Literature DB >> 33816255

Overexpressed Tumor Suppressor Exosomal miR-15a-5p in Cancer Cells Inhibits PD1 Expression in CD8+T Cells and Suppresses the Hepatocellular Carcinoma Progression.

Hong-Yu Zhang1, Hong-Xia Liang1, Shu-Huan Wu1, He-Qing Jiang1, Qin Wang1, Zu-Jiang Yu1.   

Abstract

BACKGROUND: Hepatocellular carcinoma (HCC) is the most common primary liver tumor, and the main reason is the unclear pathogenesis of HCC, which leads to a high fatality rate of HCC. Therefore, it is of great clinical significance to explore the molecular mechanism of HCC and find a targeted therapeutic approach from the molecular level.
MATERIALS AND METHODS: MicroRNA-15a-5p (miR-15a-5p) expression level was measured by bioinformatics and qRT-PCR. Luciferase assay and RIP assays were used to verify the relationship between programmed cell death protein 1 (PD1) PD 1 with miR-15a-5p. Exosomes were identified using TEM, Zetasizer Nano ZS, and western blot. Edu, Transwell, and scratch assay were performed to explore the role of miR-15a-5p or exo-miR-15a-5p on HepG2 cells progression.
RESULTS: MicroRNA-15a-5p (miR-15a-5p) was decreased in HCC tissues and cell lines, which indicated a poor prognosis. Overexpression of miR-15a-5p inhibited viability, proliferation, migration and invasion of HepG2 cells. Then, we isolated exosomes from cancer cells, and found that miR-15a-5p was packaged into exosomes from cancer cells. Furthermore, exo-miR-15a-5p was secreted into CD8+ T cells, then directly inhibited PD1 expression via targeted binding. Then, we co-cultured CD8+ T cells transfected with PD1 with HepG2 transfected with miR-15a-5p, PD1 remitted the inhibitory role of miR-15a-5p on HCC progression.
CONCLUSION: Together, present study revealed exo-miR-15a-5p from cancer cells inhibited PD1 expression in CD8+ T cells, which suppressed the development of HCC.
Copyright © 2021 Zhang, Liang, Wu, Jiang, Wang and Yu.

Entities:  

Keywords:  Hepatocellular carcinoma; PD1; T cells; exosome; miR-15a-5p

Year:  2021        PMID: 33816255      PMCID: PMC8018596          DOI: 10.3389/fonc.2021.622263

Source DB:  PubMed          Journal:  Front Oncol        ISSN: 2234-943X            Impact factor:   6.244


Introduction

Hepatocellular carcinoma (HCC) is the leading cause of cancer-related death worldwide (1). Although researchers have made some progress in prevention, screening, diagnosis and treatment techniques, the morbidity and mortality of HCC continue to rise (2). The 5-year survival rate of HCC patients is less than 20% (3). Therefore, early diagnosis of HCC is particularly important. The current screening methods for HCC, such as ultrasound and serum alpha-fetoprotein (AFP), are less effective because of their low specificity and sensitivity (4). Therefore, many scholars have been trying to find new HCC markers and related molecules to improve the rate of early diagnosis. Exosomes are secreted by stromal cells (fibroblasts, adipocytes, mast cells, etc.) and tumor cells, and they are nano-sized vesicles wrapped by lipid bilayers (5). At present, it has been confirmed that a variety of cells in the body can secrete exosomes, which may contain non-coding RNAs, messenger RNA (mRNA), protein or DNA, and so on (6). In addition, exosomes can act on target cells by direct fusion, binding to surface proteins and endocytosis (7). Exosomes are widely involved in intercellular communication and participate in the processes of tumor angiogenesis, tumor metastasis and radiotherapy resistance (8). Exosomes are rich in bioactive contents based on exosomes as biomarkers and potential therapeutic targets. MiRNA is a non-coding RNA with short molecular chains. Studies have shown that miRNA carried by some exosomes can be used for early diagnosis of HCC. In HCC, Wang et al. studied that exosomal miR-21 in serum of patients group was significantly higher than that of healthy people group, and was related to liver cirrhosis and HCC stages (9), which indicates that exo-miR-21 is a more sensitive diagnostic marker in HCC (9). In addition, studies have shown that miR-429 are rich in exosomes in HCC. Exosomal miR-429 inhibits the expression of RBBP4, enhances the activity of E2F1 transcription and increases the expression of OCT4, which promotes the formation of inflammatory microenvironment and reduces HCC cell differentiation and proliferation (10). It has reported that miR-15a-5p can be packaged into exosomes and secreted into plasm (11, 12). However, the function and mechanism of exosomal miR-15a-5p in HCC is poorly defined. There is a complex bioregulatory network between the immune system and malignant tumors (13). Programmed cell death protein 1 (PD1)-PD1 ligand (PD-L1) is the key immune checkpoint pathway, and cancer cells can use this pathway to escape the immune attack (14). In clinical treatment of some tumors, monoclonal antibody was applied to block this pathway, and the survival time of patients was significantly prolonged (15, 16). Furthermore, PD1 CD8 exhausted T cells is one of the main characteristics of HCC, and is also a key indicator of poor prognosis of HCC patients (17). Thus, exosomal miR-15a-5p functionality, as also the underlying molecular mechanisms in HCC progression, requires further study.

