| Literature DB >> 33972412 |
Qing Yang1,2, Tassa K Saldi1, Patrick K Gonzales1, Erika Lasda1, Carolyn J Decker3,4, Kimngan L Tat1, Morgan R Fink1, Cole R Hager1, Jack C Davis1, Christopher D Ozeroff1, Denise Muhlrad3,4, Stephen K Clark1,5, Will T Fattor1, Nicholas R Meyerson1,5, Camille L Paige1,5, Alison R Gilchrist1,2, Arturo Barbachano-Guerrero1, Emma R Worden-Sapper1,2, Sharon S Wu1,2,6, Gloria R Brisson7, Matthew B McQueen8, Robin D Dowell1,2,9, Leslie Leinwand1,2, Roy Parker10,3,4, Sara L Sawyer10,2.
Abstract
We analyze data from the fall 2020 pandemic response efforts at the University of Colorado Boulder, where more than 72,500 saliva samples were tested for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) using qRT-PCR. All samples were collected from individuals who reported no symptoms associated with COVID-19 on the day of collection. From these, 1,405 positive cases were identified. The distribution of viral loads within these asymptomatic individuals was indistinguishable from what has been previously observed in symptomatic individuals. Regardless of symptomatic status, ∼50% of individuals who test positive for SARS-CoV-2 seem to be in noninfectious phases of the disease, based on having low viral loads in a range from which live virus has rarely been isolated. We find that, at any given time, just 2% of individuals carry 90% of the virions circulating within communities, serving as viral "supercarriers" and possibly also superspreaders.Entities:
Keywords: SARS-CoV-2; transmission; viral load
Mesh:
Year: 2021 PMID: 33972412 PMCID: PMC8166196 DOI: 10.1073/pnas.2104547118
Source DB: PubMed Journal: Proc Natl Acad Sci U S A ISSN: 0027-8424 Impact factor: 11.205
Fig. 1.Saliva viral load distribution within our campus population. (A) Distributions are shown of the viral loads measured in the 1,405 positive samples identified on campus during the fall semester of 2020. Each histogram shows Ct values obtained using TaqMan primer/probe sets targeting either the E gene (“CU-E”) or the N gene (“CU-N”) of SARS-CoV-2. The horizontal axes are labeled with both the Ct values and the corresponding viral loads calculated from the standard curve for each primer set (). ND denotes no data, as the viral load is below the qRT-PCR detection limit. (B) The Ct values resulting from the two primer sets in A are highly correlated, especially in samples with high viral loads (Ct value lower than 30). Pearson correlation coefficients (PCC) are shown within and beyond the Ct = 30 arbitrary cutoff. (C) For 105 of the SARS-CoV-2−positive saliva samples, we ran qRT-PCR side by side with eight different primer sets commonly used in SARS-CoV-2 diagnostic tests (). Here, we show the same analysis as in B, except with the CDC primers targeting the E and N genes (see ).
Fig. 2.Viral load distributions are similar in asymptomatic and symptomatic populations. (A) A histogram of saliva viral loads in our asymptomatic campus population (n = 1,405, blue) compared to the same histogram of saliva viral loads from symptomatic (n = 404, red) individuals. The latter represents data compiled from the 10 studies in . A log-normal probability density function is fitted onto the two distributions given the population mean and standard deviation. (B) Empirical cumulative distribution functions (ECDFs) of saliva viral load in the asymptomatic (n = 1,405, blue) and symptomatic (n = 404, red) populations. The similarity of the two ECDFs was assessed with the Kolmogorov−Smirnov test, which resulted in D statistic = 0.03, and P value = 0.97.
Fig. 3.A small percentage of individuals are viral supercarriers. The histograms shown (right y axes) are the same as were shown in Fig. 2. Starting from the left of each histogram (i.e., those individuals with the highest viral loads), we calculated the accumulative percentage of total virions as a function of saliva viral load based on the probability density function of the distribution (blue and red lines, and left y axes). In both asymptomatic (blue line) and symptomatic populations (red line), the portion of population that harbors 90% and 99% of the circulating virus is highlighted by the dashed lines. We estimate that only around 50% (51% and 42% in the panels shown) of individuals who test positive for the virus actually harbor infectious virions, based on the observation that live virus has rarely been isolated from samples with viral loads of <106 virions per mL (28, 30–35). For context, the range of detection limits of common SARS-CoV-2 diagnostic testing paradigms (qRT-PCR, antigen testing, and reverse transcription loop-mediated isothermal amplification) are shown. All testing paradigms will capture virtually all infectious individuals and virions, in presymptomatic and symptomatic populations alike. Limits of detection are taken from refs. 50 to 52.
