain new powers: news from the mutant p53 field.

Authors:  Ran Brosh; Varda Rotter
Journal:  Nat Rev Cancer       Date:  2009-08-20       Impact factor: 60.716

8.  Intestinal cancer progression by mutant p53 through the acquisition of invasiveness associated with complex glandular formation.

Authors:  M Nakayama; E Sakai; K Echizen; Y Yamada; H Oshima; T-S Han; R Ohki; S Fujii; A Ochiai; S Robine; D C Voon; T Tanaka; M M Taketo; M Oshima
Journal:  Oncogene       Date:  2017-06-19       Impact factor: 9.867

Review 9.  Macrophage Polarization in the Development and Progression of Ovarian Cancers: An Overview.

Authors:  Huiyan Cheng; Zhichao Wang; Li Fu; Tianmin Xu
Journal:  Front Oncol       Date:  2019-05-22       Impact factor: 6.244

10.  The prognostic significance of immune microenvironment in breast ductal carcinoma in situ.

Authors:  Michael S Toss; Asima Abidi; Dorothea Lesche; Chitra Joseph; Sakshi Mahale; Hugo Saunders; Tanjina Kader; Islam M Miligy; Andrew R Green; Kylie L Gorringe; Emad A Rakha
Journal:  Br J Cancer       Date:  2020-03-17       Impact factor: 7.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.