Methods

Clinical Samples

The tumor samples were collected from HCC patients at the First Affiliated Hospital of Zhengzhou University. All the patients or their guardians provided written consent. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Zhengzhou University and met the standard set in the Declaration of Helsinki.

Microarray Analysis

MiRNAs in HCC tissues were profiled using microarray analysis (Bio-tech, Shanghai, China). Differentially expressed miRNAs were identified by Heatmap. Up-regulated or down-regulated miRNAs were selected based on changes ≥ 2 fold threshold and P < 0.05.

Exosome and CD8+ T Cells Isolation and Identification

Cells were isolated from cancer and para-carcinoma tissues of HCC patients as previously described (18). Transmission electron microscopy (TEM) was used to identify exosomes structures. Exosomes size was calculated using Zetasizer Nano ZS. Exosomes were analyzed using exosome marker protein CD63, Alix, and Tsg101 via Western blot. CD8+ T cells purified from serum of healthy donor or HCC patients using Easy-SepTM Direct Human CD8+ T-Cell Isolation Kit (STEMCELL Technologies) as previous described (19).

Cell Culture and Treatment

The cell lines (L-02, Hep3B, SNU-182, and HepG2) were purchased from the Science Cell Laboratory and were cultured in RPMI 1640 supplemented with 10% fetal bovine serum and penicillin and streptomycin (100 μl/ml). CD8+ T cells were activated by anti-CD3/anti-CD28 antibody (BD Biosciences) for 48 h. A 2 μg of PD1 plasmid or 500 nM miR-15a-5p/antisense morpholino oligonucleotide of miR-15a-5p (AMO-15a-5p) or its NC was transfected into cells with Lipo 2000, respectively. And the PD1 plasmid, miR-15a-5p, and AMO-15a-5p were purchased from by Guangzhou RiboBio Co. Ltd. Exosomes (500 µg/ml) were added into the medium of preactivated CD8+ T cells cells every 24 h.

RNA Isolation and qRT-PCR

RNA isolation, reverse transcription, and quantitative expression were carried according to manufacturer’s instructions after 36 h of transfection. All the kits were purchased from Vazyme, and gene expression was calculated using 2-ΔΔCt method. The relative expression level of miR-15a-5p was calculated through normalization to U6 internal controls, and mRNAs were normalized with GAPDPH. Primers list: PD1 (F: 5’-GCAGCTTCTCCAACACATCG-3’, R: 5’- CTCAGCCGTGCCTGTGTTCTCT -3’), GAPDH (F: 5’-AACGGATTTGGTCGTATTG-3 ‘, R: 5’-GGAAGATGGTGATGGGATT-3’), miR-15a-5p (F: 5′‐GACAGGAGGTATGGCGATCCTCTGTGTAGCA‐3′, R: 5′‐TGCTACACAGAGGATCGCCATACCCTCCTGTC‐3′), U6 (F: 5’-CTCGCTTCGGCAGCACA-3’, R: 5’-ACGCTTCACGAATTTTGCGT-3’).

