Literature DB >> 33898106

MTTL3 upregulates microRNA-1246 to promote occurrence and progression of NSCLC via targeting paternally expressed gene 3.

Shaohong Huang1, Shaoning Luo2, Chulian Gong3, Limin Liang1, Yi Xiao1, Mingan Li4, Jinyuan He1.   

Abstract

Non-small cell lung cancer (NSCLC) is one of the major causes of morbidity and mortality worldwide. We aimed to investigate the role of N6-methyladenosine (m6A) methyltransferase-like 3 (METTL3) regulating microRNA-1246 (miR-1246) in the progression of NSCLC by targeting paternally expressed gene 3 (PEG3). METTL3, miR-1246, and PEG3 expression in tissues was assessed, and the predictive role of METTL3 in prognosis of patients with NSCLC was detected. NSCLC cells were relatively treated with altered expression of METTL3, miR-1246, or PEG3 to measure their roles in the proliferation, migration, invasion, apoptosis, and in vivo growth of the NSCLC cells. The RNA m6A level was determined, and the targeting relationship between miR-1246 and PEG3 was confirmed. Our results revealed that METTL3 and miR-1246 were upregulated, whereas PEG3 was downregulated in NSCLC tissues. METTL3 knockdown or PEG3 overexpression in NSCLC cells suppressed malignant behaviors of NSCLC cells. METTL3 affected the m6A modification of miR-1246, thus upregulating miR-1246 and miR-1246-targeted PEG3. The elevation of PEG3 reversed the effects of miR-1246 upregulation on NSCLC cells. This study revealed that m6A methyltransferase METTL3 affects the m6A modification of miR-1246, thus upregulating miR-1246 to promote NSCLC progression by inhibiting PEG3.
© 2021.

Entities:  

Keywords:  m6A methyltransferase-like 3; m6A modification; microRNA-1246; non-small cell lung cancer; paternally expressed gene 3; tumorigenesis

Year:  2021        PMID: 33898106      PMCID: PMC8059086          DOI: 10.1016/j.omtn.2021.02.020

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   10.183


Introduction

Lung cancer, the most common malignancy in both men and women, is the main reason for cancer-associated deaths throughout the world. Lung cancer can be classified into small cell lung cancer and non-small cell lung cancer (NSCLC) based on pathology, and NSCLC accounts for 80% of all cases of lung cancer. NSCLC is a result of epigenetic, genetic, and molecular alterations and additional morphological changes that give rise to neoplastic tissue. Patients with NSCLC are often diagnosed at advanced stages of the disease, and the 5-year survival of NSCLC patients differs by pathological stages (stage I: 54%–73%; stage II: 38%–48%; stage III: 1%–25%). In the clinic, therapeutic strategies for NSCLC range from surgical resection, radiotherapy, and chemotherapy to novel targeted therapy. Nevertheless, the impact of various treatments is limited. Thus, it is urgent to explore novel targets for NSCLC treatment. N6-methyladenosine (m6A) is one of the most abundant internal modifications in eukaryotic messenger RNA that play an essential role in regulating gene expression, including splicing, translation, and stability. m6A modification is a reversible and dynamic process, which is catalyzed by RNA methyltransferase complex, such as methyltransferase-like 3 (METTL3) and 4. As previously reported, m6A mRNA methylation mediated by METTL3 induces drug resistance and metastasis in NSCLC, and it has been identified that METTL3 is a therapeutic target in NSCLC. MicroRNAs (miRNAs) are a group of single-stranded, non-coding small RNAs that are broadly present in eukaryotic cells and are highly conserved during evolution with the length of 19–24 nt. Some miRNAs are shown to participate in NSCLC. For instance, miR-484 has been demonstrated to promote NSCLC development, and a study has revealed that miR-425-5p elevation is related to the poor prognosis and tumor progression in NSCLC. miR-1246 is one of the miRNAs that is regulated by transcription factor p53, which responds to DNA damage. It has been validated that miR-1246 has also been elucidated to be a critical driver for tumor initiation and cancer progression in NSCLC. Moreover, a publication has revealed that overexpressed METTL3 promotes metastasis of colorectal cancer via regulating miR-1246, while the regulatory relationship between METTL3 and miR-1246 in NSCLC remains largely unknown. In addition, paternally expressed gene 3 (PEG3) is an imprinted gene encoding DNA-binding protein. It has been clarified that PEG3 is a primary putative gene involved in the cancer inhibitory activity in lung adenocarcinoma, while its role in NSCLC as well as the targeting relationship between miR-1246 and PEG3 in NSCLC is still scarcely investigated. In this study, we aimed to identify the role of m6A METTL3 mediating miR-1246 in the occurrence and development of NSCLC via the regulation of PEG3, and we speculated that METTL3 may regulate miR-1246 expression to affect NSCLC progression through targeting PEG3.

