Comparative and phylogenetic analysis of the complete chloroplast genome sequences of Lactuca raddeana and Lactuca sativa.

Lactuca raddeana is a biennial plant of the Lactuca genus belonging to the Asteraceae family. The classification of Lactuca is controversial, and no consistent conclusions have been reached based on the analysis of morphological characters and different molecular markers. Here, we sequenced and assembled the complete chloroplast genome of L. raddeana. This genome has a total length of 152,339 bp, a conservative quartile structure that is composed of a large single-copy (LSC) region of 83,976 bp, a small-copy (SSC) region of 18,521 bp, and a pair of inverted repeats (IRs) of 24,921 bp. The genome contains 112 unique genes, including 79 protein-coding, four rRNA, and 29 tRNA genes. Repeat analysis obtained 17 microsatellite, 16 tandem, and 17 interspersed repeats. Comparison of sequence divergence between L. raddeana and L. sativa found the intergenic spacer trnC-petN exhibited the highest degree of variation. Three phylogenetic trees based on the 72 shared protein, matK gene, and rbcL gene sequences showed that L. raddeana and L. sativa are clustered together. The acquisition and comparative analysis of the chloroplast genome provide a valuable resource for the taxonomic and phylogenetic studies of Lactuca.

Introduction

Lactuca raddeana belongs to the genus Lactuca, family Asteraceae, distributed in China, Russia, North Korea, Japan, and South Korea. It grows in forests, forest margins, thickets, moist areas on mountain slopes, mountain valleys, fields, and trailside (iPlant 2020a). The Lactuca genus includes at least 50 species, distributed worldwide, but mainly in temperate Eurasia (iPlant 2020b). For L. raddeana, it is found that its chemical component lactuside B improved ischemic brain injury by reducing aquaporin-4 and caspase-3 mRNA expression in the hippocampus and striatum three and regulating the expression of BCL-2 and BAX mRNA (Li et al. 2011). However, the effects of other species from this genus remained to be discovered. Clarification of the taxonomic classification of L. raddeana is critical for the future development of new drugs based on L. raddeana.

The classification of Lactuca is controversial. L. raddeana has several alias names, including Pterocypsela elata (Hemsl.) Shih, Pterocypsela raddeana (Maxim.) Shih, Lactuca vaniotii H. Lév., Lactuca alliariifolia H. Lév. et Vaniot, Lactuca elata Hemsl., Lactuca raddeana Maxim. var. elata (Hemsl.) Kitam. and Prenanthes hieraciifolia H. Léveillé (iPlant, 2020a), reflecting the difficulty in determining its taxonomy classification using morphological characters. More recently, the nuclear rDNA ITS sequences and five chloroplast DNA markers had been used to delineate the phylogeny of Lactuca species. Unfortunately, inconsistent results were obtained using these markers (Wang et al. 2013). The phylogeny of Lactuca was analyzed based on 31 chloroplast genomes (LSC + SSC + IR), nuclear rDNA, and ITS sequences, indicating that there are at least four main groups (Wei 2016). However, these species cover just 36% of the Lactuca, and there are still some differences among the three trees. Thus, more phylogenetic analysis based on chloroplast genomes is needed to study the phylogeny of Lactuca furtherly.

The chloroplast is an essential organelle in plant cells and capable of photosynthesis in the presence of light. The complete chloroplast genome provides a rich resource for accurate identification of plant species and determining their phylogenetic relationships (Daniell et al. 2016). Chloroplast genome encodes many key proteins playing essential roles in photosynthesis and other metabolic processes (Keeling 2004). The structure of the chloroplast genome is highly conserved and usually consists of four parts with a large single-copy (LSC) region, a small single-copy (SSC) region, and two inverted repeats (IRs) (Palmer 1991). The chloroplast genome sequence can be divided into the protein-coding region and the non-coding region. The coding region has a slow evolution rate and is suitable for phylogenetic analysis of higher taxonomic levels such as order and family (Li et al. 2012). The non-coding region evolves faster and has more variation information, which is more suitable for phylogenetic analysis of lower taxonomic levels such as genus and species (Shaw et al. 2007).