Protein Isolation and Western Blot

Total protein was collected from cells with RIPA lysis Mix after 48 h of transfection. Western blotting assay was performed as previously described. Briefly, 60 μg of protein extractions were loaded via SDS-PAGE, transferred onto nitrocellulose membranes (absin, China), then incubated with primary antibodies for 2 h at room temperature, and then plated at 4°C overnight, and the membranes were incubated in 5% non-fat milk blocking buffer for horizontal mode 3 h. After incubation with secondary antibodies, the membranes were scanned using an Odyssey, and data were analyzed with Odyssey software (LI-COR, USA). Primary antibodies list: CD63 (Abcam, ab217345), Tsg101 (Abcam, ab125011), Alix (Abcam, ab117600), PD1 (ab89828, Abcam), and GAPDH (Proteintech, 60004-1-Ig).

Luciferase Assay

HEK293 cells were co-transfected with 20 mmol/liter miR-15a-5p mimic or NC together with WT-PD1 or Mut-PD1. CD8+ T cells were transfected with WT-PD1 or Mut-PD1 and incubated with exosomes from cells or serum. Luciferase activity was measured with Dual Luciferase Reporter Assay Kit (Transgene, China) on GloMax20/20 at 48 h after the transfection.

CCK8 Assay

HepG2 or SNU-182 cells were seeded in 96-well cell plates and added CCK-8 solution (Vazyme, China) at 24, 48, and 72 h. Two hours later, the OD value at 450 nm was measured.

Wound Healing Assay

5×105 HepG2 or SNU-182 cells were planted in a six-well plate, and when the cells grew to fuse, two vertical parallel lines were drawn with 10-μl suction head against the ruler. The floating cells were washed with PBS and cultured in serum-free medium for 24 h. Images were taken at 0 and 24 h of cell culture, respectively.

Transwell Assay

HepG2 or SNU-182 cells in logarithmic growth phase were adjusted to 2 × 105 cells/well of medium (without serum) and plated into the upper chamber insert pre-coated with Matrigel (1 μg/μl). Lower chamber was added with 500 μl of medium (with 10% FBS) and then incubated the chamber at 37°C for 48 h. Then, the invading cells were visualized by the crystal violet and inverted microscope.

RNA-Binding Protein Immunoprecipitation

We performed RNA-binding protein immunoprecipitation (RIP) assay to determine the binding between PD1 and miR-15a-5p using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore) and AGO2 antibody (66720-1-Ig, Proteintech) as previous study (20). Briefly, CD8+ T cells were transfected with PD1 or IgG, and the mRNA level of miR-15a-5p was detected using qRT-PCR.

Statistical Analysis

All data is presented as a mean ± S.E.M. Statistical analysis was performed using Student’s t-test or Wilcoxon test or a one-way ANOVA through GraphPad 7.0 and SPSS 22.0.

Results

Down-Regulation of miR-15a-5p in HCC Tissues and Cells

Firstly, we used microarray assay to analyze the differentially expressed miRNAs in tumor tissues and adjacent tissues from HCC patients ( ). According to microarray data, a total of six significantly down-regulated microRNAs were differentially expressed in cancer tissues ( ). Among these down-regulated miRNAs, miR-15a-5p was much lower than other miRNAs. Suggesting miR-15a-5p might be involved in the progression of HCC. Then we detected the expression level of miR-15a-5p in 40 paired HCC patients, miR-15a-5p was reduced in cancer tissues ( ). According to the median level of miR-15a-5p in , 40 HCC patients was divided into low (n = 20) and high expression group (n = 20). Kaplan-Meier curves indicated a 5-year survival rate of HCC patients was significantly lower in low expression patients than high expression patients ( ). Besides, we cultured HCC cell lines (Hep3B, SNU-182, and HepG2) and normal human hepatocyte L-02, and found the level of miR-15a-5p was dramatically lower in HCC cell lines than that in normal hepatocyte ( ).
Figure 1

The expression of miR-15a-5p in CRC tissues and cells. (A) MiRNA expression profiles of normal tissues and cancer tissues in HCC. (B) The expression of miR-15a-5p in normal and cancer tissues was detected by qRT-PCR. n = 40. (C) According to the median level of miR-15a-5p in (B), 40 HCC patients was divided into low (n = 20) and high expression group (n = 20). Kaplan-Meier curves indicated 5-year survival rate of HCC patients. (D) qRT-PCR analysis for miR-15a-5p level in normal human hepatocyte L-02 and HCC cell lines (Hep3B, SNU-182, HepG2). Data are mean ± SD; *P < 0.05.

