Literature DB >> 33936016

Positive Effects of Crop Diversity on Productivity Driven by Changes in Soil Microbial Composition.

Laura Stefan1, Martin Hartmann1, Nadine Engbersen1, Johan Six1, Christian Schöb1.   

Abstract

Intensive agriculture has major negative impacts on ecosystem diversity and functioning, including that of soils. The associated reduction of soil biodiversity and essential soil functions, such as nutrient cycling, can restrict plant growth and crop yield. By increasing plant diversity in agricultural systems, intercropping could be a promising way to foster soil microbial diversity and functioning. However, plant-microbe interactions and the extent to which they influence crop yield under field conditions are still poorly understood. In this study, we performed an extensive intercropping experiment using eight crop species and 40 different crop mixtures to investigate how crop diversity affects soil microbial diversity and activity, and whether these changes subsequently affect crop yield. Experiments were carried out in mesocosms under natural conditions in Switzerland and in Spain, two countries with drastically different soils and climate, and our crop communities included either one, two or four species. We sampled and sequenced soil microbial Dn class="Chemical">NA to assess soil microbial diversity, anpan>d measured soil basal respirationpan> as a proxy for soil activity. Results indicate that in Switzerlanpan>d, increasing crop diversity led to shifts in soil microbial communpan>ity compositionpan>, anpan>d in particular to anpan> increase of several planpan>t-growth promoting microbes, such as members of the bacterial phylum Actinobacteria. These shifts in communpan>ity compositionpan> subsequently led to a 15 anpan>d 35% increase in crop yield in 2 anpan>d 4-species mixtures, respectively. This suggests that the positive effects of crop diversity onpan> crop productivity canpan> partially be explained by chanpan>ges in soil microbial compositionpan>. However, the effects of crop diversity onpan> soil microbes were relatively small compared to the effects of abiotic factors such as fertilizationpan> (three times larger) or soil moisture (three times larger). Furthermore, these processes were conpan>text-dependent: in Spain, where resources were limited, soil microbial communpan>ities did not responpan>d to crop diversity, anpan>d their effect onpan> crop yield was less stronpan>g. This research highlights the potential beneficial role of soil microbial communpan>ities in intercropping systems, while also reflecting onpan> the relative importanpan>ce of crop diversity compared to abiotic drivers of microbiomes anpan>d emphasizing the conpan>text-dependence of crop-microbe relationpan>ships.
Copyright © 2021 Stefan, Hartmann, Engbersen, Six and Schöb.

Entities:  

Keywords:  annual crop yield; biodiversity–productivity relationship; crop diversification; intercropping; soil microbial communities; sustainable agriculture

Year:  2021        PMID: 33936016      PMCID: PMC8081861          DOI: 10.3389/fmicb.2021.660749

Source DB:  PubMed          Journal:  Front Microbiol        ISSN: 1664-302X            Impact factor:   5.640


Introduction

The past century has seen the emergence and the development of modern, intensive agriculture that was accompanied by a strong increase in productivity per unit land area (Barrios, 2007). However, the negative effects associated with this intensification now call for a transformation toward more sustainable agricultural production (Tilman et al., 2011). Current intensive agriculture indeed has negative effects on biodiversity (n class="Chemical">Newbold et al., 2015) anpan>d ecosystem funpan>ctionpan>ing (Barrios, 2007), including that of soils (Gardi et al., 2013). Inpan> particular, chemical inputs anpan>d the loss of crop diversity associated with intensive agriculture are known to negatively affect soil biodiversity (Cavicchioli et al., 2019), with conpan>sequences onpan> soil ecosystem funpan>ctionpan>ing, such as nutrient cycling, pan> class="Chemical">carbon storage, soil structure regulation, and pest and disease control (Wall and Bardgett, 2012; Wagg et al., 2014; Fanin et al., 2017). Losses of these essential soil functions can restrict plant growth and subsequently crop yield (Giller, 2001; Bardgett and Van Der Putten, 2014). n class="Chemical">Numerous studies demonpan>strated a stronpan>g link between soil microbes anpan>d planpan>ts (Wardle et al., 2004; Fry et al., 2018). First, direct specific linkages between a planpan>t species anpan>d a particular type of microbe, such as symbiotic interactionpan>s, might occur (Wubs anpan>d Bezemer, 2016). Moreover, planpan>ts have the ability to alter the soil chemical anpan>d physical conpan>ditionpan>s (López-Anpan>gulo et al., 2020). Some of these chanpan>ges canpan> be due to above-grounpan>d mechanpan>isms, such as litter inputs or variationpan>s in microclimate associated with planpan>t canpan>opy cover (Maestre et al., 2009; Trinder et al., 2009; Delgado-Baquerizo et al., 2018). Others may be the result of below-grounpan>d processes, such as increases in soil loosening anpan>d aerationpan> due to root growth, release of root exudates or planpan>t signaling molecules, anpan>d chanpan>ges in ionpan> uptake (Doornbos et al., 2012; Eisenhauer et al., 2017). Therefore, a greater richnpan>ess of planpan>ts, anpan>d subsequently, roots, would lead to a greater diversity of microhabitats, particularly in the rhizosphere (Philippot et al., 2013). The resulting microhabitat heterogeneity would then further enhanpan>ce microbial diversity (Wardle, 2006; Eisenhauer et al., 2010), which could also increase soil funpan>ctionpan>ing, following the diversity-ecosystem funpan>ctionpan>ing relationpan>ship (Tilmanpan> et al., 2006). For instanpan>ce, Steinauer et al. (2015) showed that increasing planpan>t diversity led to a significanpan>t increase in soil microbial biomass anpan>d enzymatic activity. Similarly, results from a grasslanpan>d biodiversity experiment demonpan>strated that higher planpan>t diversity resulted in increased microbial activity anpan>d pan> class="Chemical">carbon storage (Lange et al., 2015). Most of these studies were performed in natural grasslands; however, the extent to which the same effects would arise in diversified cropping systems is still unclear. Indeed, intercropping, which is defined as growing at least two crops at the same time on the same field, could be a promising way to enhance soil microbial diversity and functioning by increasing plant diversity in arable systems. This increase in soil diversity and functioning could then feedback on crop yield through enhanced microbial activity and nutrient mobilization or decreased pathogen accumulation (Zhao et al., 2011; Bender and van der Heijden, 2015; Wang et al., 2017). However, despite current technological advances to study soil microbes, soil microbial communities and their assembly mechanisms are still poorly understood (Van der Putten et al., 2013; López-Angulo et al., 2020). In particular, we are still unsure what soil microbes respond to—e.g., plant aboveground traits, plant root traits, plant community composition, plant functional diversity—and if these responses to the biotic environment are comparable to the effects of abiotic conditions, such as soil moisture, or nutrients. Consequently, the extent to which plant–microbe interactions in soils could influence crop yield of intercropping systems is still unclear. To shed light on this subject, we conducted an extensive common garden experiment including eight annual crop species belonging to four functional groups, and 40 different crop mixtures of two and four species, in which we determined soil microbial composition and measured soil respiration—as a proxy for soil functioning—in addition to crop yield. Moreover, we repeated the mesocosm experiment in two different countries—i.e., in Spain and Switzerland, which differ drastically in terms of climate and soil, and with and without fertilizer application in a fully factorial design. This experimental setup allowed us to examine the following research questions: (1) How does crop diversity affect soil microbial diversity and respiration in comparison to abiotic properties? (2) Are changes in soil microbial diversity and respiration related to crop yield? (3) Are crop–soil microbe relationships and their effects on crop yield environmentally context-dependent? We hypothesized that increasing crop diversity would lead to an increase in microbial (alpha) diversity as well as changes in bacterial and fungal community compositions—e.g., increases in symbionts, decomposers, or disease suppressive microbes—and that these changes would have a positive effect on soil basal respiration and crop yield. Finally, we hypothesized that changes in crop–microbe relationships and their impacts on crop yield would be context-dependent, with varying size effects in Switzerland and in Spain, which differ in terms of resource availability and environmental harshness.