Previously, the partial chloroplast genome sequence of Lactuca raddeana has been reported, which has 127,660 bp containing an LSC, an SSC, and one IR region (Wei 2016). However, this genome sequence was not publicly available. To address this problem, we sequenced, assembled, and annotated the complete chloroplast genome sequence of L. raddeana and compared it with the chloroplast genomes of L. sativa.

Material and methods

Plant material, DNA extraction, and sequencing

We collected fresh leaf samples from the Central China Medicinal Botanical Garden, EnShi, China (Geospatial coordinates: N30.178176, E107.745725) and identified them as L. raddeana by Professor Jinwen You. We kept the sample in the −80° refrigerator until use. We extracted the genomic DNA with plant genomic DNA kit (Tiangen Biotech, China) and constructed the DNA library with 1 ug DNA using the library preparation kit (New England BioLabs. America). We sequenced the library using the Hiseq 2500 platform (Illumina, America). A total of 26,321,582 paired-end reads (2 × 150 bp) were obtained. Clean data were obtained by removing low-quality sequences: the percentage of bases with a quality value of Q < 19 is more than 50%, and the percentage of ‘N’ is more than 5%.

Genome assembly and annotation

We assembled the clean sequence data into a chloroplast genome by NOVOPlasty (v. 2.7.2) (Dierckxsens et al. 2017) with the k-mer length of 39 bp and the sequence of rbcL from Arabidopsis thaliana as the seed. We manually examined the assembly by mapping all raw reads to the assembled genome sequence using Bowtie2 (v.2.0.1) (Langmead et al. 2009) under the default settings. Complete coverage and an even sequencing depth across the assembly would support the correctness of the assembly. The annotation of the chloroplast genome was initially performed using CpGAVAS2 (Shi et al. 2019), and then the annotations with problems were edited using Apollo (Misra and Harris 2006). The genome sequence and annotations have been deposited in GenBank with accession number MN402448.

General characteristics and repeat analysis

The codon usage and repeat analysis were analyzed using CpGAVAS2. Notably, we identified the microsatellite repeats with MISA software (Beier et al. 2017). And the cutoff for the numbers of units for mono-, di-, tri-, tetra-, Penta-, and hexanucleotides were 10, 6, 5, 5, 5, and 5, respectively. We identified the tandem repeats by using TRF software (Benson 1999) with the size of repeat unit > = 7. Then, we identified the interspersed repeats with VMATCH software (Kurtz et al. 2001). Lastly, we calculated both GC contents and codon usage using the program Cusp from EMBOSS (v6.3.1) (Rice et al. 2000).

Comparative analysis of the chloroplast genomes

The comparative analysis between L. raddeana and the L. sativa was conducted using the mVISTA program (Frazer et al. 2004) in a Shuffle-LAGAN mode with default parameters. The complete chloroplast genome of L. sativa (Accession number: NC_007578) was obtained from Genbank. And the annotated L. raddeana genome was used as the reference. The IR boundary was analyzed and visualized by using the IRscope tool (Amiryousefi et al. 2018).