Results

METTL3 is upregulated and m6A level is increased in NSCLC tissues

METTL3 expression in 86 pairs of tissues was determined, and it was found that METTL3 was upregulated in NSCLC tissues versus the normal lung epithelial tissues (Figure 1A). To explore the role of METTL3 in NSCLC prognosis, patients were divided into the high-expression group (n = 43) and the low-expression group (n = 43). Our results indicated that METTL3 expression was related to lymph node metastasis (LNM), tumor size, and tumor-node-metastasis (TNM) stage, whereas it was not related to age and gender of the patients (Table 1; Figures 1B–1D). Our result also suggested that high METTL3 expression indicated a poor prognosis for NSCLC patients (Figure 1E).
Figure 1

METTL3 is upregulated and m6A level is increased in NSCLC tissues

(A) METTL3 expression in tumor and normal tissues determined using qRT-PCR. (B) Correlation between METTL3 expression and clinical stage of NSCLC patients. (C) Correlation between METTL3 expression and LNM of NSCLC patients. (D) Correlation between METTL3 expression and tumor size of NSCLC patients. (E) prognosis of NSCLC patients with high or low METTL3 expression. (F) m6A modification level in normal, tumor, and paratumor tissues determined using m6A quantified detection. The measurement data are expressed as mean ± standard deviation. Unpaired t test was performed for comparisons between two groups, one-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

Table 1

Correlation between METTL3 expression and clinicopathological characteristics of NSCLC patients

Clinicopathological characteristicsnMETTL3 expression
p
High (n = 43)Low (n = 43)
Gender

Male4423210.6661
Female422022

Age (years)

<603718190.8276
≥60492524

TNM stage

I–II3913260.0049
III–IV473017

LNM

No4013270.0025
Yes463016

Tumor diameter (cm)

<53712250.0015
≥5493118

NSCLC, non-small cell lung cancer; METTL3, methyltransferase-like 3; TNM, tumor-node-metastasis; LNM, lymph node metastasis.

METTL3 is upregulated and m6A level is increased in NSCLC tissues (A) METTL3 expression in tumor and normal tissues determined using qRT-PCR. (B) Correlation between METTL3 expression and clinical stage of NSCLC patients. (C) Correlation between METTL3 expression and LNM of NSCLC patients. (D) Correlation between METTL3 expression and tumor size of NSCLC patients. (E) prognosis of NSCLC patients with high or low METTL3 expression. (F) m6A modification level in normal, tumor, and paratumor tissues determined using m6A quantified detection. The measurement data are expressed as mean ± standard deviation. Unpaired t test was performed for comparisons between two groups, one-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. Correlation between METTL3 expression and clinicopathological characteristics of NSCLC patients NSCLC, non-small cell lung cancer; METTL3, methyltransferase-like 3; TNM, tumor-node-metastasis; LNM, lymph node metastasis. To explore the m6A modification in NSCLC, the m6A level in clinical NSCLC samples was determined, and it was revealed that, versus the normal tissues, m6A level was increased in both NSCLC tissues and paratumor tissues (Figure 1F). These data reflected that m6A level was increased in human NSCLC tissues.

METTL3 knockdown inhibits NSCLC cell growth

METTL3 expression in cells was determined, and it was found that METTL3 was upregulated in NSCLC cell lines, among which A549 and H1299 cell lines had higher METTL3 expression (Figure 2A); thus, the two cell lines were selected for subsequent experiments. Screened cells were transfected with short hairpin RNA (sh)-METTL3 or sh-negative control (NC), and we found through quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) that METTL3 expression was decreased by sh-METTL3 (Figure 2B). Results of Cell Counting Kit-8 (CCK-8) assay, colony-formation assay, flow cytometry, scratch test, and Transwell assay showed that inhibiting METTL3 promoted apoptosis and inhibited viability, colony-formation ability, migration, and invasion of the NSCLC cells (Figures 2C–2G). We also discovered in the in vivo assay that METTL3 silencing repressed the volume and weight of the xenografts (Figures 2H and 2I).
Figure 2

METTL3 knockdown inhibits NSCLC cell growth

(A) METTL3 expression in NSCLC cell lines and human normal lung epithelial cells Beas-2B detected using qRT-PCR. (B) METTL3 expression in A549 and H1299 cells detected using qRT-PCR. (C) Viability of A549 and H1299 cells after METTL3 knockdown measured by CCK-8 assay. (D) Colony-formation ability of A549 and H1299 cells after METTL3 knockdown measured by colony-formation assay. (E) Apoptosis of A549 and H1299 cells after METTL3 knockdown assessed using flow cytometry. (F) Migration ability of A549 and H1299 cells after METTL3 knockdown assessed using scratch test (200×). (G) Invasion ability of A549 and H1299 cells after METTL3 knockdown assessed using Transwell assay. (H) Volume of xenografts from nude mice after METTL3 knockdown. (I) Weight of xenografts from nude mice after METTL3 knockdown. ∗p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

METTL3 knockdown inhibits NSCLC cell growth (A) METTL3 expression in NSCLC cell lines and human normal lung epithelial cells Beas-2B detected using qRT-PCR. (B) METTL3 expression in A549 and H1299 cells detected using qRT-PCR. (C) Viability of A549 and H1299 cells after METTL3 knockdown measured by CCK-8 assay. (D) Colony-formation ability of A549 and H1299 cells after METTL3 knockdown measured by colony-formation assay. (E) Apoptosis of A549 and H1299 cells after METTL3 knockdown assessed using flow cytometry. (F) Migration ability of A549 and H1299 cells after METTL3 knockdown assessed using scratch test (200×). (G) Invasion ability of A549 and H1299 cells after METTL3 knockdown assessed using Transwell assay. (H) Volume of xenografts from nude mice after METTL3 knockdown. (I) Weight of xenografts from nude mice after METTL3 knockdown. ∗p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. These findings suggested the inhibitive role of METTL3 knockdown in NSCLC cell growth in vitro and in vivo.