Materials and Methods

Study Sites

The crop diversity experiment took place in outdoor experimental gardens in Zurich, Switzerland, and in Torrejón el Rubio, Cáceres, Spain. In Zurich, the garden was located at the Irchel campus of the University of Zurich (47.3961 n class="Chemical">N, 8.5510 E, 508 m a.s.l.). Inpan> Torrejón el Rubio, the garden was situated at the Aprisco de Las Corchuelas research stationpan> (39.8133 pan> class="Chemical">N, 6.0003 W, 350 m a.s.l.). Zurich is characterized by a temperate climate, while the Spanish site is located in a dry, Mediterranean climate. The main climatic differences during the respective growing seasons (i.e., between April and August in Switzerland and between February and June in Spain) were precipitation (587 mm in Zurich, 229 mm in Cáceres) and daily average hours of sunshine (5.7 h in Zurich, 8.8 h in Cáceres). Temperatures during the growing season did not vary substantially between the two sites: averages of daily mean, minimum and maximum temperatures were 15.8, 10.9, and 21.1°C in Zurich versus 15.5, 9.7, and 21.4°C in Cáceres. All climatic data come from the respective national meteorological archives and are average values over the years 2000–2018.[1] The experimental gardens were irrigated during the growing season with the aim of maintaining the above-mentioned differences in precipitation between the two sites while assuring survival of the crops during drought periods. In Spain, the automated irrigation system was configured for a dry threshold of soil moisture of 17% of field capacity, with a target of 25%. In Switzerland, the dry threshold was set at 50% of field capacity, with a target of 90% of field capacity. Whenever dry thresholds were reached (measured through PlantCare soil moisture sensors (PlantCare Ltd., Switzerland), irrigation was started and n class="Chemical">water added unpan>til reaching the target value. Each experimental garden consisted of square plots of 0.25 m2 with a depth of 40 cm. Beneath 40 cm the plots were open, allowing unlimited root growth. The plots were embedded into larger beds: in Switzerland, there were 14 beds of 14 m × 1 m, each bed containing 28 plots. In Spain, beds were 20 m × 1 m and contained 40 plots. Inside a bed, plots were separated from each other by n class="Chemical">metal frames. Each plot was filled unpan>til 30 cm with stanpan>dard, not enriched, agricultural soil coming from the local regionpan>. Therefore, soil structure anpan>d compositionpan> varied between sites anpan>d reflected the environpan>mental histories of each site. Inpan> Spain, soil was composed of 78% sanpan>d, 20% silt, anpan>d 2% clay, anpan>d conpan>tained 0.05% pan> class="Chemical">nitrogen, 0.5% carbon, 253 mg total P/kg. In Switzerland, the soil consisted of 45% sand, 45% silt, and 10% clay, and contained 0.19% nitrogen, 3.39% carbon, and 332 mg total P/kg. Spanish and Swiss soils had a mean pH of 6.30 and 7.25, respectively (Stefan et al., 2021). We fertilized half of the beds with n class="Chemical">nitrogen, n class="Chemical">phosphorus, and potassium at the concentration of 120 kg/ha N, 205 kg/ha P, and 120 kg/ha K. Fertilizers were applied three times, namely once just before sowing (50 kg/ha N, 85 kg/ha P, 50 kg/ha K), once when wheat was at the tillering stage (50 kg/ha N, 85 kg/ha P, 50 kg/ha K), and once when wheat was flowering (20 kg/ha N, 34 kg/ha P, 20 kg/ha K). The other half of the beds served as unfertilized controls. We randomly allocated individual beds to a fertilized or non-fertilized control treatment (Supplementary Figure 1).

Crop Species

At each site, experimental communities were constructed with eight annual crop species. We used crop species belonging to four different phylogenetic groups with varying functional characteristin class="Chemical">cs: pan> class="Species">Triticum aestivum (wheat, C3 grass) and Avena sativa (oat, C3 grass), Lens culinaris (lentil, legume) and Lupinus angustifolius (lupin, legume), Linum usitatissimum [flax, herb (superrosids)] and Camelina sativa [false flax, herb (superrosids)], and Chenopodium quinoa [quinoa, herb (superasterids)] and Coriandrum sativum [coriander, herb (superasterids)]. The crop cultivars that we chose were commercially available in Switzerland (the list of cultivars and suppliers can be found in Supplementary Table 1).

Experimental Crop Communities

Experimental communities consisted of control plots with no crops, monocultures, 2- and 4-species mixtures. We planted every possible combination of 2-species mixtures with two species from different phylogenetic groups and every possible 4-species mixture with a species from each of the four different phylogenetic groups present. We replicated the experiment two times with the exact same species composition in each country. Within each country, we replicated the complete setup with and without fertilizer; plots were randomized within each fertilizer treatment, with each plot receiving the same amount of fertilization in the fertilized treatment. Each monoculture and mixture community consisted of one, two or four species planted in four rows. Each row only consisted of a single species. Two species mixtures were organized following a speciesA| speciesB| speciesA| speciesB pattern, where the described pattern refers to the row in which they were planted. The order of the species was chosen randomly. For 4-species mixtures, i.e., A| B| C| D, the order of the rows was also randomized. Density of sowing differed among species groups and was based on current cultivation practices: 160 seeds/m2 for legumes, 240 seeds/m2 for n class="Chemical">superasterids, 400 seeds/m2 for cereals, anpan>d 592 seeds/m2 for superrosids. Seeds were sown by hanpan>d in early February 2018 in Spain anpan>d early April 2018 in Switzerlanpan>d. The plots were lightly tilled before sowing (at a depth of 5 cm). To sow, we dug four lines in the plots at 1–2 cm depth for all the species expect for the legumes, which were sown at 5 cm depth anpan>d for pan> class="Species">Camelina, which was sown at 0.5 cm. We then spread out the seeds in these lines and gently covered the surface. Germination and seedling establishment was controlled after two weeks; if germination was lower than 50% of the original seeds, additional seeds were resown to ensure that the plots would reach a sufficient plant density to allow plant interactions.

Data Collection

Soil Samples

Soil samples were collected in each plot during flowering of the crops (early May in Spain, early June in Switzerland). We took three samples per plot to a depth of 25 cm, one between each of the four plant rows of a plot, which we then pooled. These soil samples were transported cooled to the lab and sieved with a 2 mm mesh size.

Soil Activity Measured as Soil Basal Respiration

With the sieved soil samples, we then measured n class="Chemical">water content, n class="Chemical">water holding capacity, and incubated 25 g equivalent dry soil at a normalized moisture level (60% WHC) for 12 h in airproof jars. The CO2 content in the headspace was measured with a LiCor LI820 once at the beginning of the incubation and once at the end. The difference between the two measures corresponded to the amount of CO2 that had been produced by soil microbial respiration (Curiel Yuste et al., 2007).

