Emergence of fluoroquinolone resistance and possible mechanisms in clinical isolates of Stenotrophomonas maltophilia from Iran.

Stenotrophomonas maltophilia exhibits wide spectrum of fluoroquinolone resistance using different mechanisms as multidrug efflux pumps and Smqnr alleles. Here, the role of smeDEF, smeVWX efflux genes and contribution of Smqnr alleles in the development of fluoroquinolone resistance was assessed. Ciprofloxacin, levofloxacin and moxifloxacin resistance were found in 10.9%, 3.5%, and 1.6% of isolates, respectively. More than four-fold differences in ciprofloxacin MICs were detected in the presence of reserpine and smeD, F, V expression was significantly associated with ciprofloxacin resistance (p = 0.017 for smeD, 0.003 for smeF, and 0.001 for smeV). Smqnr gene was found in 52% of the ciprofloxacin-resistant isolates and Smqnr8 was the most common allele detected. Fluoroquinolone resistance in S. maltophilia clinical isolates was significantly associated with active efflux pumps. There was no correlation between the Smqnr alleles and ciprofloxacin resistance; however, contribution of the Smqnr genes in low-level levofloxacin resistance was revealed.

Introduction

Although Stenotrophomonas maltophilia have not been considered as a highly virulent pathogen[1], more recently is known as one of the leading antibiotic-resistant pathogens in immunocompetent individuals[2]. Resistance of S. maltophilia strains to co-trimoxazole and ticarcillin-clavulanate which were recommended for empirical therapy was 4.7% and 16.1%, respectively around the world before 2003, but greater levels of resistance has now been reported and the trend of increasing antibiotic resistance is worrying[3]. In addition, S. maltophilia is intrinsically resistant to many commonly used antibiotics such as carbapenems and aminoglycosides and acquiring resistance to multiple antibiotics through plasmids, transposons, integrons result in the development of multi-drug resistant (MDR) strains, which makes it difficult to treat infections caused by this bacterium[4,5].

Fluoroquinolones are antibiotics with a broad spectrum of antibacterial activity, have been used as an alternative therapeutic option against MDR S. maltophilia infections despite of their serious side effects and rapid resistance emergence on therapy[3,6]. Until recently, fluoroquinolones showed promising activity against S. maltophilia, but resistance to fluoroquinolones has currently been reported[7]. Resistance to fluoroquinolones is mainly attributed to mutations in chromosomal genes encoding, DNA gyrase and topoisomerase IV, and decreased intracellular concentration of quinolones as a result of porin alteration or overexpression of multidrug resistance (MDR) efflux pumps[8,9]. In addition, plasmid-mediated quinolone resistance (PMQR) has been found in Gram-negative bacteria and the genes responsible for such resistance are called qnr genes[10,11]. Multiple chromosomally encoded resistance determinants, including efflux pumps, antibiotic-inactivating enzymes and the quinolone resistance protein SmQnr have been considered as the mechanisms of antibiotic resistance in S. maltophilia[12,13]. However, S. maltophilia is the only known bacterium in which mutations in topoisomerases encoding genes is not associated with quinolone resistance[14]. Furthermore, S. maltophilia harbors a novel quinolone resistance gene, namely Smqnr which is encoded by the chromosome, rather than plasmid-mediated qnr genes[15]. Therefore, development of resistance to quinolones and the relevant resistance mechanisms are not fully described in S. maltophilia[16].

Despite the increasing prevalence of antibiotic resistance and a considerable resistance against fluoroquinolones (0–20%) in clinical isolates of S. maltophilia in Iran, mechanisms of fluoroquinolone resistance in Iranian isolates of S. maltophilia were not completely studied[17,18]. Here, the genetic background of resistance to fluoroquinolones including the role of active efflux pumps and their gene expression, the effect of reserpine as an efflux pump inhibitor on minimum inhibitory concentrations (MICs), and association of Smqnr alleles with fluoroquinolone resistance in clinical isolates of S. maltophilia in Iran was sought.