Phylogenetic analysis

We constructed the phylogenetic tree between the L. raddeana and other fourteen closely related species obtained from Genbank (Table S4), L. sativa, Sonchus acaulis, Sonchus boulosii, Sonchus canariensis, Sonchus webbii, Taraxacum amplum, Taraxacum brevicorniculatum, Taraxacum kok-saghyz, Taraxacum mongolicum, Taraxacum obtusifrons, Taraxacum officinale, Taraxacum platycarpum, Youngia japonica, and Youngia denticulata. Helianthus annuus and Ageratina adenophora were set as outgroups. A total of 72 shared proteins present among the sixteen chloroplast genomes were detected and extracted (ATPA, ATPB, ATPE, ATPF, ATPH, ATPI, CCSA, CEMA, CLPP, MATK, NDHA, NDHB, NDHC, NDHD, NDHE, NDHF, NDHG, NDHH, NDHI, NDHJ, NDHK, PETA, PETB, PETD, PETG, PETL, PETN, PSAA, PSAB, PSAC, PSAI, PSAJ, PSBA, PSBB, PSBC, PSBD, PSBE, PSBF, PSBH, PSBJ, PSBK, PSBM, PSBN, PSBT, RBCL, RPL14, RPL16, RPL2, RPL20, RPL22, RPL23, RPL32, RPL33, RPL36, RPOA, RPOB, RPOC1, RPOC2, RPS11, RPS12, RPS14, RPS15, RPS16, RPS18, RPS19, RPS2, RPS3, RPS4, RPS7, RPS8, YCF3, YCF4). These protein sequences were subjected to multiple sequence alignment using CLUSTALW2 (v2.0.12) (Thompson et al. 2002) with the option ‘-gapopen = 10 -gapext = 2 -output = phylip’. The phylogenetic tree was then constructed using the Maximum Likelihood method implemented in RaxML (v8.2.4) (Stamatakis 2014) with the option ‘raxmlHPC-PTHREADS-SSE3 -f a -N 1000 -m PROTGAMMACPREV -x 551314260 -p 551314260 -o A_thaliana, N_tabacum -T 20’.

Results

General features of the chloroplast genome

The chloroplast genome of L. raddeana is 152,339 bp in size with an LSC of 83,976 bp, an SSC of 18,521 bp, and two IRs of 24,921 bp each (Figure 1). The chloroplast genome encodes 130 genes, of which 112 are unique genes, including 79 protein-coding genes, four ribosome RNA genes, and 29 transfer RNA genes (Table 1). Among them, there are 7 genes (rps16, rpoC1, atpF, petB, rpl2, ndhB, and ndhA) contains 1 intron, 2 genes (ycf3 and clpP) contain 2 introns. 6 tRNAs (trnK-UUU, trnS-CGA, trnL-UAA, trnC-ACA, trnE-UUC, and trnA-UGC) contain 1 intron (Table S1). The length of the protein-coding regions, the rRNA genes, and the tRNA genes in the chloroplast genome of the L. raddeana is 78,288 bp, 9,536 bp, and 2,727 bp, accounting for 51.39%, 6.26%, and 1.79% of the genome length, respectively. The chloroplast genome's non-coding region mainly includes introns and intergenic spacers, and its length accounts for 40.56% of the genome length.

Figure 1.

The schematic representation of the chloroplast genome of L. raddeana was created by using CPGAVAS2. The map contains four rings. From the center going outward, the first circle shows the scattered forward and reverse repeats connected with red and green arcs, respectively. The next circle shows the tandem repeats marked with short bars. The third circle shows the microsatellite sequences identified. The fourth circle shows the gene structure of the chloroplast genome. The genes were colored based on their functional categories, which are shown in the left corner.

Table 1.

Gene composition in the chloroplast genome of L. raddeana.

Category of genes	Group of genes	Name of genes
	rRNA	rrn16S2, rrn23S2, rrn5S2, rrn4.5S2
	tRNA	29 trna genes (6 contain an intron)
Photosynthesis	Subunits of ATP synthase	atpA, atpB, atpE, atpF, atpH, atpI
	Subunits of photosystem II	psbA, psbB, psbC, psbD, psbE, psbF, psbI, psbJ, psbK, psbM, psbN, psbT, psbZ, ycf3
	Subunits of NADH-dehydrogenase	ndhA, ndhB2, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK
	Subunits of cytochrome b/f complex	petA, petB, petD, petG, petL, petN
	Subunits of photosystem I	psaA, psaB, psaC, psaI, psaJ
	Subunit of rubisco	rbcL
Self replication	Large subunit of ribosome	rpl14, rpl16, rpl22, rpl20, rpl22, rpl232, rpl32, rpl33, rpl36
	DNA dependent RNA polymerase	rpoA, rpoB, rpoC1, rpoC2
	Small subunit of ribosome	rps11, rps122, rps14, rps15, rps16, rps18, rps19, rps2, rps3, rps4, rps72, rps8
Other genes	Subunit of Acetyl-CoA-carboxylase	accD
	c-type cytochrom synthesis gene	ccsA
	Envelop membRNAe protein	cemA
	Protease	clpP
	TRNAslational initiation factor	infA
	Maturase	matK
Unknown	Conserves open reading frames	ycf1, ycf152, ycf22, ycf4