DNA Extraction and Amplification

Total nucleic acids were extracted from 250 mg of sieved soil using the Dn class="Chemical">Neasy PowerSoil Kits (Qiagen, Hilden, Germanpan>y) following the supplier’s protocol. Conpan>centrationpan> of extracted DNA was measured photospectrometrically with the QIAxpert System (Qiagen). Amplicon sequencing library construction was performed following a two-step PCR approach. The first step was performed using specific primers targeting the bacterial and archeal 16S ribosomal RNA gene (region V3–V4) and the fungal internal transcribed spacer region ITS2 using primer pairs 341F and 806R (Frey et al., 2016) and ITS3ngs and ITS4ngsUni (Tedersoo and Lindahl, 2016), respectively, including the sequencing primer sites of the Illumina adapters P5 (CTTTCCCTACACGACGCTCTTCCGATCT) and P7 (GGAGTTCAGACGTGTGCTCTTCCGATCT) required for the second step index PCR (Illumina Inc., San Diego, CA, United States). PCR amplification was performed in a volume of 25 μl containing 20 ng of template DNA, 1x GoTaq® Flexi Buffer (Promega, Madison, WI, United States), 2.5 mM MgCl2 (Promega), 0.4 μM of each primer (Microsynth, Balgach, Switzerland), 0.2 mM dNTPs (Promega), 0.6 mg/ml BSA (VWR, Radnor, PA, United States) and 1.25 U GoTaq® G2 Hot Start Polymerase (Promega). The PCR conditions consisted of an initial denaturation at 95°C for 5 min, 28 (16S rRNA gene) or 35 (ITS2 rrn) cycles of denaturation at 95°C for 40 s, annealing at 58°C for 40 s and elongation at 72°C for 1 min, followed by a final elongation at 72°C for 10 min. Each sample was amplified in triplicates and subsequently pooled. Pooled DNA samples were sent to the Functional Genomics Center Zurich (FGCZ, Zurich, Switzerland) for the indexing PCR. Index PCR products were purified, quantified, and pooled in equimolar ratios prior to sequencing on the Illumina MiSeq platform using the v3 chemistry (Illumina Inc.).

Soil Moisture Level

At the same time as the collection of soil samples, volumetric soil n class="Chemical">water content was measured from the soil surface to a depth of 6 cm using a ML3 ThetaProbe Soil Moisture Sensor (Delta-T, Cambridge). The measurements were taken in the center of each of the three in-between rows per plot and averaged per plot.

Grain Yield

Grain yield of each crop species was determined in each plot when grains reached maturity (duration of crop growth from sowing to harvest given in Table 1). As time of maturity slightly varied among the different crops, we harvested species by species.
TABLE 1

Sowing and harvesting dates, and crop growth duration in mean days after sowing from sowing until harvest for both countries and all eight species.

SpeciesSowing dates
Harvesting dates
Days after sowing
SwitzerlandSpainSwitzerlandSpainSwitzerlandSpain
Avena sativa04.04.201802.02.201828.07.201827.06.2018115145
Triticum aestivum04.04.201802.02.201828.07.201827.06.2018115145
Lens culinaris04.04.201802.02.201812.08.201827.06.2018130145
Lupinus angustifolius04.04.201802.02.201812.08.201817.06.2018130135
Camelina sativa04.04.201802.02.201813.07.201802.07.2018100150
Linum usitatissimum04.04.201802.02.201822.08.201812.07.2018140160
Coriandrum sativum04.04.201802.02.201812.08.201827.06.2018130145
Chenopodium quinoa04.04.201802.02.201801.09.201804.08.2018150183
Sowing and harvesting dates, and crop growth duration in mean days after sowing from sowing until harvest for both countries and all eight species.

Data Analyses

Due to wild birds foraging on wheat seeds in Spain, and consequently, loss of data on wheat yield, we discarded the plots that were affected by the birds foraging. A total of 341 out of 384 plots remained, 181 in Switzerland and 160 in Spain.

Bioinformatics

Sequences were processed using a customized pipeline largely based on VSEARCH. The main steps included paired-end read merging using the fastq_mergepairs algorithm implemented in VSEARCH (Edgar and Flyvbjerg, 2015); primer trimming using Cutadapt (Martin, 2011) allowing for one mismatch; removing PhiX control reads using Bowtie2 (Langmead and Salzberg, 2012); quality filtering by maximum expected error of one using the fastq_filter function (Edgar and Flyvbjerg, 2015) implemented in VSEARCH; dereplicating sequences using the derep_fulllength function in VSEARCH; delineation of sequences into amplicon sequence variants (n class="Chemical">ASVs) using the unpan>oise3 algorithm (Edgar, 2016c) implemented as the cluster_unpan>oise funpan>ctionpan> in VSEARCH with anpan> alpha of 2 anpan>d minsize of 4; removal of potentially chimeric sequences using the uchime2 algorithm (Edgar, 2016b) implemented as the uchime3_denovo funpan>ctionpan> in VSEARCH; target verificationpan> using Metaxa2 (Bengtssonpan>-Palme et al., 2015) anpan>d ITSx (Bengtssonpan>-Palme et al., 2013) for the 16S rRNA gene and ITS2 sequences, respectively; mapping of the quality-filtered reads of each sample against the verified ASV sequences using the usearch_global function in VSEARCH; and taxonomic classification of each ASV sequence using the SINTAX classifier (Edgar, 2016a) implemented in VSEARCH with a bootstrap support of 0.8 against the SILVA database for the 16S rRNA sequences (Pruesse et al., 2007) and the UNITE database for the ITS2 sequences (Abarenkov et al., 2010). Non-fungal ITS2 sequences, as well as 16S rRNA sequences assigned to organelle structures (chloroplasts, mitochondria) were removed from the ASV table. To remove effects of variability in sequencing read numbers, we performed 100-fold iterative subsampling of the n class="Chemical">ASV table using the funpan>ctionpan> rrarefy from the veganpan> package in R (Oksanpan>en et al., 2019; R Core Team, 2019), anpan>d subsequently computed the meanpan> abunpan>danpan>ce for each pan> class="Chemical">ASV. Alpha diversity was assessed by calculating Shannon’s diversity (H) and Pielou’s evenness (J) indexes. We used linear mixed models followed by type I analysis of variance to analyze the effects of the experimental treatment on fungal and bacterial n class="Chemical">ASV richnpan>ess, H, anpan>d J, respectively. The anpan>alyses were performed for Spain anpan>d Switzerlanpan>d separately. Fixed factors included fertilizing conpan>ditionpan>, crop species number (i.e., two or four crop species) nested in monpan>oculture vs. mixtures, presence of cereal, presence of legume, presence of superrosid herb, presence of pan> class="Chemical">superasterid herb, as well as the interactions between them (except interactions between crop species number and monoculture vs. mixture and presence of functional group, respectively). Presences of the different functional groups were all binary factors (yes, no). Species composition and bed were set as random factors. Homogeneity of variance and normality of residues were assessed visually and with Shapiro-Wilk tests (Royston, 1982). To analyze the responses of the microbial community composition to the experimental treatments, we first performed principal coordinates analysis (PCoA) using Bray-Curtis dissimilarity on relative n class="Chemical">ASV abunpan>danpan>ce (Gower, 1966). To that end, sparse pan> class="Chemical">ASVs (i.e., ASVs that appeared in one or two plots only) were removed, and relative abundance was log-transformed. We first performed this analysis taking both countries together, and in a second time, per country separately. Then, we used permutational multivariate analyses of variance (PERMANOVA; Anderson, 2001) with Bray-Curtis dissimilarity on the previously described composition matrices (i.e., separated per country), using the function adonis from the vegan package with 999 permutations (Oksanen et al., 2019). Experimental factors tested included fertilization, crop diversity treatments (monocultures vs. mixtures, crop species number, presence of the different functional groups and/or species), and their interactions. Homogeneity of variance was tested using permutational analysis of multivariate dispersion (PERMDISP; Anderson, 2006) implemented as the betadisper function in vegan with 999 permutations. Finally, we conducted a canonical analysis of principal coordinates (CAP; Anderson and Willis, 2003) for each country using the function CAPdiscrim from the BiodiversityR package (Kindt and Coe, 2005). We analyzed species-specific and phylum-specific responses to the experimental factors with indicator species analyses using the indin class="Chemical">cspecies package (Cáceres and Legendre, 2009), calculating the point-biserial correlationpan> coefficient, and correcting for multiple testing using the Benjamini-Hochberg method with the p.adjust functionpan> from the stats package (Benjamini and Hochberg, 1995). We calculated total crop yield per plot (measured as the sum of grain mass of each species per plot), and the net biodiversity effect (n class="Chemical">NE) following the method from Hector and Loreau as the deviationpan> from total expected yield in the mixture (Loreau and Hector, 2001). We then used the same linear mixed models as described above to analyse the responpan>se of total crop yield and NE to the experimental treatment variables, in Spain and in Switzerland, respectively.