METTL3 upregulates miR-1246 and increases m6A level

miR-1246 expression in tumor and normal tissues was assessed, and it was observed that the tumor tissues had higher miR-1246 expression (Figure 3A). Thus, we speculated that there may exist a positive relationship between MELTTL3 and miR-1246, and this speculation was confirmed through the Pearson test (p < 0.005, r = 0.71; Figure 3B).
Figure 3

METTL3 upregulates miR-1246 and increases m6A level

(A) miR-1246 expression in tumor and normal tissues determined using qRT-PCR. (B) Correlation between expression of METTL3 and miR-1246 analyzed using Pearson test. (C) miR-1246 expression in A549 and H1299 cells detected using qRT-PCR. (D) pri-miR-1246 expression in A549 and H1299 cells detected using qRT-PCR. (E) Modification level of m6A of pri-miR-1246 was analyzed by MeRIP assay. N = 3; ∗p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. Unpaired t test was performed for comparisons between two groups, one-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

METTL3 upregulates miR-1246 and increases m6A level (A) miR-1246 expression in tumor and normal tissues determined using qRT-PCR. (B) Correlation between expression of METTL3 and miR-1246 analyzed using Pearson test. (C) miR-1246 expression in A549 and H1299 cells detected using qRT-PCR. (D) pri-miR-1246 expression in A549 and H1299 cells detected using qRT-PCR. (E) Modification level of m6A of pri-miR-1246 was analyzed by MeRIP assay. N = 3; ∗p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. Unpaired t test was performed for comparisons between two groups, one-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. METTL3 was knocked down in cells to verify whether it could regulate the maturation of miR-1246, and it was found in qRT-PCR that METTL3 inhibition downregulated miR-1246, while it further upregulated primary (pri)-miR-1246 (Figures 3C and 3D), indicating that METTL3 promoted the transition of pri-miR-1246 to mature miR-1246. Then, we detected the m6A modification of pri-miR-1246 using methylated RNA immunoprecipitation (MeRIP), and it showed that sh-METTL3 repressed the m6A modification in the pri-miR-1246 sequence (Figure 3E). The above results revealed that METTL3 can promote the formation of mature miR-1246 through the m6A modification of pri-miR-1246.

Elevated miR-1246 promotes NSCLC cell growth

A549 and H1299 cells were transfected with miR-1246-mimic or NC-mimic plasmid to verify the role of miR-1246 elevation on NSCLC cells. Results of qRT-PCR reflected that miR-1246 expression was successfully increased in NSCLC cells by transfection of miR-1246-mimic (Figure 4A). Outcomes of our experiments indicated that miR-1246 elevation reduced apoptosis and facilitated malignant behaviors of NSCLC cells, as well as in vivo tumorigenesis, while these effects were abolished by PEG3 upregulation (Figures 4B–4D and 5A–5D), suggesting a promotive role of miR-1246 upregulation in NSCLC cell growth with the involvement of PEG3.
Figure 4

Elevated miR-1246 promotes NSCLC cell growth

(A) miR-1246 expression in tumor and normal tissues determined using qRT-PCR. (B) Viability of A549 and H1299 cells after miR-1246 upregulation measured by CCK-8 assay. (C) Colony-formation ability of A549 and H1299 cells after miR-1246 upregulation measured by colony-formation assay. (D) Apoptosis of A549 and H1299 cells after miR-1246 upregulation assessed using flow cytometry. ∗p < 0.05 versus the NC-mimic group, #p < 0.05 versus the miR-1246-mimic group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

Figure 5

Elevated miR-1246 promotes NSCLC cell growth

(A) Migration ability of A549 and H1299 cells after miR-1246 upregulation assessed using scratch test (200×). (B) Invasion ability of A549 and H1299 cells after miR-1246 upregulation assessed using Transwell assay. (C) Volume of xenografts from nude mice after miR-1246 upregulation. (D) Weight of xenografts from nude mice after miR-1246 upregulation. ∗p < 0.05 versus the NC-mimic group, #p < 0.05 versus the miR-1246-mimic group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

Elevated miR-1246 promotes NSCLC cell growth (A) miR-1246 expression in tumor and normal tissues determined using qRT-PCR. (B) Viability of A549 and H1299 cells after miR-1246 upregulation measured by CCK-8 assay. (C) Colony-formation ability of A549 and H1299 cells after miR-1246 upregulation measured by colony-formation assay. (D) Apoptosis of A549 and H1299 cells after miR-1246 upregulation assessed using flow cytometry. ∗p < 0.05 versus the NC-mimic group, #p < 0.05 versus the miR-1246-mimic group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. Elevated miR-1246 promotes NSCLC cell growth (A) Migration ability of A549 and H1299 cells after miR-1246 upregulation assessed using scratch test (200×). (B) Invasion ability of A549 and H1299 cells after miR-1246 upregulation assessed using Transwell assay. (C) Volume of xenografts from nude mice after miR-1246 upregulation. (D) Weight of xenografts from nude mice after miR-1246 upregulation. ∗p < 0.05 versus the NC-mimic group, #p < 0.05 versus the miR-1246-mimic group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