The ‘2’ symbol after gene name reflect the genes located on the IR regions.

The whole genome's GC content is 37.69%, of which the protein-coding regions, the rRNA genes, and the tRNA genes are 38.02%, 54.55%, and 53.12%, respectively. The GC contents for the first, second, and third positions of the codons are 45.58%, 38.26%, and 30.22%, respectively, showing a higher A/T bias within the protein-coding regions at the third codon position. In terms of codon usage, 26,096 codons encoding 79 protein-coding genes were identified in the complete genome (Table S2). The most common codon, AUU, codes for the amino acid Isoleucine (an abbreviation I) and was found 1,056 times.

Repeat analysis

The types and numbers of repeated sequences might provide important information regarding genome evolution. There are three types of repeats. The simple sequence repeats (SSRs), also referred to as microsatellite repeats, consist of multiple copies of small repeat units (size <= 6 bp) concatenated together. They are abundant in the angiosperm genomes and often used as molecular markers because they mutate rapidly at the interspecies and intraspecies levels (Lu et al. 2005; Tanaka et al. 2017). In the chloroplast genome of L. raddeana, the SSRs include 15 A/T and 2 AT/AT (Table 2). These numbers are rather small compared to those found in other chloroplast genomes (data not shown). The SSRs were found to distribute across the intergenic spacers (IGS), intron regions, and exon regions. And numbers of SSRs falling into these regions are 9, 3, and 3, respectively.

Table 2.

Microsatellite repeats in the chloroplast genome of L. raddeana.

SSR type	Structure of SSRs	Size (bp)	Start	End	Region (gene names)
p1	(A)10	10	4408	4417	IGS (matK-rps16)
p1	(T)15	15	12,680	12,694	IGS (trnE-UUC- rpoB)
p1	(A)11	11	16,599	16,609	Intron (rpoC1)
p1	(A)10	10	18,409	18,418	Exon (rpoC1)
p1	(T)10	10	23,213	23,222	IGS (rpoC2- rps2)
p2	(AT)6	12	26,596	26,607	IGS (atpH- atpF)
p1	(A)10	10	43,666	43,675	Intron (ycf3)
p1	(T)10	10	50,222	50,231	IGS (ndhC- trnM-CAU)
p1	(T)10	10	59,176	59,185	IGS (psaI- ycf4)
p1	(T)10	10	67,305	67,314	IGS (psaJ- rpl33)
p2	(TA)7	14	67,647	67,660	IGS (rpl33- rps18)
p1	(T)11	11	70,358	70,368	Exon (clpP)
p1	(T)10	10	71,329	71,338	Intron (clpP)
p1	(T)10	10	77,876	77,885	Exon (rpoA)
p1	(A)10	10	116,247	116,256	IGS (ndhD- psaC)
p1	(T)10	10	124,260	124,269	Exon (ycf1)
p1	(T)10	10	124,985	124,994	Exon (ycf1)

p1: perfect repeat of mononulceotide; p2: perfect repeat of dinucleotides. The structure of SSRs is presented as repeat units surrounded with parenthesis, followed with the number of repeat units.

The second type of repeats is the tandem repeat consisting of multiple copies of repeat units (size > 6 bp) concatenated together. A total of 26 tandem repeats were found in the chloroplast genome of L. raddeana, of which the most extended repeat unit is 32 bp (Table 3). And the number of repeat units is mostly 2. The average matching rate of repeat unit sequences is 98%. Seventeen of the tandem repeats possessed the highest possible matching rate of 100%. Besides, four tandem repeats are present in the IR regions and located in the IGS (trnN-GUU-trnR-ACG and trnN-GUU-trnR-ACG) and exonic (rrn4.5S and ycf2) regions.