Structural Equation Modeling

Considering the possibilities of direct and indirect effects of the different environmental and experimental variables (fertilizer, crop species richness) on soil moisture, soil microbes, soil respiration, and crop yield (measured as total grain mass per plot), we then applied structural equation modeling (SEM) to our data sets, separately for Switzerland and Spain. Because the effects of crop species number and crop community composition were correlated (for instance the 4-species mixtures automatically had one cereal, one legume, and two herbs) and thus difficult to disentangle in our study, we decided for simplicity of the SEM to only keep crop species number as a variable for crop diversity. The SEMs were built, run and evaluated with the lavaan package (Rosseel, 2012). We decided to fit the SEM to the Swiss and Spanish datasets separately because microbial composition in the two countries showed large differences. SEM allows to test complex a priori defined direct and indirect relationships in a unique framework and to assess the overall fit of the data to the model (Grace, 2006). For our a priori model, we considered environmental variables (fertilizer), crop species richness, soil moisture level in terms of volumetric n class="Chemical">water conpan>tent, soil microbial alpha diversity measures (bacterial anpan>d funpan>gal Shanpan>nonpan> indexes), soil microbial beta diversity measures (coordinates from the three first axes of the principal coordinates anpan>alyses for funpan>gi anpan>d bacteria, respectively), soil activity measured as pan> class="Chemical">CO2 flux, and total crop yield per plot. Our a priori model relating environmental and experimental factors, soil moisture, soil microbial diversity, soil activity and crop yield included the following hypotheses: (1) soil microbial diversity components (i.e., alpha diversity and community composition axes) are directly influenced by the environmental conditions (fertilizer), soil moisture, and the experimental treatment (crop species richness). (2) Soil activity can be affected directly or indirectly by crop species richness, soil moisture and fertilizer; the relationship can be indirect if effects on soil activity are mediated by effects on soil diversity measures. (3) Crop yield can also be directly or indirectly affected by crop species richness, soil moisture and fertilizer. The relationship can be indirect if effects on crop yield are mediated through changes in soil microbial diversity measures or soil activity. (4) All the soil microbial diversity measures can covary with each other. To overcome scale differences among variables, we log-transformed crop yield before inclusion in the SEM. Path coefficients were estimated using maximum likelihood, and the model n class="Disease">fits were tested with a chisquare goodness of fit test, a Bollen–Stine bootstrap test with 1000 bootstrap draws, a root mean square error of approximationpan> (RMSEA) test, and the comparative fit index (CFI). A nonpan>-significant chisquare, Bollen–Stine and RMSEA test, as well as CFI values above 0.90, indicate a good fit of the model to the data (Kline, 2011). Finally, we calculated the weighted average score of each n class="Chemical">ASV based on the previously mentioned PCoA decompositions, and subsequently investigated with linear models which bacterial and fungal genera were non-randomly distributed along the PCoA axes.

Results

After sequencing, the fungal dataset contained 9,713,470 reads delineated into 7,856 ASVs. After removing all nonpan>-funpan>gal pan> class="Chemical">ASVs, we obtained 6,161,288 reads assigned to 3,546 ASVs. The vast majority of the removed ASVs were assigned to plants despite having sieved the soils with 2 mm mesh size, which suggests low fungal biomass in our system. The bacterial dataset contained 6,394,402 reads delineated into 4,4136 ASVs. After removing all sequences associated with chloroplasts and mitochondria, we obtained 6,306,145 reads assigned to 43,857 ASVs.

Soil Microbial Alpha Diversity

All diversity metrin class="Chemical">cs were consistently lower in Switzerland compared to Spain (Figure 1): mean fungal n class="Chemical">ASV richness was 608 in Spain, against 324 in Switzerland (-47%), whereas fungal H was lower by 22% and fungal J by 13%. Similarly, mean bacterial ASV richness was lower by 30% (i.e., 803 vs. 561 ASVs in Spain vs. Switzerland); bacterial H was 16% lower and bacterial J 11% lower in Switzerland compared to Spain.
FIGURE 1

Effects of fertilizer on fungal (A) and bacterial (B) Shannon’s diversity index (H), and of crop species number on fungal (C), and bacterial (D) ASV richness in Spain and Switzerland. Horizontal lines represent the median of the data, boxes represent the lower and upper quartiles (25 and 75%), with vertical lines extending from the hinge of the box to the smallest and largest values, no further than 1.5× the interquartile range. Data beyond the end of the whiskers are outlying and plotted individually. See Tables S2 and S3 for the results of the statistical analyses.

Effects of fertilizer on fungal (A) and bacterial (B) Shannon’s diversity index (H), and of crop species number on fungal (C), and bacterial (D) n class="Chemical">ASV richnpan>ess in Spain and Switzerland. Horizonpan>tal lines represent the median of the data, boxes represent the lower and upper quartiles (25 and 75%), with vertical lines extending from the hinge of the box to the smallest and largest values, no further than 1.5× the interquartile range. Data beyonpan>d the end of the whiskers are outlying and plotted individually. See Tables S2 and S3 for the results of the statistical analyses. In Spain, bacterial H was marginally lower (2%) in fertilized compared to unfertilized plots (Supplementary Table 2 and Figure 1B). Furthermore, the presence of a n class="Chemical">superasterid herb marginally increased bacterial pan> class="Chemical">ASV richness (+2.5%) and decreased bacterial J (−1%). In Switzerland, fertilization decreased bacterial n class="Chemical">ASV richnpan>ess (−16% in fertilized compared to unpan>fertilized plots) but increased bacterial evenness (+4%) (Supplementary Table 3). Funpan>gal pan> class="Chemical">ASV richness marginally increased with crop species number (Figure 1C; +7% in 4-species mixtures compared to monocultures and +4% compared to 2-species mixtures), while bacterial ASV richness was higher in 2-species mixtures compared to 4-species mixtures (Figure 1D). Finally, the presence of a legume marginally decreased fungal H (−1%) and J (−1%) in comparison to plots without legumes, while cereal presence marginally decreased bacterial J (−2%).

Soil Microbial Community Composition

Fungal and bacterial community composition differed strongly between countries (Supplementary Figure 2), with the country accounting for 66 and 52% of the variance in fungal and bacterial communities, respectively (Supplementary Table 4). All other factors explained less than 1% of the remaining variance. In Spain, fungal communities were characterized by higher relative abundance of Ascomycota, Mortierellomycota, and Mucoromycota, while the fungal communities in the Swiss soils had relatively more Basidiomycota, Chytridiomycota, and Rozellomycota (Supplementary Figures 3A, 4A). n class="Chemical">Notable chanpan>ges in bacterial communpan>ities between the two counpan>tries include higher relative abunpan>danpan>ce of Planpan>ctomycetes, Actinobacteria, Acidobacteria, anpan>d Nitrospirae in Spain, while in Switzerland bacterial communities showed more Proteobacteria, Chloroflexi, Bacteroidetes, and Cyanobacteria (Supplementary Figures 3B, 4B). In Spain, the community composition of both fungi and bacteria was significantly affected by fertilization, presence of cereal, as well as their interaction (Table 2 and Supplementary Figures 5, 6). The interaction between fertilizer and the presence of legume also had an effect on fungal communities in Spain. Fertilized plots had fungal communities with relatively more Chytridiomycota, while Mortierellmycota, Mucoromycota, and Kickxellomycota were positively linked to unfertilized plots (Supplementary Figure 7A). For bacterial communities, we observed a relative increase of Proteobacteria, Actinobacteria, n class="Chemical">Nitrospirae, Firmicutes, anpan>d pan> class="Species">Patescibacteria in fertilized plots, while Planctomycetes, Acidobacteria, and Chloroflexi were more abundant in unfertilized plots. Deinococcus-Thermus and Fibrobacteres increased in relative abundance in the presence of cereals, while Nitrospirae was associated with the absence of cereals (Supplementary Figure 9A).
TABLE 2

Results of the permutational analysis of variance, showing R2 and significance of the considered factors for the community composition of fungi and bacteria in Spain and Switzerland.