miR-1246 targets PEG3

It was predicted by TargetScan that there existed binding sites between miR-1246 and PEG3, and the targeting relationship was confirmed using dual luciferase reporter gene assay and RIP assay (Figures 6A–6C). Results of qRT-PCR and western blot analysis implied that miR-1246 elevation downregulated PEG3 (Figures 6D and 6E), and PEG3 was downregulated in tumor tissues versus normal tissues (Figure 6F). Pearson test was conducted, and it was revealed that expression of miR-1246 and PEG3 was in a negative relationship (p < 0.005, r = −0.65; Figure 6G). These data revealed that miR-1246 can target and negatively regulate PEG3. qRT-PCR was used to detect the expression of PEG3 in A549 cells and H1299 cells after interference with METTL3. The results showed that the expression of PEG3 was increased after knockdown of METTL3 (Figure 6H), which further indicated that METTL3 affected PEG3 expression by regulating the expression of miR-1246.
Figure 6

miR-1246 targets PEG3

(A) Binding sites between miR-1246 and PEG3 predicted at TargetScan. (B) Targeting relationship between miR-1246 and PEG3 confirmed using dual luciferase reporter gene assay. (C) Binding of miR-1246 and PEG3 in A549 and H1299 cells verified using RIP assay. (D) PEG3 expression in A549 and H1299 cells determined using qRT-PCR. (E) Protein expression of PEG3 in A549 and H1299 cells determined using western blot analysis. (F) PEG3 expression in tumor and normal tissues determined using qRT-PCR. (G) Correlation between expression of miR-1246 and PEG3 analyzed using Pearson test. (H) PEG3 expression in A549 and H1299 cells after METTL3 knockdown determined using qRT-PCR. ∗p < 0.05 versus the NC-mimic group, &p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. The unpaired t test was performed for comparisons between two groups.

miR-1246 targets PEG3 (A) Binding sites between miR-1246 and PEG3 predicted at TargetScan. (B) Targeting relationship between miR-1246 and PEG3 confirmed using dual luciferase reporter gene assay. (C) Binding of miR-1246 and PEG3 in A549 and H1299 cells verified using RIP assay. (D) PEG3 expression in A549 and H1299 cells determined using qRT-PCR. (E) Protein expression of PEG3 in A549 and H1299 cells determined using western blot analysis. (F) PEG3 expression in tumor and normal tissues determined using qRT-PCR. (G) Correlation between expression of miR-1246 and PEG3 analyzed using Pearson test. (H) PEG3 expression in A549 and H1299 cells after METTL3 knockdown determined using qRT-PCR. ∗p < 0.05 versus the NC-mimic group, &p < 0.05 versus the sh-NC group. The measurement data are expressed as mean ± standard deviation. The unpaired t test was performed for comparisons between two groups.

PEG3 participates in the occurrence and development of NSCLC

A549 and H1299 cells were treated with overexpressed (oe)-PEG3 plasmid to figure out its role in NSCLC cells. PEG3 expression was determined, and we found that oe-PEG3 upregulated PEG3 (Figures 7A and 7B). Outcomes of gain- and loss-of-function assays reflected that PEG3 overexpression promoted apoptosis and restrained malignant episodes of NSCLC cells as well as tumor growth (Figures 7C–7E and 8A–8D). Based on the above results, we can infer that PEG3 participated in the occurrence and progression of NSCLC.
Figure 7

PEG3 participates in the occurrence and development of NSCLC

(A and B) PEG3 expression in A549 and H1299 cells determined using qRT-PCR and western blot analysis. (C) Viability of A549 and H1299 cells measured by CCK-8 assay. (D) Colony-formation ability of A549 and H1299 cells measured by colony-formation assay. (E) Apoptosis of A549 and H1299 cells assessed using flow cytometry. ∗p < 0.05 versus the oe-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

Figure 8

PEG3 participates in the occurrence and development of NSCLC

(A) Migration ability of A549 and H1299 cells assessed using scratch test (200×). (B) Invasion ability of A549 and H1299 cells assessed using Transwell assay. (C) Volume of xenografts from nude mice. (D) Weight of xenografts from nude mice. ∗p < 0.05 versus the oe-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

PEG3 participates in the occurrence and development of NSCLC (A and B) PEG3 expression in A549 and H1299 cells determined using qRT-PCR and western blot analysis. (C) Viability of A549 and H1299 cells measured by CCK-8 assay. (D) Colony-formation ability of A549 and H1299 cells measured by colony-formation assay. (E) Apoptosis of A549 and H1299 cells assessed using flow cytometry. ∗p < 0.05 versus the oe-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. PEG3 participates in the occurrence and development of NSCLC (A) Migration ability of A549 and H1299 cells assessed using scratch test (200×). (B) Invasion ability of A549 and H1299 cells assessed using Transwell assay. (C) Volume of xenografts from nude mice. (D) Weight of xenografts from nude mice. ∗p < 0.05 versus the oe-NC group. The measurement data are expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA.