Table 3.

Tandem repeats in the chloroplast genome of L. raddeana.

Start-end sites of tandem repeats	Repeat units			Region (gene name)
	Size (bp)	Percent of match	Sequence (copy number)
4871–4908	19	100	TAAAGAACTTCGATTCCTT (2)	IGS (matK-rps16)
8639–8682	21	100	TATGTTACATTACATATCAAG (2)	IGS (trnS-GCU)
11,771–11,808	19	94	ACCAATGGACCATAGGGGC (2)	Exon (trnE-UUC)
12,249–12,305	28	100	ATTGAGCCCTAAATAATACTGTCAATTG (2)	IGS (trnE-UUC-rpoB)
31,073–31,106	17	94	GTTAGAGTATATTAGTT (2)	IGS (trnT-GGU-psbD)
31,492–31,531	19	100	ATAATATTTCTATATTTAG (2)	IGS (trnT-GGU-psbD)
56,199–56,248	25	92	ATTTGAGTTTCAGGCAATGGATACT (2)	Exon (rbcL)
58,617–58,646	15	100	TTCAATATATTCAAT (2)	IGS (accD-psaI)
58,620–58,655	15	90	AATATATTCAATATA (2)	IGS (accD-psaI)
58,743–58,790	24	100	AATAATATCTCATCCATATCCTTT (2)	IGS (accD-psaI)
58,879–58,914	18	100	TATTAAGTAATAATAATA (2)	IGS (accD-psaI)
65,047–65,095	24	100	AATAGAAATGACTAGTCTTAGAAT (2)	IGS (psbE-petL)
65,473–65,528	27	100	TTTTATACAGTTGTGACTTTATCCTTG (2)	IGS (psbE-petL)
66,338–66,369	16	100	GTCCAATGTGAATTGA (2)	IGS (trnW-CCA-trnP-UGG)
67,780–67,820	21	95	TAAATCCAAGCGAACTTTTCT (2)	Exon (rps18)
68,264–68,319	26	96	TATTCTTATCATATTCTATTCATTTT (2)	IGS (rps18-rpl20)
81,570–81,611	21	100	TTTGTATAGATAACTAAATAT (2)	IGS (rpl16-rps3)
91,223–91,282	18	100	CGATATTGATGCTAGTGA (3)	Exon (ycf2)
106,912–106,973	32	93	CATTGTTCAACTCTTTAACAACACGAAAAAAC (2)	Exon (rrn4.5S)
107,809–107,839	15	100	AGTAGCATAACAAAA (2)	IGS (trnR-ACG- trnN-GUU)
107,947–107,984	18	100	TAATTGGATAGTTGTAAA (2)	IGS (trnR-ACG- trnN-GUU)
112,130–112,177	22	96	TTATATTATAGACAAATATTAT(2)	IGS (ndhF-rpl32)
128,332–128,369	18	100	TATTTACAACTATCCAAT (2)	IGS (trnN-GUU-trnR-ACG)
128,477–128,507	15	100	TTTTTGTTATGCTAC (2)	IGS (trnN-GUU-trnR-ACG)
129,343–129,404	32	93	TTTTTCATGTTGTCAAAGAGTTGAACAATGGT (2)	Exon (rrn4.5S)
145,034–145,093	18	100	ATATCGTCACTAGCATCA (3)	Exon (ycf2)

The third type of repeats is the interspersed repeat. It differs from the tandem repeat in the organization. Remarkably, the repeat units are distributed in a scattered and nonadjacent manner within the genome. We identified two tandem repeats in the chloroplast genome, 9 palindromic repeats, and 16 direct repeats (Table S3). The repeats sequences of three types in the chloroplast genome of L. raddeana will be invaluable in developing molecular markers.