Fungi community composition
Bacteria community composition
Spain
Switzerland
Spain
Switzerland
R2p-valueR2p-valueR2p-valueR2p-value
Fertilizer0.04710.0010***0.03370.0010***0.04270.0010***0.04250.0010***
Monoculture vs mixture0.00540.84700.00620.26700.00700.29800.00550.3920
Crop species number (2 vs 4)0.00680.38200.01320.0020**0.00720.24200.01040.0040**
Cereal0.01560.0010***0.01780.0010***0.00930.0380*0.01300.0020**
Legume0.00830.11300.01650.0020**0.00790.15100.01240.0010***
Superasterid herb0.00870.06400.00930.0320*0.00690.30500.00770.0660
Fertilizer x mono vs mixture0.00650.46300.00510.49700.00590.71900.00770.0590
Fertilizer x species number0.00670.42100.00520.48200.00600.67400.00480.6960
Fertilizer x cereal0.01000.0290*0.00590.31500.01010.0240*0.00550.4010
Fertilizer x legume0.00990.0240*0.00380.85800.00810.12700.00790.0430*
Fertilizer x superasterid herb0.00540.81900.00550.40700.00620.59800.00690.1200
Results of the permutational analysis of variance, showing R2 and significance of the considered factors for the community composition of fungi and bacteria in Spain and Switzerland. In Switzerland, fungal and bacterial communities were affected by fertilization, crop species number, presence of cereal and presence of legume (Table 2 and Supplementary Figures 5, 6). Fungal communities were also affected by the presence of n class="Chemical">superasterid herbs. The interactionpan> of fertilizationpan> anpan>d presence of legume had anpan> effect onpan> bacterial communpan>ities. Mucoromycota were more abunpan>danpan>t in fertilized plots, while Ascomycota were more present in unpan>fertilized plots (Supplementary Figure 7B). For bacterial communpan>ities, we noticed anpan> increase in Proteobacteria, pan> class="Species">Patescibacteria, Hydrogenedentes, Bacteroidetes, and Cyanobacteria in fertilized plots, while Planctomycetes, Actinobacteria, and Firmicutes were more abundant in unfertilized plots. Furthermore, there was an increase in the relative abundance of Fibrobacteres, Verrucomicrobia, and Armatimonadetes in the presence of cereals, while plots with no cereal had more Hydrogenedentes and Latescibacteria (Supplementary Figure 9B).

Total Crop Yield and Net Biodiversity Effect (NE)

Total crop yield had an average of 416 g/m2 in Spain and 784 g/m2 in Switzerland. In Spain, total crop yield was only increased by the presence of a legume (+72%) (Figure 2A and Supplementary Table 5). In Switzerland, total crop yield significant increased with crop species number (Figure 2B and Supplementary Table 6): two-species and four-species mixtures showed an increase in average yield of 43 and 102% compared to monocultures, while 4-species mixture showed an increase in average yield of 41% compared to 2-species mixtures. The presence of a cereal and a n class="Chemical">superasterid herb increased total yield in Switzerlanpan>d (+102%, +96%), while the presence of a legume decreased total yield (-20%) (Figure 2A).
FIGURE 2

Effects of legume presence and crop species number on total crop yield (A,B), and effects of crop species number, presence of cereal and legume on Net biodiversity Effects (C–E) in Spain and Switzerland. Horizontal lines represent the median of the data, boxes represent the lower and upper quartiles (25 and 75%), with vertical lines extending from the hinge of the box to the smallest and largest values, no further than 1.5 × the interquartile range. Data beyond the end of the whiskers are outlying and plotted individually. See Tables S5, S6, S7 and S8 for the results of the statistical analyses. *p < 0.05, **p < 0.01, and ***p < 0.001.

Effects of legume presence and crop species number on total crop yield (A,B), and effects of crop species number, presence of cereal and legume on n class="Chemical">Net biodiversity Effects (C–E) in Spain and Switzerland. Horizonpan>tal lines represent the median of the data, boxes represent the lower and upper quartiles (25 and 75%), with vertical lines extending from the hinge of the box to the smallest and largest values, no further than 1.5 × the interquartile range. Data beyonpan>d the end of the whiskers are outlying and plotted individually. See Tables S5, S6, S7 and S8 for the results of the statistical analyses. *p < 0.05, **p < 0.01, and ***p < 0.001. n class="Chemical">Net biodiversity effect was positive in both countries, which means that the mixtures conpan>sistently overyielded. However, NE was much higher in Switzerland compared to Spain (+680%) (Figure 2C). In Spain, NE was significantly reduced by the presence of a cereal (−108%) and increased in the presence of a legume (+219%) (Figures 2D,E and Supplementary Table 7). In Switzerland, NE was significantly higher in 4-species mixtures compared to 2-species mixtures (+150%) (Figure 2C and Supplementary Table 8).

Structural Equation Modeling

Our data showed overall good fit to our a priori SEM in Spain and Switzerland: chisquare = 3.828 (Spain) and 4.939 (Switzerland); P(chisquare) = 0.281 (Spain) and 0.173 (Switzerland); P(Bollen–Stine Bootstrap) = 0.459 (Spain) and 0.464 (Switzerland); RMSEA = 0.046 (Spain) and 0.064 (Switzerland); P(RMSEA) = 0.415 (Spain) and 0.321 (Switzerland); CFI = 0.999 (Spain) and 0.997 (Switzerland). In Spain, soil diversity measures were mostly influenced by fertilizer and soil moisture (Figure 3A). Soil microbial activity was directly influenced by soil moisture, fungal PCoA 2 and bacterial PCoA 2. Crop yield was only linked to bacterial PCoA axis 2. Bacterial PCoA axis 2 was associated with a response of Bacilli, Actinobacteria and Acidobacteria, among others (Supplementary Figure 11), which therefore correlated with an increase in crop yield in our study. Fertilization had an indirect positive effect on crop yield via changes in bacterial PCoA axis 2.
FIGURE 3

Structural Equation Modeling showing the relationships between crop diversity, fertilizer, soil moisture, soil activity, and bacterial and fungal diversity measures in Spain (A) and Switzerland (B). H: Shannon’s diversity. Only significant (solid line) and marginally significant (dashed line) relationships are shown. Width of arrows are proportional to the strength of the standardized path coefficients indicated by the numbers above the arrows. The numbers in brackets indicate associated p-values. Colors of the arrows show positive (green) and negative (gray) effects. Residual correlations are not shown.