Discussion

Worldwide, NSCLC is one of the most prevalent malignancies of the respiratory system and is currently known as one of the leading causes of cancer-related deaths. In the present study, we aimed to explore the role of m6A METTL3 mediating miR-1246 in the occurrence and development of NSCLC with the involvement of PEG3, and we found that the knockdown of METTL3 can downregulate miR-1246 to repress the proliferation, migration, and invasion and promote apoptosis of NSCLC cells, as well as suppress NSCLC tumorigenesis in vivo through the upregulation of PEG3. First, we assessed METTL3 expression in tissues and cells, and it was found that METTL3 was upregulated in both NSCLC tissues and cell lines, respectively, versus human normal lung epithelial tissues and cells. Similarly, Jin et al. have verified that METTL3 expression was higher in human NSCLC tissues and cell lines, and it has also been validated that METTL3 was upregulated in NSCLC tissues in comparison to that in adjacent tissues. Moreover, the predictive role of METTL3 in the prognosis of NSCLC patients was determined, and we found that higher METTL3 indicated a poorer prognosis, and high METTL3 expression was related to the LNM, tumor size, and TNM stage of the NSCLC patients. Consistently, it has been recently reported that METTL3 expression was related to TNM stage in patients with nasopharyngeal carcinoma, as well as tumor size in patients with esophageal carcinoma. Liu et al. have clarified that high METTL3 expression was associated with poor prognosis of patients with oral squamous cell carcinoma. In view of the aberrant expression of METTL3 in NSCLC, we knocked it down to observe its role in NSCLC cell growth in vitro and in vivo. The results of our experiments showed that the reduction of METTL3 promoted apoptosis and inhibited viability, colony-formation ability, migration, and invasion of the NSCLC cells and also decelerated the in vivo tumorigenesis. In accordance with this finding, Wei et al. have identified that the inhibition of METTL3 facilitated apoptosis and repressed migration, survival, and proliferation of lung cancer cells, and it has been elucidated that METTL3 promoted growth, survival, and invasion of human lung adenocarcinoma cells. Additionally, the inhibitive role of depleted METTL3 in tumor growth in prostate cancer has been figured out as well. Furthermore, we found that METTL3 can promote the formation of mature miR-1246 through the m6A modification of pri-miR-1246, thus facilitating the transition of pri-miR-1246 to mature miR-1246. Consistently, Peng et al. have found that METTL3 could methylate pri-miR-1246, which further promoted the maturation of pri-miR-1246, thus regulating the metastasis of colorectal cancer. We also detected miR-1246 expression, and it was revealed that miR-1246 expression was increased in NSCLC tissues and cells. Consistent with this outcome, a publication has indicated that miR-1246 showed upregulation in NSCLC tissues. The NSCLC cells were transfected with miR-1246 mimic to explore its effect on NSCLC cell growth, and we found that the upregulation of miR-1246 promoted the malignant behaviors of NSCLC cells and accelerated the in vivo tumorigenesis. Similar to these findings, it has been previously demonstrated that extracellular miR-1246 promoted lung cancer cell proliferation and radioresistance, and Kim et al. have observed that anti-miR-1246 suppressed malignant behaviors of NSCLC cells. In addition, we confirmed that PEG3 served as a target gene of miR-1246 and presented a decreased expression level in NSCLC. Although this targeting relationship and the abnormal expression of PEG3 in NSCLC remain scarcely investigated, it has been confirmed that PEG3 was downregulated in lung adenocarcinoma. PEG3 was overexpressed as well to detect the biological functions of NSCLC cells, and it was found that PEG3 overexpression inhibited NSCLC cell growth. Consistently, Yang et al. have discovered that the restoration of PEG3 suppressed glioma cell growth. In conclusion, we found that METTL3 regulates the m6A modification to promote the maturation of miR-1246, which targets PEG3 to participate in occurrence and development of NSCLC (Figure 9). This study may further the understanding on the molecular mechanisms of NSCLC, while more efforts are needed for future research.
Figure 9

METTL3 affects the m6A modification of miR-1246, which targets PEG3 to participate in occurrence and development of NSCLC

METTL3 affects the m6A modification of miR-1246, which targets PEG3 to participate in occurrence and development of NSCLC

Materials and methods

Ethics statement

Written informed consents were acquired from all patients before this study. The protocol of this study was confirmed by the Ethic Committee of The Third Affiliated Hospital of Sun Yat-sen University. Animal experiments were strictly conducted in accordance with the Guide to the Management and Use of Laboratory Animals issued by the National Institutes of Health. The protocol of animal experiments was approved by the Institutional Animal Care and Use Committee of The Third Affiliated Hospital of Sun Yat-sen University.

Study subjects

Eighty-six cases of tumor tissues, paratumor tissues, and human normal lung epithelial tissues (>3 cm from the tumor) were harvested from NSCLC patients accepted for treatment in The Third Affiliated Hospital of Sun Yat-sen University between January 2014 and February 2016. The follow-up visit was performed until 2019.

Cell culture

NSCLC cell lines (A549, H1299, H520, and H1975) and human normal lung epithelial cells Beas-2B were acquired from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.

Cell transfection and grouping

A549 and H1299 cells were respectively transfected with sh-METTL3, miR-1246-mimic, oe-PEG3, or the NCs using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). The plasmids and oligonucleotides were purchased from Shanghai Sangon Biotechnology (Shanghai, China).

qRT-PCR

Total RNA was extracted from tissues and cells using Trizol kits (Invitrogen) according to the manufacturer’s information, and the concentration and purity of the extracted RNA were determined using a nanodrop2000 ultraviolet spectrophotometer (1011U, NanoDrop, Waltham, MA, USA). The RNA was reversely transcribed into cDNA using TaqMan MicroRNA Assays Reverse Transcription primer (4427975, Applied Biosystems, Foster City, CA, USA)/PrimeScript RT reagent Kit (RR047A, Takara, Shiga, Japan). The PCR was performed using the ABI7500 qPCR instrument (7500, Thermo Fisher, Rochester, NY, USA) with U6 and β-actin as the loading controls of miRNA and mRNA. Data were analyzed using 2−ΔΔCt method, and the primers are shown in Table 2.
Table 2

Primer sequence

GeneSequence (5′–3′)
METTL3F: AGGCAGCTCATCTGTGTCCT
R: GCTTGGCGTGTGGTCTTT
miR-1246F: TGAAGTAGGACTGGGCAGAGA
R: TTTGGGTCAGGTGTCCACTC
PEG3F: CCTACCCAAGCACCAGTCG
R: GGAACTGCGTGACACATCCT
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
β-actinF: ACTGGAACGGTGAAGGTGAC
R: AGAGAAGTGGGGTGGCTTTT

F, forward; R, reverse; miR-1246, microRNA-1246; PEG3, paternally expressed gene 3; METTL3, methyltransferase-like 3.