Table 1

Differentially expressed miRNAs in HCC.

DownregulatedLog2(FC)P valueUpregulatedLog2(FC)P value
hsa-miR-15a-5p-7.84<0.05hsa-miR-2175.23<0.05
hsa-miR-211-5p-7.12<0.05hsa-miR-187-5p4.79<0.05
hsa-miR-143-3p-5.61<0.05hsa-miR-328-5p4.43<0.05
hsa-miR-214-5p-5.48<0.05hsa-miR-4214.14<0.05
hsa-miR-125b-5p-5.21<0.05hsa-miR-1973.47<0.05
hsa-miR-214-3p-5.04<0.05hsa-miR-216a-5p3.18<0.05
The expression of miR-15a-5p in CRC tissues and cells. (A) MiRNA expression profiles of normal tissues and cancer tissues in HCC. (B) The expression of miR-15a-5p in normal and cancer tissues was detected by qRT-PCR. n = 40. (C) According to the median level of miR-15a-5p in (B), 40 HCC patients was divided into low (n = 20) and high expression group (n = 20). Kaplan-Meier curves indicated 5-year survival rate of HCC patients. (D) qRT-PCR analysis for miR-15a-5p level in normal human hepatocyte L-02 and HCC cell lines (Hep3B, SNU-182, HepG2). Data are mean ± SD; *P < 0.05. Differentially expressed miRNAs in HCC.

Overexpression of miR-15a-5p Obstructed the Growth of HCC Cells

To further identify the function of miR-15a-5p in HCC progression, we constructed miR-15a-5p mimics to force its expression. As showed in , the transfection of miR-15a-5p significantly promoted miR-15a-5p expression in HepG2 and SNU-182 cells. Then we used CCK8 assay to detect cell viability, and found that miR-15a-5p inhibited HepG2 and SNU-182 cells viability ( ). Edu analysis was performed to detect cell proliferation, miR-15a-5p decreased Edu positive cell numbers ( ). Then, miR-15a-5p alleviated the migratory ability of HepG2 c and SNU-182 cells ( ). Transwell assay showed that miR-15a-5p reduced the invasive ability in HepG2 and SNU-182 cells ( ).
Figure 2

Overexpression of miR-15a-5p inhibited the viability, proliferation, migration and invasion of HepG2 and SNU-182 cells. MiR-15a-5p or miR-NC were transfected into HepG2 and SNU-182 cells. (A) The transfection efficiency of miR-15a-5p was determined by qRT-PCR. (B) CCK8 was to determine viability of HepG2 and SNU-182 cells. (C) Edu assay was to detected proliferation of HepG2 and SNU-182 cells. Scale bar, 100 μm. (D) Wound healing assay was to evaluate migration of HepG2 and SNU-182 cells. Scale bar, 500 μm. (E) Transwell assay was to examine invasion of HepG2 and SNU-182 cells. Scale bar, 100 μm. Data are mean ± SD; *P < 0.05.

Overexpression of miR-15a-5p inhibited the viability, proliferation, migration and invasion of HepG2 and SNU-182 cells. MiR-15a-5p or miR-NC were transfected into HepG2 and SNU-182 cells. (A) The transfection efficiency of miR-15a-5p was determined by qRT-PCR. (B) CCK8 was to determine viability of HepG2 and SNU-182 cells. (C) Edu assay was to detected proliferation of HepG2 and SNU-182 cells. Scale bar, 100 μm. (D) Wound healing assay was to evaluate migration of HepG2 and SNU-182 cells. Scale bar, 500 μm. (E) Transwell assay was to examine invasion of HepG2 and SNU-182 cells. Scale bar, 100 μm. Data are mean ± SD; *P < 0.05.