Structural Equation Modeling showing the relationships between crop diversity, fertilizer, soil moisture, soil activity, and bacterial and fungal diversity measures in Spain (A) and Switzerland (B). H: Shannon’s diversity. Only significant (solid line) and marginally significant (dashed line) relationships are shown. Width of arrows are proportional to the strength of the standardized path coefficients indicated by the numbers above the arrows. The numbers in brackets indicate associated p-values. Colors of the arrows show positive (green) and negative (gray) effects. Residual correlations are not shown. In Switzerland, fertilizer and soil moisture also significantly influenced almost all the soil diversity measures (Figure 3B). Moreover, crop diversity had a direct effect on soil moisture, bacterial and fungal H, fungal PCoA axis 2, and bacterial PCoA axis 2. Soil microbial activity was negatively affected by bacterial H, and positively by the first and second axes of bacterial PCoA. Crop yield was directly affected by some soil diversity measures (fungal PCoA axes 1 and 2, bacterial PCoA axes 1 and 2), and also by crop diversity, fertilizer and soil moisture. Crop diversity indirectly increased soil activity in Switzerland through changes in bacterial H and the second axis of bacterial PCoA. Crop diversity indirectly affected crop yield in Switzerland through five different pathways. Firstly, there were two indirect positive effects through the second axis of fungal PCoA (Figure 4); fungi genera associated with negative coordinates along the PCoA axis 2 included for instance Kondoa, Serendipita, Mucor, or Leucospiridium, among others (Supplementary Figure 10). The presence of these fungal genera is therefore linked to an increase in crop yield. Secondly, there were two positive effects of crop diversity on crop yield mediated by the second axis of bacterial PCoA (Figure 5). Bacterial PCoA axis 2 is related to a response of n class="Chemical">Nitriliruptoria, Chloroflexia, Acidimicrobia, anpan>d Actinobacteria, amonpan>g others (Supplementary Figure 12B); these bacteria thus form anpan>other potential group of yield promoting soil microbes in our study (Figures 5, 6). Finally, crop diversity indirectly increased crop yield through the first axis of bacterial PCoA. Bacterial genera associated with negative coordinates alonpan>g the PCoA axis 1 include Nitriliruptoria, Actinobacteria, Acidimicrobia, Chloroflexia, and Bacilli, among others (Supplementary Figure 12A), i.e., a third group of yield promoting soil microbes in our study (Figure 6). Fertilization had an indirect positive effect on crop yield, via changes in fungal PCoA axes 2 and 3, but also an indirect negative effect on crop yield, mediated by changes in bacterial PCoA axis 1.
FIGURE 4

Effects of crop species number on the coordinates of the second axis of fungal PCoA decomposition (A) and correlation between these coordinates and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: −288, p-value = 0.00037). *** indicates the significance level of the effects of crop species number on fungal PCoA 2 (p-value < 0.001).

FIGURE 5

Effects of crop species number on the coordinates of the second axis of bacterial PCoA decomposition (A) and correlation between these coordinates and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: 779, p-value < 0.001). **indicates the significance level of the effects of crop species number on bacterial PCoA 2 (p-value < 0.01).

FIGURE 6

Effects of crop species number on the proportion of Actinobacteria (A) and correlation between the proportion of Actinobacteria and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: 26.8, p-value < 0.001). **indicates the significance level of the effects of crop species number on bacterial PCoA 2 (p-value < 0.01).

Effects of crop species number on the coordinates of the second axis of fungal PCoA decomposition (A) and correlation between these coordinates and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: −288, p-value = 0.00037). *** indicates the significance level of the effects of crop species number on fungal PCoA 2 (p-value < 0.001). Effects of crop species number on the coordinates of the second axis of bacterial PCoA decomposition (A) and correlation between these coordinates and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: 779, p-value < 0.001). **indicates the significance level of the effects of crop species number on bacterial PCoA 2 (p-value < 0.01). Effects of crop species number on the proportion of Actinobacteria (A) and correlation between the proportion of Actinobacteria and total crop yield (B) in Switzerland. In panel (B), the line represents the linear regression (coefficient: 26.8, p-value < 0.001). **indicates the significance level of the effects of crop species number on bacterial PCoA 2 (p-value < 0.01).

Discussion

Our study shows that fertilization, as well as—in some cases—crop diversity and composition, can affect soil microbial community composition, and that these compositional changes can go along with changes in crop yield. In particular, the data suggests that in Switzerland, the positive effects of increasing crop diversity on crop yield are partially mediated by changes in microbial composition, notably through a response of plant-growth promoting bacteria. However, as expected, changes in soil microbes do not fully explain yield variations and thus, other processes must play an important role in increasing crop yield in mixtures. Furthermore, the effects of crop diversity on microbial communities remained small compared to the effects of fertilization. In Spain, where soil resources were limited and both crop and soil communities experienced more stressful environmental conditions than in Switzerland, we did not observe any significant responses of soil microbes to crop diversity. We suggest that this context-dependency of crop diversity effects on soil microbes and ecosystem functioning might be explained by differences in abiotic factors; however, further research in various environmental conditions is needed to better understand the reasons behind this context-dependency.

Crop Species Number Effects on Microbes

Our first hypothesis was that an increase in crop diversity would lead to an increase in microbial alpha diversity as well as changes in soil microbial community composition. We did observe an increase in fungal n class="Chemical">ASV richnpan>ess in responpan>se to crop diversity, but this effect was onpan>ly marginally present in Switzerlanpan>d. This is conpan>sistent with results from studies in natural environpan>ments, where planpan>t species richnpan>ess positively correlated with funpan>gal richnpan>ess (Yanpan>g et al., 2017). There was no effect of crop diversity onpan> anpan>y of the bacterial alpha diversity measures; however, in both counpan>tries, we observed chanpan>ges in bacterial anpan>d funpan>gal beta diversity in responpan>se to crop diversity anpan>d crop compositionpan> (Table 2). Inpan> Switzerlanpan>d notably, we observed a shift in soil funpan>gal anpan>d bacterial compositionpan> between 2-species mixtures anpan>d 4-species mixtures. This is in agreement with previous research demonpan>strating that planpan>t diversity did not correlate with microbial alpha diversity, but it did with beta diversity (Grüter et al., 2006; Prober et al., 2015). Moreover, crop compositionpan> also affected microbial communpan>ities: for instanpan>ce, the presence of a cereal induced chanpan>ges in funpan>gal anpan>d bacterial soil communpan>ities in both counpan>tries, with a notable increase in abunpan>danpan>ce of Fibrobacteres, Armatimonpan>adetes, anpan>d Verrucomicrobia. The two latter groups have commonpan>ly been founpan>d in the rhizosphere of wheat or oat, even though little is known about their funpan>ctionpan>s (Rascovanpan> et al., 2016; Dai et al., 2020; Lupwayi et al., 2020). The responpan>se of Fibrobacteres—which are mostly involved in the degradationpan> of planpan>t-based cellulose (Gupta, 2004)—to the presence of a cereal has been scarcely mentionpan>ed in previous research (Mahonpan>ey et al., 2017). These chanpan>ges in microbial compositionpan> may be due to above-grounpan>d processes linked to crop diversity anpan>d compositionpan>, such as variationpan>s in microclimate associated with planpan>t canpan>opy cover (Delgado-Baquerizo et al., 2018), or below-grounpan>d processes, such as increased diversity of root exudates or planpan>t signaling molecules (Eisenhauer et al., 2017); however, more research is needed to investigate the mechanpan>isms behind these specific responpan>ses. Secondly, we hypothesized that crop diversity would enhance soil activity; this was indeed the case in Switzerland, where crop diversity increased soil respiration via changes in bacterial richness and composition (Figure 3B). This is consistent with grassland studies demonstrating a positive link between plant diversity and soil microbial activity (Lange et al., 2015; Steinauer et al., 2015), possibly due to increases in root inputs, changes in root exudates (Bais et al., 2006), or a reduction in evapotranspiration from the topsoil due to denser vegetation in diverse plant communities (Lange et al., 2014).