Primer sequence F, forward; R, reverse; miR-1246, microRNA-1246; PEG3, paternally expressed gene 3; METTL3, methyltransferase-like 3.

Western blot analysis

Total protein was extracted from tissues and cells using radio-immunoprecipitation assay lysis buffer containing phenylmethylsulfonyl fluoride (P0013C, Beyotime Institute of Biotechnology, Shanghai, China). The extracted proteins were incubated on ice for 30 min and centrifuged at 4°C and 8,000 × g for 10 min. The supernatant was collected, and the total protein concentration was determined using the bicinchoninic acid reagent. Protein sample (50 μg) was dissolved in 2× sodium dodecyl sulfate (SDS) loading buffer and boiled at 100°C for 5 min, and then was conducted with SDS-polyacrylamide gel electrophoresis. Then, proteins were transferred onto polyvinylidene fluoride membranes, blocked with 5% skim milk powder for 1 h, incubated with primary antibodies PEG3 (1:3,000, Abcam, Cambridge, MA, USA) and β-actin (1:1,000, Cell Signaling Technology, Danvers, MA, USA) at 4°C overnight, and then incubated with horseradish peroxidase-conjugated secondary antibody (1:1,000, Cell Signaling Technology) for 1 h. Next, the enhanced chemiluminescent fluorescence detection kits (BB-3501, Ameshame, UK) were used to detect the signaling, and the Image Lab software (National Institutes of Health, Bethesda, MD, USA) was employed for analysis.

Quantified detection of RNA m6A

Total RNA was extracted as above, and the RNA m6A level in total RNA was detected using m6A RNA methylation quantified detection kits (ab185912, Abcam). RNA was used to coat the detection wells at 37°C for 90 min and respectively added with capture antibody to determine the antibody and enhancer solution. Then, the RNA was developed, and the absorbance at 450 nm was detected. The m6A level was conducted with calorimetric quantification, and the data were calculated based on the standard curve.

MeRIP assay

Total RNA was extracted from cells using Trizol, and the mRNA in total RNA was isolated and purified using PolyATtract mRNA Isolation Systems (A-Z5300, A&D Technology, Beijing, China). The immunoprecipitation (IP) buffer (20 mM Tris [pH 7.5], 140 mM NaCl, 1% Nonidet P 40, 2 mM ethylene diamine tetraacetic acid) was added with 3 μg antibody m6A (1:500, ab151230, Abcam) or immunoglobulin G (IgG, ab109489, 1:100, Abcam) and incubated with protein A/G magnetic beads for 1 h. The IP buffer containing ribonuclease inhibitor and proteinase inhibitor was added with purified mRNA and magnetic bead-antibody complex at 4°C overnight. The RNA was eluted using elution buffer, purified using phenol-chloroform, and analyzed using qRT-PCR. The experiment was independently repeated 3 times.,

CCK-8 assay

The CCK-8 assay was conducted using CCK-8 kits (Enogene Biotechnology, Nanjing, China) as previously described. The trypsinized cells were seeded in 96-well plates at 1,000 cells/well, and to each well 10 μL CCK-8 reagent was added at 0, 24, 48, and 72 h of culture. After 4-h incubation, the medium was discarded, and the optical density at 450 nm was analyzed using a microplate reader (Alpha Innotech, San Jose, CA, USA).

Colony-formation assay

Cells were seeded onto 12-well plates at 0.5 × 103 cells/well, cultured for 2 weeks, fixed with 4% paraformaldehyde, and stained with 0.04% crystal violet dye solution. A microscope (Olympus Optical, Tokyo, Japan) was used for photographing and counting of the colonies.

Flow cytometry

The flow cytometry was conducted as previously described; cells that had been transfected for 48 h were trypsinized, centrifuged, resuspended, and fixed in 70% ethanol at 4°C overnight. Then, cells were incubated with 10 mg/mL RNase A for 30 min and 10 g/mL propidium iodide at 4°C in the dark for 30 min. Then, the analysis was performed using the BD FACSCanto II (BD Biosciences, Franklin Lakes, NJ, USA) within 24 h.

Scratch test

Transfected cells were seeded at 5 × 105 cells/mL and cultured for 24 h with the medium discarded. A 10 μL sterile dispette was used to make the scratches, and the cells were continuously cultured in DMEM containing 10% FBS. Cells were observed and photographed at 0 and 36 h of culture, and the migration rate was measured based on the wound healing of cells in each group.