MiR-15a-5p Was Packaged Into Exosomes Derived From Cancer Cells

To determine the origin of miR-15a-5p in HCC, we isolated exosomes in cancer tissues and adjacent normal tissues. TEM data showed the morphology of exosomes ( ). Zetasizer Nano ZS showed the diameter of exosomes was about 65 nm ( ), and exosomes markers were detected by western blot ( ). Interestingly, miR-15a-5p level increased in cancer exosomes compared with normal exosomes and cancer cells ( ), which indicated that miR-15a-5p was packaged into exosomes and derived from cancer cells in HCC.
Figure 3

Cancer cells secreted exosomal miR-15a-5p in HCC. (A) TEM of exosomes isolated from normal cells and cancer cells. Scale bar, 500 μm. (B) Particle distribution of exosomes analyzed by Zetasizer Nano ZS. (C) The expression of CD63, Alix, and Tsg101 in exosomes was detected by western blot. (D) The expression of miR-15a-5p in exosomes (normal cells and cancer cells) and cancer cells was tested by qRT-PCR. Data are mean ± SD; *P < 0.05; #p < 0.05.

Cancer cells secreted exosomal miR-15a-5p in HCC. (A) TEM of exosomes isolated from normal cells and cancer cells. Scale bar, 500 μm. (B) Particle distribution of exosomes analyzed by Zetasizer Nano ZS. (C) The expression of CD63, Alix, and Tsg101 in exosomes was detected by western blot. (D) The expression of miR-15a-5p in exosomes (normal cells and cancer cells) and cancer cells was tested by qRT-PCR. Data are mean ± SD; *P < 0.05; #p < 0.05.

Exo-miR-15a-5p Was Secreted Into CD8+ T Cells

Given that crosstalk between cancer cells and immune cells could facilitate cancer cells to evade immune attack (21), and the implementation of this crosstalk requires exosomes (22, 23). To clarify the effect of exosomal miR-15a-5p (exo-miR-15a-5p) in the cancer immune escape, we collected various immune cells from HCC tissues, and miR-15a-5p was significantly enriched in the CD8+ T cells ( ). Then we isolated the exosomes from the culture medium of HepG2 and L-02, and treated CD8+ T cells with these exosomes. MiR-15a-5p level in CD8+ T cells significantly induced after incubated with the exosomes from HepG2 cells, while treatment with exosomes from HepG2 cells transfected with AMO-15a-5p inhibited miR-15a-5p expression ( ). Moreover, the exosomes from HCC patient serum promoted miR-15a-5p expression in CD8+ T cells ( ).
Figure 4

Exo-miR-15a-5p was delivered into CD8+ T cells. (A) The expression of miR-15a-5p in the various immune cells derived from HCC tissues. (B) The expression of miR-15a-5p in the CD8+ T cells incubated with exosomes from L-02, HepG2, or HepG2 transfected with AMO-15a-5p. (C) The expression of miR-15a-5p in the CD8+ T cells incubated with exosomes from healthy volunteer serum or HCC patient serum. Data are mean ± SD; *P < 0.05.

Exo-miR-15a-5p was delivered into CD8+ T cells. (A) The expression of miR-15a-5p in the various immune cells derived from HCC tissues. (B) The expression of miR-15a-5p in the CD8+ T cells incubated with exosomes from L-02, HepG2, or HepG2 transfected with AMO-15a-5p. (C) The expression of miR-15a-5p in the CD8+ T cells incubated with exosomes from healthy volunteer serum or HCC patient serum. Data are mean ± SD; *P < 0.05.