Soil Microbes Partially Explain the Positive Effects of Intercropping on Yield in Switzerland

Results from our SEM in Switzerland suggest that the changes in soil microbial communities induced by crop diversity further affected crop yield (Figure 3B). We had previously shown that there was a positive effect of crop species richness on crop yield in Switzerland, demonstrating a positive diversity–productivity relationship (Figure 2B; Chen et al., 2020; Engbersen et al., 2020). Here, we provide evidence that these positive effects of intercropping on crop yield can partially be explained by changes in microbial communities. Indeed, increasing crop diversity was linked to an increase in yield through five indirect pathways mediated by changes in fungal or bacterial composition (Figure 3B). We noticed that those changes in microbial composition associated with increases in crop yield were characterized by a response of potentially beneficial bacteria such as plant growth-promoting rhizobacteria (PGPRs). For instance, this was the case of Actinobacteria (Figure 6 and Supplementary Figure 11, 12), which are known to be symbionts of plants as well as saprophytes (Bhattacharyya and Jha, 2012). They also play a role as biocontrol agents against a range of pathogenic fungi and promote plant growth (Merzaeva and Shirokikh, 2006; Franco-Correa et al., 2010). Some examples include Glycomyces, Agromyces, or n class="Chemical">Nocardioides, which are genera of PGPRs (Qin et al., 2011; Hamedi anpan>d Mohammadipanpan>ah, 2014), anpan>d Streptomyces, known to associate with wheat anpan>d possessing anpan>ti-funpan>gal properties (Conpan>n anpan>d Franpan>co, 2004). Other potential PGPRs that were founpan>d to positively correlate with crop yield in our study include Pseudomonpan>as, pan> class="Species">Burkholderia, Bacillus, and Massilia (Supplementary Figure 11, 12). Pseudomonas has been shown to promote plant growth as well as inhibit pathogenic fungi (Gray and Smith, 2005; Melo et al., 2016). Burkholderia and Bacillus can be involved in phosphate solubilization (Dimkpa et al., 2009; Zhao et al., 2014) and symbiotic associations with wheat (Shaharoona et al., 2007; Moreno-Lora et al., 2019). Finally, Massilia has been shown to correlate with an increase in plant biomass for alfalfa and soybean (Xiao et al., 2017). Some bacteria involved in nitrogen cycling also positively correlated with the PCoA coordinates leading to an increase in crop yield in Switzerland, such as Nitrosospira—ammonia-oxidizing genus (Fierer et al., 2007), and Nitrolancea—nitrite-oxidizing genus (Daims et al., 2016). When looking at fungi, our results showed that in Switzerland crop yield was positively associated with fungal genera including Claroideoglomus, Myrmecridium, Serendipita, Mucor, as well as several n class="Species">yeasts (e.g., Torula, Konpan>doa, Leucosporidium) (Supplementary Figure 10). Claroideoglomus belonpan>gs to the Glomerales order, which are biotrophic mutualists anpan>d canpan> establish arbuscular mycorrhizal networks with wheat (Dai et al., 2014). Myrmecridium anpan>d Mucor are saprophytes, involved in decompositionpan> of organpan>ic matter anpan>d nutrient cycling (Schlatter et al., 2018), while Serendipita are planpan>t growth promoting funpan>gi which have been shown to have beneficial effects onpan> manpan>y planpan>ts, including wheat (Singhal et al., 2017). Finally, pan> class="Species">yeasts have also been suggested as potential bio-agents and plant growth promoters (Mukherjee et al., 2020); furthermore, they are a nutrient source for some bacteria and contribute to essential soil ecological processes such as mineralization of organic matter (Botha, 2011). Among the fungal genera associated with positive PCoA coordinates, i.e., lower crop yield, we found a few plant pathogens, such as Protomyces, causing stem gall disease in coriander (Khan and Parveen, 2018), and Pyrenochaeta, a parasite for plant roots (Aragona et al., 2014). Our study thus suggests that in Switzerland, increasing crop diversity leads to changes in microbial communities that enhance the presence of beneficial microbes and reduce pathogen loads, which may promote plant growth and contribute to the observed increase in crop yield.

The Importance of Microbial Communities Is Relative and Context-Dependent

While changes in soil microbial composition explained part of the positive effects of crop diversity on crop yield, there were also direct effects of intercropping on yield (i.e., not mediated by microbes) in Switzerland. This demonstrates that other mechanisms must play a role in increasing crop productivity in diverse mixtures. These processes could include a complementary use of resources, such as nutrient or light partitioning (Jesch et al., 2018; Engbersen et al., 2020), trait differentiation (Cadotte, 2017), or changes in crop–weed interactions (Stefan et al., 2020). Moreover, our study highlights the context-dependency and relative importance of crop diversity effects on soil microbes. Indeed, our results suggest that abiotic factors such as fertilization or soil moisture were more important drivers of soil microbial communities than crop diversity. This is consistent with previous research indicating that soil microbial community composition mainly depends on soil moisture, temperature, and organic matter contents, and that these factors are often more important than crop diversification (Ren et al., 2018; Guo et al., 2020). In our case, in Switzerland, the effects of soil moisture and fertilization on microbial composition were indeed up to three times stronger than the effect of crop diversity (Figure 2B). Interestingly, fertilization in Switzerland seemed to have conflicting indirect effects on yield: on the one hand, it promoted fungal communities that were beneficial for crop yield, such as Mucoromycota (Supplementary Figure 7B), but on the other hand, it also favored bacteria that were not positively associated with crop yield, such as Proteobacteria. Bacterial phyla responding to mineral fertilization included Proteobacteria, Hydrogenedentes, Bacteroidetes, and Cyanobacteria (Supplementary Figure 8B). This is consistent with previous studies demonstrating that the relative abundance of Proteobacteria and Bacteroidetes generally increase under high-n class="Chemical">N conpan>ditionpan>s (Fierer et al., 2012). Bacteroidetes anpan>d manpan>y proteobacterial groups have been identified as copiotrophic taxa, which tend to thrive in resource-rich environpan>ments (Fierer et al., 2007; Ramirez et al., 2010). Onpan> the conpan>trary, Actinobacteria, which include manpan>y PGPRs, was significanpan>tly more abunpan>danpan>t in unpan>fertilized plots (Supplementary Figure 8B). Therefore, we might hypothesize that high-pan> class="Chemical">N conditions would favor the growth of Proteobacteria at the expense of Actinobacteria (Lupwayi et al., 2018), thereby limiting the abundance of plant beneficial bacteria. In Spain, soil microbes responded to soil moisture and fertilization but did not respond to crop diversity. We propose several reasons for this lack of crop–microbe relationship in Spain, while acknowledging the speculative character of the following suggestions due to the limitations of having one unique site per country. First, soil texture in Spain was dominated by sand (78%) with only a small proportion of clay (2%), unlike Switzerland where sand and silt were in equal proportions (45%) with a higher clay content (10%). Higher clay and silt content usually protect and favor microbial biomass (Bach et al., 2010) through larger aggregates (Wick et al., 2009), greater n class="Chemical">water holding capacity (Voronpan>ey, 2007), anpan>d increased nutrient retentionpan> (Knops anpan>d Tilmanpan>, 2000). This is supported by the fact that microbial DNA concentration was indeed much lower in Spain (Supplementary Figure 13), which indicates that the soil microbial communities were poorer in Spain in terms of biomass, and consequently perhaps more resistant to change (Landesman and Dighton, 2010). Secondly, the climate in Spain is more arid than in Switzerland, which led to lower soil moisture and increased water stress for plant and soil communities. Also, soil nutrient content was lower in Spain. Spanish soil communities thus experienced greater abiotic stress than in Switzerland, which may be why they primarily responded to soil moisture or fertilization—factors that can directly alleviate their stress—rather than crop diversity. Furthermore, there was almost no link between microbial communities and crop yield in Spain; in particular, fungal communities did not have any effect on crop yield, while only one axis of the bacterial composition positively affected yield in response to fertilization (Figure 3A). This decoupling between yield and soil microbes suggests that crop productivity in Spain might be limited by other, more impactful factors that could overshadow any potential effects of microbes, such as nutrient or water availability. This is consistent with a recent study by Adomako et al. (2020), in which they found that the positive effects of soil microbes on plant biomass were stronger under high nutrient and water availability compared to low resource conditions. Indeed, in conditions of nutrient stress, microbial communities may compete for the limited available nutrients (Ho and Chambers, 2019). If the amount of nutrients is insufficient, it is possible that microbes cannot exchange nutrients for carbon with the plants anymore, which can lead to negative plant–soil feedbacks (Petermann et al., 2008; Zandt et al., 2019). In the other way around, nutrient or water limitation, by restricting plant growth—as it was the case in Spain (Figure 2A)—might also reduce the amount of carbon provided by the plants to fuel the microbial communities (Harrison and Bardgett, 2010). This reduction in plant–soil feedbacks raises important questions on the universality of the role of soil microbes for plant growth, and calls for more experiments in various soil and climatic conditions to confirm and improve our understanding of crop–soil microbes relationships in agricultural systems.