Results

S. maltophilia strains

Among the 385 isolates collected, 375 were confirmed as S. maltophilia using phenotypic and genotypic methods and used for further experiments. These isolates were obtained from blood (n = 308), bronchoalveolar lavage (BAL) (n = 9), sputum (n = 5), wounds (n = 2), ascitic fluid (n = 2), respiratory secretions (n = 2), and other clinical sources (n = 47).

Fluoroquinolone susceptibility of S. maltophilia strains

According to the disc diffusion method, ciprofloxacin resistance was found in 41 (10.9%) strains and among the remaining strains, 113 (30.1%) showed intermediate susceptibility to ciprofloxacin and 221 (58.9%) were ciprofloxacin-susceptible. Thirteen (3.5%) and 6 (1.6%) strains showed resistance or intermediate susceptibility to levofloxacin. Majority of the strains was susceptible to moxifloxacin (369, 98.4%), one strain was intermediate susceptible and only five strains (1.3%) were resistant to moxifloxacin. Table 1 shows the susceptibility profile of the S. maltophilia strains to ciprofloxacin and levofloxacin. Based on the MICs, 48 ciprofloxacin- and 4 levofloxacin- resistant strains were identified with the MICs equivalent or greater than 2 and 8 µg/mL, respectively. Furthermore, MIC90 of ciprofloxacin was ≤ 32 µg/mL while that was ≤ 2 µg/mL for levofloxacin.

Table 1

Minimum inhibitory concentration ranges and susceptibility pattern of Stenotrophomonas maltophilia strains against ciprofloxacin and levofloxacin.

Antibiotic	Susceptibility pattern (MIC range)	No. of strains (%)	MIC50	MIC90
			(µg/mL)
Ciprofloxacin	Susceptible (≤ 0.5)	0 (0%)	≤ 4	≤ 32
	Intermediate (1)	2 (4%)
	Resistant (≥ 2)	48 (96%)
Levofloxacin	Susceptible (≤ 2)	46 (92%)	≤ 0.5	≤ 2
	Intermediate (< 2, > 8)	0 (0%)
	Resistant (≥ 8)	4 (8%)

Since the critical concentrations of ciprofloxacin for Stenotrophomonas maltophilia are not defined by the CLSI, the critical concentrations of Pseudomonas aeruginosa have been used to interpret the results of ciprofloxacin susceptibility[35].

MIC minimum inhibitory concentration.

Effect of reserpine on ciprofloxacin MICs

MICs of ciprofloxacin were reduced in 30 out of 48 ciprofloxacin-resistant strains following reserpine treatment from 4 to 16 folds indicating active efflux pump in these strains. Among them, 6 resistant strains became susceptible, 8 resistant strains identified as intermediate susceptible to ciprofloxacin and 16 resistant strains showed decreased MICs of ciprofloxacin. Strains with active efflux pumps showed significantly greater MICs of ciprofloxacin (p = 0.001) but not levofloxacin (p = 0.081). The MICs of ciprofloxacin with and without reserpine among the 30 S. maltophilia strains with reduced MICs are shown in Fig. 1.

Figure 1

Minimum inhibitory concentrations of ciprofloxacin among the 30 strains of Stenotrophomonas maltophilia before and after the reserpine treatment.

The presence of smeDEF and smeVWX genes

Among the 48 strains ciprofloxacin-resistant strains, smeE and smeF genes were not detected in 3 and 8 strains, respectively using PCR. The remaining strains yielded amplicons for smeD, smeE, smeF, smeV, smeW and smeX genes (Supplementary Table S1). There were not significant differences in the MICs of ciprofloxacin/levofloxacin among the smeDEF-positive and smeDEF-negative S. maltophilia strains (p > 0.05).

