| Literature DB >> 33864586 |
Abdelkader Biary1, Salma Berrouch1, Oussama Dehhani1, Abdelmalek Maarouf1, Pierre Sasal2, Brahim Mimouni1, Jamaleddine Hafid3.
Abstract
Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.Entities:
Keywords: Anisakis simplex; Atlantique coast; Mackerel; Morocco; Sardine
Year: 2021 PMID: 33864586 DOI: 10.1007/s11033-021-06323-y
Source DB: PubMed Journal: Mol Biol Rep ISSN: 0301-4851 Impact factor: 2.316