Comparative genomic analysis

To investigate the similarities and divergence between L. raddeana and other Lactuca plants' chloroplast genomes, we compared the sequence divergence between the chloroplast genomes of L. raddeana and the L. sativa (Figure 2). In general, the two genomes are similar, in which the protein-coding regions are more conserved than the non-coding regions. Specifically, the ycf1 genes from the two species are highly variable, consistent with the previous finding that the ycf1 gene exhibited a rapid evolution rate in many species. For the non-coding regions, seven regions have a higher degree of divergence, with the percentage of similarity being less than 75%. These include IGS(trnC-petN), IGS(trnE-rpoB), IGS(ycf3-trnS), IGS(ndhC-trnM), IGS(psbF-petG), IGS(rpl16-rps3), IGS(rpl32-trnL).

Figure 2.

Comparison of the chloroplast genomes of L. raddeana and L. sativa by using mVASTA. The gray line and arrow indicated the orientation of genes. The coloring of the different conserved regions corresponds to the annotation of the region. The genes were represented as gray arrows on the top of the alignment. Other regions are labeled with different colors. The pink regions are ‘Conserved Non-Coding Sequences’ (CNS), the dark blue regions are exons, and the light-blue regions are ‘Untranslated regions’ (UTR). The Y-scale represents the percent identity ranging from 50% to 100%.

The distances of intergenic spacers between the L. raddeana and L. sativa were conducted using the Kimura 2-parameter (K2p) model (Figure 3). The K2p distances range from 0.00-0.242, with an average of 0.018. The seventeen IGS regions: ndhA-ndhH, ndhH-rps15, ndhK-ndhC, psaB-psaA, psbF-psbE, rpl22-rps19, rpl23-rpl2, rpl23-trnM, rpl2-rpl23, rpoB-rpoC1, rps11-rpl36, rps19-rpl2, trnA-trnE, trnE-trnA, trnM-rpl23, trnM -ycf2, ycf2-trnM, exhibiting 100% similarity with the K2p values of 0. These IGS regions are conserved and have a length range from 1 bp to165bp. Besides, the IGS(trnC-petN) has the largest K2p values of 0.242, which indicated a faster evolution rate than other regions. The length of IGS(trnC-petN) varies greatly, 534 bp for L. raddeana and 831 bp for L. sativa. In summary, from the highly variable region, it is expected to develop new DNA barcodes to discriminate different species of Lactuca.

Figure 3.

K2p distances between the IGS regions of L. raddeana and L. sativa.

Structure analysis of the IR boundaries

The contraction and expansion of IR boundaries are often related to species evolution and directly affect the chloroplast genome's size. Previous studies have shown that the length and boundary of the IR region are variable in different species. Here the IR boundaries of L. raddeana and L. sativa chloroplast genomes were analyzed, showing that they have similar boundary structures (Figure 4). The LSC-IRb and SSC-IRa boundaries are located in the protein-coding regions, the rps19, and the ycf1 genes. In contrast, the IRb-SSC and IRa-LSC boundaries are located in the IGS, the IGS(trnN -ndhF), and IGS(rpl2-trnH), respectively. It should be pointed out that not all genes located in the IR regions are duplicated. For example, there is only one ycf1 gene since part of the ycf1 gene is located in the IRa region, and the other part is in the SSC region. Compared with other angiosperms, the Lactuca genus' IR boundaries were relatively conservative and had no significant contraction and expansion (Chen et al. 2018).

Figure 4.

LSC, SSC, and IR regions' boundaries in the chloroplast genomes of L. raddeana and L. sativa. The genes on the positive and negative strands are presented above and below the tracks, respectively. The JLB, JSB, JSA, and JLA represent junction sites of IRb and LSC, IRb and SSC, SSC and IRa, and IRa and LSC, respectively.