Transwell assay

This assay was performed based on the description by Liu et al. In brief, each Transwell apical chamber was added with 50 μL diluted Matrigel (YB356234, Yubo Biological Technology, Shanghai, China) and incubated for 2–3 h. The cells were trypsinized, counted, and made into suspension using serum-free medium. The 200 μL cell suspension was added into the apical chambers (1 × 105 cells/well), and 800 μL FBS conditioned medium containing 20% FBS was added into the basolateral chambers (apoptosis inhibitor treatment: 50 μm Z-VAD-FMK [Selleck, #S7023]; dimethyl sulfoxide [24-h treatment] was taken as the NC group). Incubated for 24 h, the chambers were rinsed with 4% paraformaldehyde (Sigma-Aldrich, Carlsbad, CA, USA; Merck, Darmstadt, Germany) for 10 min and stained with 0.1 crystal violet dye solution (Sigma; Merck). The non-invasive cells were removed and an inverted optical microscope (TE 2000-S, Nikon Corporation, Tokyo, Japan) was used to capture the images of invasive cells. Four random optical fields were selected for cell counting, and the experiment was independently repeated 3 times.

Dual luciferase reporter gene assay

Binding sites between miR-1246 and PEG3 were predicted at Jefferson. PEG3-wild-type (WT) and PEG3 mutant type (Mut) plasmids were constructed, which were then co-transfected into cells with miR-1246-mimic or NC-mimic for 24 h. The luciferase activity was determined using luciferase detection kits (K801-200, Biovision, Milpitas, CA, USA) and dual luciferase reporter gene detection system (Promega, Madison, WI, USA).

RIP assay

According to the description in a previous study, the RIP assay was conducted using Magna RIP RNA kits (Millipore). Cells were lysed using RIP lysis buffer (Beyotime) in an ice bath for 5 min and centrifuged at 14,000 rpm and 4°C for 10 min to collect the supernatant. One part of the cell extraction was taken as the input, and the other part was coprecipitated with antibody. The magnetic beads (50 μL from each system) were rinsed and suspended in 100 μL RIP Wash Buffer and then were added with 5 μg rabbit anti-Ago2 (ab186733, 1:50, Abcam) at 4°C for 6 h. The bead-antibody complex was treated with proteinase K, and the RNA was extracted for subsequent qRT-PCR. Rabbit anti-IgG (ab172730, 1:100, Abcam) was used as NC, and the experiment was independently repeated 3 times.

Subcutaneous tumorigenesis in nude mice

Eighty female BALB/c nude mice (age 4–5 weeks and weighing 15–18 g, obtained from the Experimental Animal Center of Sun Yat-sen University, Guangdong, China) were separated into two large groups (n = 40) and respectively injected with A549 and H1299 cells. The 40 nude mice of each large group were classified into 8 small groups (n = 5) and subcutaneously injected with transfected cell suspension in the back (5 × 106 cells/mL/mouse). The length and width of tumors were recorded every 4 days, and the tumor volume = (length × width2)/2. The tumor growth curve was thereby graphed. On the 28th day of injection, mice were euthanized by neck dislocation, and the xenografts were harvested, photographed, and weighed.

Statistical analysis

All data analyses were conducted using SPSS 22.0 software (IBM, Armonk, NY, USA). The measurement data conforming to the normal distribution were expressed as mean ± standard deviation. The unpaired t test was performed for comparisons between two groups, one-way analysis of variance (ANOVA) was used for comparisons among multiple groups, and Tukey’s post hoc test was used for pairwise comparisons after one-way ANOVA. Correlation between expression of miR-1246 and METTL3 was analyzed using Pearson test. p value <0.05 was indicative of statistically significant difference.
  34 in total

1.  Testing for neurological involvement in HIV infection.

Authors: 
Journal:  Lancet       Date:  1987-12-26       Impact factor: 79.321

2.  Hsa-miR-1246 and hsa-miR-1290 are associated with stemness and invasiveness of non-small cell lung cancer.

Authors:  Gwangil Kim; Hee-Jung An; Mi-Jung Lee; Ji-Ye Song; Ju-Yeon Jeong; Ji-Hyun Lee; Hye-Cheol Jeong
Journal:  Lung Cancer       Date:  2015-11-17       Impact factor: 5.705

3.  HDAC6 inhibition blocks inflammatory signaling and caspase-1 activation in LPS-induced acute lung injury.

Authors:  Li Liu; Xiaoming Zhou; Sreerama Shetty; Gang Hou; Qiuyue Wang; Jian Fu
Journal:  Toxicol Appl Pharmacol       Date:  2019-03-22       Impact factor: 4.219

4.  Overexpression of METTL3 associated with the metabolic status on 18F-FDG PET/CT in patients with Esophageal Carcinoma.

Authors:  Xu-Sheng Liu; Ling-Ling Yuan; Yan Gao; Lu-Meng Zhou; Jian-Wei Yang; Zhi-Jun Pei
Journal:  J Cancer       Date:  2020-06-07       Impact factor: 4.207

5.  m6A mRNA methylation initiated by METTL3 directly promotes YAP translation and increases YAP activity by regulating the MALAT1-miR-1914-3p-YAP axis to induce NSCLC drug resistance and metastasis.