The qRT-PCR TaqMan primer/probe sets used for university screening and focused analysis
| Assay name | Primer/probe set target and designation | Primer or probe name | 1× concentration, nM | Sequence (5′ to 3′) |
| CU | SARS-CoV-2 E gene “CU-E” | E_Sarbeco_F1 (IDT 10006888) | 400 | ACAGGTACGTTAATAGTTAATAGCGT |
| E_Sarbeco_R2(IDT 10006890) | 400 | ATATTGCAGCAGTACGCACACA | ||
| E_Sarbeco_P(IDT Custom) | 200 | TexRd-ACACTAGCCATCCTTACTGCGCTTCG- IAbRQSp | ||
| SARS-CoV-2 N gene “CU-N” | nCOV_N1_F (IDT 10006830) | 500 | GACCCCAAAATCAGCGAAAT | |
| nCOV_N1_R (IDT 10006831) | 500 | TCTGGTTACTGCCAGTTGAATCTG | ||
| nCOV_N1_P (IDT Custom) | 250 | HEX-ACCCCGCAT-ZEN-TACGTTTGGTGGACC-IABkFQ | ||
| Human RNase P“CU-RNaseP” | RNaseP_F (IDT 10006836) | 50 | AGATTTGGACCTGCGAGCG | |
| RNaseP_R (IDT 10006837) | 50 | GAGCGGCTGTCTCCACAA GT | ||
| RNase_P_P (IDT 10006838) | 50 | FAM-TTCTGACCT-ZEN-GAAGGCTCTGCGCG-IABkFQ | ||
| CDC | SARS-CoV-2 E gene “CDC-E” | E_Sarbeco_F1 (IDT 10006888) | 400 | ACAGGTACGTTAATAGTTAATAGCGT |
| E_Sarbeco_R2 (IDT 10006890) | 400 | ATATTGCAGCAGTACGCACACA | ||
| E_Sarbeco_P (IDT 10006893) | 200 | FAM-ACACTAGCCATCCTTACTGCGCTTCG- IABkFQ | ||
| SARS-CoV-2 N gene “CDC-N” | nCOV_N2_F (IDT 10006833) | 600 | TTACAAACATTGGCCGCAAA | |
| nCOV_N2_R (IDT 10006834) | 600 | GCGCGACATTCCGAAGAA | ||
| nCOV_N2_P (IDT 10007049) | 300 | SUN- ACAATTTGCCCCCAGCGCTTCAG - IABkFQ | ||
| Human RNase P “CDC-RNaseP” | RNaseP_F (IDT 10006836) | 50 | AGATTTGGACCTGCGAGCG | |
| RNaseP_R (IDT 10006837) | 50 | GAGCGGCTGTCTCCACAA GT | ||
| RNase_P_P (IDT 10007062) | 50 | ATTO647-TTCTGACCTGAAGGCTCTGCGCG - IABkFQ | ||
| SalivaDirect ( | SARS-CoV-2 N gene “SalivaDirect-N” | nCOV_N1_F (IDT 10006830) | 400 | GACCCCAAAATCAGCGAAAT |
| nCOV_N1_R (IDT 10006831) | 400 | TCTGGTTACTGCCAGTTGAATCTG | ||
| nCOV_N1_P (IDT 10006832) | 200 | FAM-ACCCCGCATTACGTTTGGTGGACC-IABkFQ | ||
| Human RNase P “SalivaDirect-RNaseP” | RNaseP_F (IDT 10006836) | 150 | AGATTTGGACCTGCGAGCG | |
| RNaseP_R (IDT 10006837) | 150 | GAGCGGCTGTCTCCACAA GT | ||
| RNase_P_P (IDT 10007062) | 200 | ATTO647-TTCTGACCTGAAGGCTCTGCGCG - IABkFQ |
Explanation for some of the TaqMan fluorophores and quenchers used: IAbRQSp, Iowa Black Dark Quenchers RQ; IABkFQ, Iowa Black Dark Quenchers FQ; ZEN, internal quencher; TexRd, Texas Red; HEX, Hexachloro-fluorescein; FAM, fluorescein.