Expression of smeD, smeF and smeV genes

Twenty-nine out of 48 ciprofloxacin-resistant strains were detected with ≥ threefold expression of smeD gene. Compared to the S. maltophilia ATCC13637, overexpression of smeF gene was found in 24 strains and expression level of smeV gene was ≥ 3 folds in 9 strains. Overexpression of the three efflux pump genes tested were noted in 3 out of 4 levofloxacin-resistant strains and one levofloxacin-resistant strain showed overexpression for smeD and smeF genes but not smeV. The expression of smeD, F, V genes was significantly correlated with higher MICs of ciprofloxacin and this correlation was also found between smeV gene and levofloxacin, compared to ATCC13637 standard strain. The expressions level of smeD, smeF, and smeV genes are demonstrated in Fig. 2.

Figure 2

Expression level of smeD, smeF, and smeV genes in Stenotrophomonas maltophilia strains. (A–C) smeD, smeF, and smeV expression level and distribution of ciprofloxacin MICs, (D–F) smeD, smeF, and smeV expression level and distribution of levofloxacin MICs, (G) the mean expression level of smeD, smeF, and smeV genes among the S. maltophilia isolates. Red lines showing the mean ± SD for each group and the dash line indicates the level of gene expression above which overexpression is considered, *expression level of smeD (p = 0.01) and smeF (p = 0.003) genes was significantly associated with the reduced MICs of ciprofloxacin, **the corelation of smeV expression level with the MICs of both ciprofloxacin (p = 0.000) and levofloxacin (p = 0.03) was significant.

Smqnr alleles

The Smqnr gene was identified in 25 strains of 48 ciprofloxacin- resistant with the following allele distribution: Smqnr8 (n = 8), Smqnr9 (n = 2), Smqnr11 (n = 5), Smqnr13 (n = 1), Smqnr24 (n = 1), Smqnr30 (n = 2), Smqnr35 (n = 2), and 4 distinct new alleles, hereafter named new variant -1, -2, -3, and -4 (Supplementary Fig. S1). Differences in amino acid sequences among the 4 new variants are as follows: new variant 1 (R95H, 99.5% identity to Smqnr35), new variant 2 (T64A, 99.5% identity to Smqnr40), new variant 3 (Q23E and Q28H substitutions with 99.1% identity to Smqnr35), and new variant 4 (L161R, with identity of 99.5% to Smqnr13). Three levofloxacin-resistant strains with MIC equal to 8 µg/mL carried Smqnr9 (n = 2) and the new variant-4 (n = 1). A levofloxacin-resistant strain was Smqnr negative. The sequence alignment of the all subtypes and amino acid substitutions of Smqnr are shown in Supplementary Fig. S1. Phylogenetic tree of the 4 new and 21 known Smqnr alleles and their relative distances are shown in Fig. 3. Three major clusters were found. Two new variants (1 and 3) were classified in a cluster alongside with known Smqnr -24, -35 and the new alleles 4 and known Smqnr -9, -11, and -13 were concentrated in another cluster.

Figure 3

Phylogenetic tree of 4 new and already known Smqnr alleles in Stenotrophomonas maltophilia strains tested in this study. The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 3.10403504 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site.

Co-effect of efflux pumps and Smqnr alleles on ciprofloxacin MICs

Based on the expression of efflux pump genes and/or presence of Smqnr alleles, the isolates were classified into the following sets: (a) the isolates which harbored Smqnr alleles and had smeDEF overexpression (14 isolates); 57.1% (4 isolates) of these isolates had MIC ≥ 4 µg/mL but the differences of ciprofloxacin MICs among the isolates in this group was not statistically significant compared to the isolates without efflux pump genes overexpression and Smqnr alleles (p = 0.08), (b) the isolates having smeVWX overexpression and Smqnr alleles (four isolates); all these were among the resistance isolates and there were no significant differences in the ciprofloxacin MICs of isolates with smeVWX overexpression and Smqnr alleles in comparison with the isolates which did not have efflux pump genes overexpression and Smqnr alleles (p < 0.05), (c) the isolates with overexpression of smeDEF and smeVWX and Smqnr alleles(four isolates); all the isolates in this category showed MIC ≥ 4 µg/mL. The comparison of ciprofloxacin MICs between this recent group and the isolates with no overexpression of efflux pump genes and Smqnr alleles was significant (p = 0.002).