Authors:  Dan Jin; Jiwei Guo; Yan Wu; Jing Du; Lijuan Yang; Xiaohong Wang; Weihua Di; Baoguang Hu; Jiajia An; Lingqun Kong; Lei Pan; Guoming Su
Journal:  J Hematol Oncol       Date:  2019-12-09       Impact factor: 17.388

6.  METTL3 Promotes Tumorigenesis and Metastasis through BMI1 m6A Methylation in Oral Squamous Cell Carcinoma.

Authors:  Lin Liu; Yu Wu; Qiuli Li; Jianfeng Liang; Qianting He; Luodan Zhao; Jianwen Chen; Maosheng Cheng; Zhexun Huang; Hui Ren; Jie Chen; Liang Peng; Fengxin Gao; Demeng Chen; Anxun Wang
Journal:  Mol Ther       Date:  2020-06-24       Impact factor: 11.454

7.  Upregulated lncRNA-UCA1 contributes to progression of hepatocellular carcinoma through inhibition of miR-216b and activation of FGFR1/ERK signaling pathway.

Authors:  Feng Wang; Hou-Qun Ying; Bang-Shun He; Yu-Qin Pan; Qi-Wen Deng; Hui-Ling Sun; Jie Chen; Xian Liu; Shu-Kui Wang
Journal:  Oncotarget       Date:  2015-04-10

8.  The up-regulation of Myb may help mediate EGCG inhibition effect on mouse lung adenocarcinoma.

Authors:  Hong Zhou; Joseph Manthey; Ekaterina Lioutikova; William Yang; Kenji Yoshigoe; Mary Qu Yang; Hong Wang
Journal:  Hum Genomics       Date:  2016-07-25       Impact factor: 4.639

9.  Application values of miR-194 and miR-29 in the diagnosis and prognosis of gastric cancer.

Authors:  Xin Zhao; Yunxia Hou; Zhongzhen Tuo; Fangmeng Wei
Journal:  Exp Ther Med       Date:  2018-03-06       Impact factor: 2.447

10.  M2 bone marrow-derived macrophage-derived exosomes shuffle microRNA-21 to accelerate immune escape of glioma by modulating PEG3.

Authors:  Fan Yang; Tiecheng Wang; Peng Du; Haitao Fan; Xushuai Dong; Hua Guo
Journal:  Cancer Cell Int       Date:  2020-03-27       Impact factor: 5.722

View more
  9 in total

1.  Role of N6-Methyladenosine Methylation Regulators in the Drug Therapy of Digestive System Tumours.

Authors:  Zhelin Xia; Fanhua Kong; Kunpeng Wang; Xin Zhang
Journal:  Front Pharmacol       Date:  2022-06-09       Impact factor: 5.988

2.  METTL3 promotes colorectal carcinoma progression by regulating the m6A-CRB3-Hippo axis.

Authors:  Jiashu Pan; Feng Liu; Xiaoli Xiao; Ruohui Xu; Liang Dai; Mingzhe Zhu; Hanchen Xu; Yangxian Xu; Aiguang Zhao; Wenjun Zhou; Yanqi Dang; Guang Ji
Journal:  J Exp Clin Cancer Res       Date:  2022-01-10

3.  Mechanism of methyltransferase like 3 in epithelial-mesenchymal transition process, invasion, and metastasis in esophageal cancer.

Authors:  Xuyang Liang; Zhimei Zhang; Lu Wang; Shuxian Zhang; Ling Ren; Shouying Li; Jing Xu; Shengxiang Lv
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

4.  METTL3 suppresses neuropathic pain via modulating N6-methyladenosine-dependent primary miR-150 processing.

Authors:  Le Zhang; Xin Zhao; Jing Wang; Yanwu Jin; Moxuan Gong; Yuyang Ye; Peilong Li
Journal:  Cell Death Discov       Date:  2022-02-24

Review 5.  The Emerging Role of N6-Methyladenosine RNA Methylation as Regulators in Cancer Therapy and Drug Resistance.

Authors:  Zhaolin Chen; Ying Hu; Le Jin; Fan Yang; Haiwen Ding; Lei Zhang; Lili Li; Tingting Pan
Journal:  Front Pharmacol       Date:  2022-04-06       Impact factor: 5.988

Review 6.  The Role of m6A RNA Methylation in Cancer: Implication for Nature Products Anti-Cancer Research.

Authors:  Na Song; Kai Cui; Ke Zhang; Jie Yang; Jia Liu; Zhuang Miao; Feiyue Zhao; Hongjing Meng; Lu Chen; Chong Chen; Yushan Li; Minglong Shao; Jinghang Zhang; Haijun Wang
Journal:  Front Pharmacol       Date:  2022-06-16       Impact factor: 5.988

7.  METTL3 dual regulation of the stability of LINC00662 and VEGFA RNAs promotes colorectal cancer angiogenesis.

Authors:  Guoying Zhang; Tianjun Wang; Zihui Huang; Yuanyuan Chen; Li Sun; Xia Xia; Fang He; Chenying Fan; Shukui Wang; Wanli Liu
Journal:  Discov Oncol       Date:  2022-09-17

Review 8.  Multifaceted Roles of the N6-Methyladenosine RNA Methyltransferase METTL3 in Cancer and Immune Microenvironment.

Authors:  Chenxi Hu; Jiacheng Liu; Yue Li; Wei Jiang; Ding Ji; Wei Liu; Teng Ma
Journal:  Biomolecules       Date:  2022-07-28

Review 9.  A Review on the Role of miR-1246 in the Pathoetiology of Different Cancers.

Authors:  Soudeh Ghafouri-Fard; Tayyebeh Khoshbakht; Bashdar Mahmud Hussen; Mohammad Taheri; Mohammad Samadian
Journal:  Front Mol Biosci       Date:  2022-01-03
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.