The chloroplast genome provides a valuable resource for the phylogenetic and taxonomic studies of the angiosperm (Guo et al. 2017). We obtained fifteen complete chloroplast genome sequences to explore the phylogenetic relationships among species from Cichorieae. The sequences of 72 shared proteins were used to construct the phylogenetic tree. In general, the species belong to the same genus were clustered together (Figure 5). The genus Taraxacum, Sonchus, and Youngia were clustered together, and the Lactuca species formed a single phylogenetic cluster. Some taxonomists classified the L. raddeana as a species of Pterocypsela Shih's genus, and the classification of the genus Pterocypsela Shih and Lactuca themselves is highly controversial (Wang et al. 2013). In this study, L. raddeana and L. sativa were clustered together with 100 bootstrap value, which supports L. raddeana belongs to the Lactuca genus.

Figure 5.

The phylogenetic tree of species from Cichorieae constructed using the maximum likelihood (ML) method using the 72 shared proteins present among the seventeen chloroplast genomes. The number above each node represents are the bootstrap value.

Discussion

In this study, we sequenced and analyzed the complete chloroplast genome of L. raddeana. Specifically, we extracted and sequenced the total DNA from the leaves of L. raddeana, assembled and annotated a complete chloroplast genome. Then we analyzed the general features of the chloroplast genome and the three kinds of repeat sequences, compared the genomic divergence and IR boundaries between the L. raddeana and L. sativa, and conducted phylogenetic analyses of L. raddeana and several closely related species from the Cichorieae. The present study provides a high-quality reference chloroplast genome sequence for the L. raddeana, which can be used for phylogenetic analyses of Lactuca species.

The Lactuca belong to the tribe Cichorieae, family Asteraceae. Due to the ambiguous definition of the genus, the number of species given in the literature varies greatly. The traits between Lactuca and its related genus are complex and have a serious crossover. There are two main types in the classification of Lactuca according to morphological characteristics. The first type, the Cicerbita Wallr., Mycelis Cass., Mulgedium Cass., and Pterocypsela, is combined as the Lactuca genus section (Lebeda et al. 1999; Doležalová et al. 2002). The second type, the Cicerbita Wallr., Mycelis Cass., Mulgedium Cass., and Pterocypsela, is considered an independent genus (Chu 1988).

The Lactuca raddeana of this study is also named Pterocypsela raddeana in the same literature (Wang et al. 2013). This study constructed a phylogenetic tree based on the shared protein sequence, showing that L. raddeana and L. sativa are clustered together with 100 bootstrap values. Previous studies based on different molecular sequences have shown different phylogenetic results. The phylogenetic analysis based on the entire chloroplast genome sequence without one of the IR regions showed that the Pterocypsela group, including L. raddeana, was clustered together with those of the crop group L. sativa (Wei 2016). The phylogenetic analysis based on petD gene, IGS(psbA-trnH), IGS(trnL-UAA-trnF), IGS(rpl32-trnL-UAG), and IGS(trnQ-UUG-rps16) showed that the genus Pterocypsela including L. raddeana and Lactuca formed two separate branches (Wang et al. 2013). The phylogenetic tree based on ITS region indicated that the Pterocypsela (including L. raddeana) and some of the Lactuca species (including L. sativa) were on one branch (Wang et al. 2013).

What’s more, the L. raddeana are not clustered together with L. sativa according to the tree constructed using the ndhF and trnL genes, but on the same branch with other Lactuca species (Wei et al. 2017). In summary, the study based on part and complete chloroplast genome supported the notion that the Lactuca raddeana (Pterocypsela raddeana) belongs to the Lactuca genus. However, the current study cannot resolve the classification of all the Lactuca species due to limited numbers of chloroplast genomes available. More chloroplast genome sequences are needed to determine the phylogeny of these species ultimately.

Authors’ contributions

CL conceived the study; MJ collected samples of L. raddeana, extracted DNA for next-generation sequencing, assembled and validated the genome; YNL performed data analysis, and drafted the manuscript. BW, HMC, and CL critically reviewed the manuscript. All authors have read and agreed on the contents of the manuscript.