Discussion

Intrinsic resistance nature of S. maltophilia against multiple antimicrobial agents and limited therapeutic options made great concern to control the increasing S. maltophilia nosocomial infections. However, resistance rate of S. maltophilia strains varies depending on different geographical areas. In this study, a large series of isolates from Tehran and a neighboring province were studied and we found a susceptibility rate of fluoroquinolones (89% for ciprofloxacin and 96.5% for levofloxacin) similar to the previous study (84.1% for ciprofloxacin and 99.4% for levofloxacin) in Iran which studied 44 and 45 isolates[18,19]. The resistance to ciprofloxacin ranged from 13 to 96% globally[3] and fluoroquinolone resistance in neighboring countries of Iran was as follows: an increasing rate of resistance from 7.8% (1998–2003)[20] to 89% (2006–2013)[21] in Turkey, 64–100% in Pakistan[22] and 23% (2003–2009) in Saudi Arabia[23].

Overexpression of smeDEF and smeVWX genes might contribute to increased MICs of multiple antibiotics and developing multi-drug resistant S. maltophilia strains[24]. In this study, the average of increased MICs of ciprofloxacin in smeD, F, V overexpressed strains was statistically significant compared to the isolates with no overexpression. The differences of MICs of levofloxacin were statistically significant only when the smeV gene is overexpressed. Furthermore, the differences of MICs of ciprofloxacin in the presence of reserpine confirmed that ciprofloxacin resistance was affected by the smeD, F, V overexpression. Therefore, the significant role of active efflux in fluoroquinolone resistance of S. maltophilia strains was demonstrated in the present study. These findings are supported by the results from previous studies[24-26]. In contrast, Wu et al. demonstrated that smeDEF did not considerably contribute to fluoroquinolone resistance and implication of efflux pumps in resistance to fluoroquinolone might have overestimated[27].

There were geographical differences of 47–70% in Smqnr frequency[28] and little correlation between the Smqnr alleles and resistance to fluoroquinolones in the S. maltophilia isolates was assumed[29]. Nonetheless, almost half (n = 25, 52.1%) of the 48 ciprofloxacin-resistant S. maltophilia strains (MIC ≥ 2 µg/mL) were found carrying Smqnr genes in the present study. Two remaining strains with intermediate susceptibility to ciprofloxacin (MIC = 1 µg/mL) was Smqnr-negative. Four strains with high level resistance to both ciprofloxacin (MIC = 8, 32 (2 isolates), and 128 µg/mL) and levofloxacin (MIC = 8 µg/mL) showed overexpression for smeDF genes harboring Smqnr9 (n = 2), Smqnr new variant 4 (n = 1), and a Smqnr-negative strain. The frequency of 65.9% Smqnr alleles were also previously reported in from Iran which studied only 44 strains[18]. The most common Smqnr allele in the current study was Smqnr8, followed by Smqnr11, Smqnr9, Smqnr30, and Smqnr35. Therefore, there was no significant association between ciprofloxacin resistance and Smqnr alleles in the strains examined (p = 0.2). However, significant differences of levofloxacin MICs among the Smqnr-positive and Smqnr-negative strains were found (p = 0.008). Significant difference in resistance to levofloxacin of Smqnr-positive isolates was previously demonstrated by Kanamori et al. using a MIC of ≥ 2 µg/mL for levofloxacin but not a MIC of ≥ 8 µg/mL and they highlighted the role of Smqnr genes in low-level fluoroquinolone resistance[28]. The isolates with the Smqnr8 and Smqnr11 were found to be levofloxacin-intermediate susceptible; however, three of 8 isolates with Smqnr8 and 3 of 5 isolates having Smqnr11 alleles were found among the ciprofloxacin-resistant isolates (MIC ≥ 2 µg/mL). The two isolates with Smqnr9 allele and a Smqnr new variant-4 positive strain were resistant to both ciprofloxacin (MIC ≥ 2 µg/mL) and levofloxacin (MIC ≥ 8 µg/mL). Three Smqnr alleles including Smqnr24, 30, and new variant-1 were found among the isolates with intermediate susceptibility levofloxacin. Totally, 22 (88%) out of 25 Smqnr positive isolates were intermediate susceptible to levofloxacin and this might propose that Smqnr alleles were mostly related to low-level fluoroquinolone resistance as Kanamori et. al. reported[28]. The role of Smqnr genes remains obscure and high-level fluoroquinolone resistance in S. maltophilia isolates might be associated with mechanisms other than Smqnr as described previously[29,30].