MiR-15a-5p Directly Targeted PD1

We use the Targetscan to predicted the target gene of miR-15a-5p (24) and found that there were 7 binding sites between miR-15a-5p in 3’UTR of PD1 ( ). By comparing the binding score, we focused on the position 305-311 of PD1 3’ UTR ( ). And luciferase assay indicated that miR-15a-5p could bind with WT PD1 rather than mutant PD1 ( ). Also, the exosomes collected from HepG2 cells or HCC patients inhibited the WT PD1 activity, while the exosomes from HepG2 transfected with AMO-15a-5p showed the opposite effect ( ). Then, we performed the anti-AGO2 RIP assay and found that miR-15a-5p were pull-down by AGO2 in cells transfected with PD1 compared with NC ( ). Furthermore, PD1 was significantly decreased incubated with the exosomes from HepG2 or HCC patients, but promoted by exosomes from HepG2 transfected with AMO-15a-5p ( ). Moreover, PD1 protein level was increased in HCC tissues than that in normal tissues ( ), and PD1 expression was negatively revalated to miR-15a-5p level in HCC tissues ( ).
Table 2

The predicting binding (conserved sites) between miR-15a-5p and PD1 using Targetscan.

miRNAPosition in the UTRseed matchcontext++ scorecontext++ score percentileweighted context++ scoreconserved branch lengthPct
hsa-miR-15a-5p305-3117mer-m8-0.1986-0.192.8770.44
hsa-miR-15a-5p308-3147mer-m8-0.1682-0.162.8770.44
hsa-miR-15a-5p311-3177mer-m8-0.1173-0.112.8770.44
hsa-miR-15a-5p314-3207mer-m8-0.0867-0.082.8770.44
hsa-miR-15a-5p317-3237mer-m8-0.0866-0.082.8770.44
hsa-miR-15a-5p320-3267mer-m8-0.0660-0.062.8770.44
hsa-miR-15a-5p323-3297mer-m8-0.0762-0.072.8770.44
Figure 5

MiR-15a-5p directly targeted PD1. (A) Predicted miR-15a-5p target sequences in the 3′ UTRs of PD1 genes. (B) WT and mutant PD1 luciferase plasmids were transfected into HEK293 cells with miR-15a-5p or NC. The luciferase activity was measured by dual-luciferase reporter assay system. (C) Luciferase assay for WT and mutant PD1 activity in CD8+ T cells incubated with exosomes from L-02, HepG2, HepG2 transfected with AMO-15a-5p, healthy volunteer serum or HCC patient serum. (D) RIP assay was performed to detect the enrichment of miR-15a-5p in CD8+ T cells transfected with PD1 or NC. (E) qRT-PCR analysis for PD1 expression in CD8+ T cells incubated with exosomes from L-02, HepG2, HepG2 transfected with AMO-15a-5p, healthy volunteer serum or HCC patient serum. (F) The protein expression of PD1 in normal tissues and cancer tissues in HCC. (G) The expression correlation between of miR-15a-5p and PD1 in HCC. Data are mean ± SD; *P < 0.05.

The predicting binding (conserved sites) between miR-15a-5p and PD1 using Targetscan. MiR-15a-5p directly targeted PD1. (A) Predicted miR-15a-5p target sequences in the 3′ UTRs of PD1 genes. (B) WT and mutant PD1 luciferase plasmids were transfected into HEK293 cells with miR-15a-5p or NC. The luciferase activity was measured by dual-luciferase reporter assay system. (C) Luciferase assay for WT and mutant PD1 activity in CD8+ T cells incubated with exosomes from L-02, HepG2, HepG2 transfected with AMO-15a-5p, healthy volunteer serum or HCC patient serum. (D) RIP assay was performed to detect the enrichment of miR-15a-5p in CD8+ T cells transfected with PD1 or NC. (E) qRT-PCR analysis for PD1 expression in CD8+ T cells incubated with exosomes from L-02, HepG2, HepG2 transfected with AMO-15a-5p, healthy volunteer serum or HCC patient serum. (F) The protein expression of PD1 in normal tissues and cancer tissues in HCC. (G) The expression correlation between of miR-15a-5p and PD1 in HCC. Data are mean ± SD; *P < 0.05.