Conclusion

Our study shows that in some cases, crop diversity has the potential to influence soil microbial community composition and that these changes partially explain the positive effects of intercropping on yield. However, these effects are relative and less important than changes in abiotic factors, such as the addition of mineral fertilizer. Furthermore, these processes are context-dependent: in Spain, soil microbial communities do not respond to crop diversity, and their effect on crop yield is weaker. We hypothesize that these contrasting responses could be explained by differences in abiotic conditions and resources. However, further investigation is required to test this context-dependency hypothesis. Considered as a whole, this research suggests that soil microbial communities can play a beneficial role in intercropped systems. Yet this positive result is not universal; on the contrary, it reflects on the relative importance of microbial communities compared to abiotic factors for increasing crop productivity, and highlights the context-dependency of crop–microbe relationships.

Data Availability Statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://doi.org/10.5281/zenodo.4479277.

Author Contributions

LS and n class="Chemical">CS conceived the study with input from MH, JS, and NE. LS, NE, and CS collected the data. LS assembled and analyzed the data with the help of CS and MH. LS, MH, and CS wrote the manuscript. All authors discussed the data analyses and results.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  60 in total

1.  The UNITE database for molecular identification of fungi--recent updates and future perspectives.

Authors:  Kessy Abarenkov; R Henrik Nilsson; Karl-Henrik Larsson; Ian J Alexander; Ursula Eberhardt; Susanne Erland; Klaus Høiland; Rasmus Kjøller; Ellen Larsson; Taina Pennanen; Robin Sen; Andy F S Taylor; Leho Tedersoo; Björn M Ursing; Trude Vrålstad; Kare Liimatainen; Ursula Peintner; Urmas Kõljalg
Journal:  New Phytol       Date:  2010-04       Impact factor: 10.151

Review 2.  The role of root exudates in rhizosphere interactions with plants and other organisms.

Authors:  Harsh P Bais; Tiffany L Weir; Laura G Perry; Simon Gilroy; Jorge M Vivanco
Journal:  Annu Rev Plant Biol       Date:  2006       Impact factor: 26.379

3.  Toward an ecological classification of soil bacteria.

Authors:  Noah Fierer; Mark A Bradford; Robert B Jackson
Journal:  Ecology       Date:  2007-06       Impact factor: 5.499

4.  Associations between species and groups of sites: indices and statistical inference.

Authors:  Miquel De Cáceres; Pierre Legendre
Journal:  Ecology       Date:  2009-12       Impact factor: 5.499

5.  Plant diversity increases soil microbial activity and soil carbon storage.

Authors:  Markus Lange; Nico Eisenhauer; Carlos A Sierra; Holger Bessler; Christoph Engels; Robert I Griffiths; Perla G Mellado-Vázquez; Ashish A Malik; Jacques Roy; Stefan Scheu; Sibylle Steinbeiss; Bruce C Thomson; Susan E Trumbore; Gerd Gleixner
Journal:  Nat Commun       Date:  2015-04-07       Impact factor: 14.919

6.  Functional traits explain ecosystem function through opposing mechanisms.

Authors:  Marc W Cadotte
Journal:  Ecol Lett       Date:  2017-06-22       Impact factor: 9.492

7.  Fungal identification biases in microbiome projects.

Authors:  Leho Tedersoo; Björn Lindahl
Journal:  Environ Microbiol Rep       Date:  2016-07-14       Impact factor: 3.541

8.  Differential responses of soil microbial biomass, diversity, and compositions to altitudinal gradients depend on plant and soil characteristics.

Authors:  Chengjie Ren; Wei Zhang; ZeKun Zhong; Xinhui Han; Gaihe Yang; Yongzhong Feng; Guangxin Ren
Journal:  Sci Total Environ       Date:  2017-08-17       Impact factor: 7.963

9.  Plant attributes explain the distribution of soil microbial communities in two contrasting regions of the globe.

Authors:  Manuel Delgado-Baquerizo; Ellen L Fry; David J Eldridge; Franciska T de Vries; Peter Manning; Kelly Hamonts; Jens Kattge; Gerhard Boenisch; Brajesh K Singh; Richard D Bardgett
Journal:  New Phytol       Date:  2018-04-19       Impact factor: 10.151

10.  Maize rhizosphere in Sichuan, China, hosts plant growth promoting Burkholderia cepacia with phosphate solubilizing and antifungal abilities.

Authors:  Ke Zhao; Petri Penttinen; Xiaoping Zhang; Xiaoling Ao; Maoke Liu; Xiumei Yu; Qiang Chen
Journal:  Microbiol Res       Date:  2013-08-06       Impact factor: 5.415

View more
  5 in total

1.  Rapid transgenerational adaptation in response to intercropping reduces competition.

Authors:  Laura Stefan; Nadine Engbersen; Christian Schöb
Journal:  Elife       Date:  2022-09-13       Impact factor: 8.713

2.  Mycorrhizosphere Bacteria, Rahnella sp. HPDA25, Promotes the Growth of Armillaria gallica and Its Parasitic Host Gastrodia elata.

Authors:  Tianrui Liu; Zhongyi Hua; Pengjie Han; Yuyang Zhao; Junhui Zhou; Yan Jin; Xiaolin Li; Luqi Huang; Yuan Yuan
Journal:  Front Microbiol       Date:  2022-03-17       Impact factor: 5.640

3.  Harnessing the Potential of Wheat-Pea Species Mixtures: Evaluation of Multifunctional Performance and Wheat Diversity.

Authors:  Johannes Timaeus; Odette Denise Weedon; Maria Renate Finckh
Journal:  Front Plant Sci       Date:  2022-03-25       Impact factor: 5.753

4.  Maize and peanut intercropping improves the nitrogen accumulation and yield per plant of maize by promoting the secretion of flavonoids and abundance of Bradyrhizobium in rhizosphere.

Authors:  Qiqi Dong; Xinhua Zhao; Dongying Zhou; Zhenhua Liu; Xiaolong Shi; Yang Yuan; Peiyan Jia; Yingyan Liu; Penghao Song; Xiaoguang Wang; Chunji Jiang; Xibo Liu; He Zhang; Chao Zhong; Feng Guo; Shubo Wan; Haiqiu Yu; Zheng Zhang
Journal:  Front Plant Sci       Date:  2022-08-04       Impact factor: 6.627

5.  Temporal and regional shifts of crop species diversity in rainfed and irrigated cropland in Iran.

Authors:  Leila Jafari; Sara Asadi; Ashkan Asgari
Journal:  PLoS One       Date:  2022-03-11       Impact factor: 3.240

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.