Comparison of the MICs of ciprofloxacin in the presence of both efflux and Smqnr alleles showed that the higher MICs were noted when overexpression of the two smeDEF and smeVWX efflux pump genes alongside with the Smqnr alleles detected. Totally, the higher MIC levels more related with two parameters; the number of overexpressed genes and the level of expression (higher levels of expression in more genes result in higher MICs). Therefore, according to these findings and comparison with the results of the isolates only having Smqnr alleles or active efflux pumps, overexpression of smeDEF and smeVWX genes were more important in resistance development and can lead to high level fluoroquinolone resistance. High-level fluoroquinolone resistance due to the overexpression of multi-drug efflux pump semDEF and low-level fluoroquinolone resistance by qnrD were already reported by Cavaco et al. and Valdezate et al.[31,32].

In conclusion, this study revealed that active efflux pumps can significantly contribute in fluoroquinolone resistance in S. maltophilia isolates. No correlation between the Smqnr alleles and ciprofloxacin resistance in the clinical isolates of S. maltophilia was found, but Smqnr alleles were mostly associated with lower MICs of levofloxacin. Therefore, efflux pumps were largely linked to higher MICs of fluoroquinolone than the Smqnr alleles. Further studies are required to assess the contribution of Smqnr to the fluoroquinolone susceptibility of S. maltophilia isolates.

Materials and methods

Bacterial isolates and identification

A total of 385 clinical isolates of S. maltophilia were collected during the period between September 2010 and August 2017 from six hospitals (H1–H4, H6, H11) in Iran. Phenotypic identification of the isolates was done using different biochemical tests including, oxidase, catalase, DNase, nitrate reduction, citrate, esculin hydrolysis, gelatin liquefaction, lysine decarboxylase and sugar fermentation on triple sugar iron (TSI) agar[5]. Genomic DNA was prepared from single colony of each isolate using the standard phenol–chloroform method[33] and species-specific PCR (SS-PCR) using the following primers; SM1 5′-CAGCCTGCGAAAAGTA-3′ and SM4 5′-TTAAGCTTGCCACGAACAG-3′ was applied to target the 23S rRNA gene[34]. Gel electrophoresis was done to confirm the presence of the amplicons of 531 bp in S. maltophilia strains[34]. A representative amplicon of 23S rRNA gene was subjected to sequencing and the sequence was deposited in GenBank under the accession no. JQ889327 (https://www.ncbi.nlm.nih.gov/nuccore/JQ889327).

Antimicrobial susceptibility testing

Antibiotic susceptibility testing of the isolates against ciprofloxacin (5 µg), levofloxacin (5 µg) and moxifloxacin (5 µg) (Mast Group Ltd, UK) was determined using the disk diffusion method on the Mueller–Hinton agar (Merck, Germany) plates according to Clinical and Laboratory Standards Institute (CLSI) guidelines[35]. In addition, minimum inhibitory concentrations (MICs) of ciprofloxacin and levofloxacin were determined by broth microdilution method for the isolates which were considered as ciprofloxacin-intermediate/-resistant according to the disk diffusion method. In other words, 50 isolates were selected for this experiment, in which 41 isolates were ciprofloxacin resistant and the remaining nine isolates were among the ciprofloxacin-intermediate-susceptible isolates which were selected based on isolation date, sources, the presence of resistance genes and MICs). In brief, twofold serial dilutions of ciprofloxacin and levofloxacin were prepared in 96-well microplates containing Mueller–Hinton broth (Merck, Germany) to obtain the concentration ranging from 0.25 to 128 μg/mL. The 0.5 MacFarland bacterial suspensions were used and the final concentration was equal to 5 × 105 CFU/mL. The plates were sealed and incubated for 20–24 h at 35 °C. The critical breakpoints of ciprofloxacin for Pseudomonas aeruginosa were used for interpretation of the results because of no breakpoints for S. maltophilia were recommended by the CLSI[35] and the results of moxifloxacin were interpreted according to the British Society for Antimicrobial Chemotherapy (BSAC) guidelines[36]. The S. maltophilia ATCC 13637 and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains.

MIC determination in the presence of reserpine

The MICs of ciprofloxacin were determined in the presence of an efflux pumps inhibitor, ion motive ATPase; reserpine (Sigma Aldrich, St. Louis, MO, USA). The broth microdilution method was performed as described above with a final concentration of 25 μg/mL reserpine in the Cation-adjusted Mueller Hinton broth (Merck, Germany)[37]. A change of four-fold or higher, in the ciprofloxacin MICs with and without reserpine was considered as inhibition of active efflux of the drug[38].

Genomic detection of smeDEF and smeVWX genes

To confirm the presence of the genes encoding efflux pumps including, smeDEF and smeVWX, PCR was done using specific primers for smeD, smeE, smeF, smeV, smeW, and smeX genes (Table 2). A representative PCR amplicon of each gene was sequenced to ensure the specific amplification.

Table 2

Primers used in PCR detection of smeDEF and smeVWX genes in Stenotrophomonas maltophilia strains.

Gene	Oligonucleotide sequence (5′ to 3′)	Tm (°C)	Amplicon size (bp)	References
smeD
F	CCAAGAGCCTTTCCGTCAT	57.5	150	[25]
R	TCTCGGACTTCAGCGTGAC	59.5
smeE
F	AGCTCGACGCCACGGTA	57.3	803	[25]
R	TGGCCTGGATCGAGAGCA	58.4
smeF
F	GCCACGCTGAAGACCTA	54.9	800	[25]
R	CACCTTGTACAGGGTGA	52.4
smeV
F	GTCGACTTCCTCGACAACC	59.5	212	[39]
R	TTGCCATCCTTGTCTACCAC	58.4
smeW
F	GCCCACACCATCTCGTTCCC	64.6	221	[40]
R	TAGCCGTTGCCGTTGCCC	60.8
smeX
F	TACGACCGCCGCAAGCAACC	64.6	219	[40]
R	CAGCTCGAAGTAGTTGCGTGCC	65.8

F forward, R reverse.

Quantitative reverse transcription PCR (RT-qPCR)

A single colony of each isolates were cultured in Luria–Bertani (LB) broth (Merck, Germany) and placed in a 37 °C shaking incubator at 180 rpm until the growth reached logarithmic phase (OD600 = 0.5). The log-phase bacterial cell were used to extract total RNA by the RNeasy mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Then, total RNA was treated with RNase free DNase I (Ambion, Austin, TX, U.S.A.) to further eliminate genomic DNA. After that, the quantity and quality of yielded RNA were evaluated using the Nanodrop (Thermo Scientific, Waltham, MA, USA) and RNA integrity verification was done on 1% agarose gel. Finally, the purified RNA was confirmed by PCR using gyrA primers (Table 3). The StepOnePlus™ real-time PCR System (Applied Biosystems, Foster City, CA, USA) was used to perform the relative RT-qPCR on the synthesized cDNA (PrimeScript RT reagent kit (Parstous, Iran) using specific primers for smeD, smeF, and smeV genes (Table 3). Each reaction mixture contains 8 μL of the Power SYBR Green PCR Master Mix (Bioneer, Korea), 1 μL of each primer (10 pM), and 2 μL of cDNA in a final volume of 20 μL by adding distilled water and the RT-qPCR was run under the following conditions: initial denaturation of 10 min at 95 °C, 40 cycles of 95 °C for 20 s and 61 °C for 40 s followed by melting curve analyses to ensure specific amplification. This experiment was run in triplicate (from the same sample) for all isolates tested.

Table 3

Primers used in relative Rt qPCR for amplification of smeD, smeF, smeV, and gyrA genes in Stenotrophomonas maltophilia strains.

Gene	Oligonucleotide sequence (5′ to 3′)	Tm (°C)	Amplicon size (bp)	References
gyrA
F	CCAGGGTAACTTCGGTTCGA	60.5	60	[41]
R	GCCTCGGTGTATCGCATTG	59.5
smeD
F	CCAAGAGCCTTTCCGTCAT	57.5	150	[25]
R	TCTCGGACTTCAGCGTGAC	59.5
smeF
F	TCGTCCAGGCTGACATTCAA	58.4	101	[25]
R	AACGCGGATCGTGATATCG	57.5
smeV
F	GTCGACTTCCTCGACAACC	59.5	212	[39]
R	TTGCCATCCTTGTCTACCAC	58.4

The RT-qPCR data analysis was carried out using the 2−∆∆CT method to evaluate expression level of smeD, smeF and smeV genes by normalization to the gyrA housekeeping gene as well as compared to the S. maltophilia ATCC 13637 as a reference strain. Efflux pump expression greater than 3 folds was considered as overexpression[27].

PCR detection and sequence analysis of Smqnr alleles

To amplify a 811 bp fragment of Smqnr gene, the following primer set was used; forward primer; 5′-ACACAGAACGGCTGGACTGC-3′ and reverse primer; 5′-TTCAACGACGTGGAGCTGT-3′[29]. PCR was performed using the 10 µL of Pfu PCR PreMix, (Bioneer, Korea), 10 pM of each primer, 50 ng of template DNA and 6 µL of distilled water to reach final volume of 20 µL PCR reaction mix. PCR products were sequenced with the corresponding PCR primers and translated to amino acid sequences using the Expasy translate tool (http://web.expasy.org/translate/). The obtained sequences were compared to the previously deposited Smqnr sequences in GenBank and alleles with one or more amino acid substitution were considered as new variants[6]. Multiple alignments of all available Smqnr sequences in GenBank till October 14, 2020 were performed to analyze the phylogenetic relationships of Smqnr alleles. The phylogenetic tree of Smqnr genes was constructed using Molecular Evolution and Genetic Analysis (MEGA) version 7.0.14 (http://www.megasoftware.net/).

Nucleotide accession numbers

The sequences of Smqnr genes have been submitted to the GenBank and the assigned accession numbers are as follows: Smqnr8 (MT920916, MT920917, MT997012, MT997013, MT997019, MT997020, MT997021, MT997023), Smqnr9 (MT997015, MT861992), Smqnr11 (MT920914, MT920915, MT921276, MT920913, MT997025), Smqnr13 (MT920912), Smqnr24 (MT890701), Smqnr30 (MT997016, MT997017), Smqnr35 (MT928300, MT997014) and new Smqnr (MT939666, MT997026, MT997027, MT997028).

Statistical analysis

The SPSS version 23.0 was used to analyze the obtained results. Descriptive statistics of the data was conducted by frequencies and crosstabs. The Pearson Chi-Square test was used to analyze the reduction of ciprofloxacin MICs under reserpine treatment. The effect of the presence or absence of efflux pump genes on antibiotic resistance was evaluated using Kruskal–Wallis test. The correlation of the antibiotic MICs with the efflux pump’s expression or Smqnr alleles was evaluated using Pearson Chi-Square test. co-effect of efflux pumps and Smqnr alleles on ciprofloxacin MICs was assessed by Chi-Square test. The MIC50 (MIC required to inhibit the growth of 50% of organisms) and MIC90 (MIC required to inhibit the growth of 90% of organisms) of ciprofloxacin and levofloxacin of the strains were calculated. A p value of < 0.05 was considered significant.

Ethics approval

This study was approved by the Ethics Committee of Tehran University of Medical Sciences “IR. TUMS. MSP. SPH. REC.1396.4388”.

Supplementary Table S1.

Supplementary Figure S1.