Exo-miR-15a-5p Inhibited HCC Progression by Modulating PD1

To further identify whether exo-miR-15a-5p suppressed HCC progression by inhibiting PD1 in CD8+ T cells, we forced PD1 expression in CD8+ T cells, which was co-cultured with HepG2 with miR-15a-5p mimics. Firstly, PD1 expression was significantly increased in CD8+ T cells ( ). And followed functional analysis showed that overexpression of PD1 promoted accelerated cell viability and promoted cell proliferation, migration and invasion of HepG2 cells, which illuminated that PD1 remitted the anti-cancer role of miR-15a-5p on HCC progression ( ).
Figure 6

Exo-miR-15a-5p suppressed HCC progression by inhibiting PD1 expression in CD8+ T cells. PD1 was forced expression in CD8+ T cells, and co-cultured CD8+ T cells with HepG2 cells transfected with miR-15a-5p. (A) The transfection efficiency of PD1 was determined by qRT-PCR. (B) The protein expression of PD1 was determined by western blot. (C) CCK8 for viability of HepG2 cells. (D) Edu assay for proliferation of HepG2 cells. Scale bar, 100 μm. (E) Wound healing assay for migration of HepG2 cells. Scale bar, 500 μm. (F) Transwell assay for invasion of HepG2 cells. Scale bar, 100 μm. Data are mean ± SD; *P < 0.05.

Exo-miR-15a-5p suppressed HCC progression by inhibiting PD1 expression in CD8+ T cells. PD1 was forced expression in CD8+ T cells, and co-cultured CD8+ T cells with HepG2 cells transfected with miR-15a-5p. (A) The transfection efficiency of PD1 was determined by qRT-PCR. (B) The protein expression of PD1 was determined by western blot. (C) CCK8 for viability of HepG2 cells. (D) Edu assay for proliferation of HepG2 cells. Scale bar, 100 μm. (E) Wound healing assay for migration of HepG2 cells. Scale bar, 500 μm. (F) Transwell assay for invasion of HepG2 cells. Scale bar, 100 μm. Data are mean ± SD; *P < 0.05.

Discussion

HCC is one of the most common tumors in the world, accounting for the third highest mortality rate of malignant tumors worldwide. HCC has a high rate of recurrence and metastasis, which seriously threaten human life and health. Tumor microenvironment is a complex environment for the survival of cancer cells, and is mainly composed of a variety of different extracellular matrix and stromal cells. The communication between tumor cells and surrounding stromal cells plays an vital effect in the progression of malignant tumors, in which exosomes participate in the occurrence and development of tumors, forming a microenvironment suitable for tumor development and produce chemotherapy tolerance, so as to promote tumor progression. In present study, we found the HCC cells could secret exosomal miR-15a-5p into CD8+ T cells and inhibited PD1expression and PD1-PDL1 pathway, thereby suppressed cancer development. Many researches have shown that exosomes contribute to the occurrence and development of breast cancer, prostate cancer, lung cancer and other cancers (25). And it has been found that the biomolecules can also reflect some characteristics of tumors, making them ideal materials for early diagnosis of tumors (26, 27). Kogure T et al. studied exosomal RNA expression profiles of HCC cell line Hep3B and PLC/PRF/5 sources, and found that 11 miRNAs were specifically expressed (28). The results showed that a specific group of miRNAs were selectively enriched in hepatocellular carcinoma-derived exosomes. Hepatocellular exosomes can mediate the information transfer between HCC cells and tumor microenvironment, and regulate the signaling pathway of target gene expression in recipient cells, cell transformation and biological behavior. It was found that HCC exosomes could deliver miRNAs to recipient cells, which inhibited the constitutive expression of TAK1 and downstream signal MAP3K family, promoted the proliferation of HCC cells and metastasis of HCC (28). And in present study, we performed microarray to analyze miRNAs in HCC and found that miR-15a-5p was differentially expressed, which was confirmed by following qRT-PCR assay. Further, lower expression of miR-15a-5p indicated a poor prognosis of HCC patients. Moreover, overexpression of miR-15a-5p inhibited viability, proliferation, migration and invasion of HepG2 cells. To determine the origin of miR-15a-5p in HCC, we isolated exosomes from cancer cells and normal cells, and found that miR-15a-5p was packaged into exosomes from cancer cells. Thus, HCC cells secreted exosomal miR-15a-5p into tumor microenvironment, then exosomal miR-15a-5p modulated tumor growth. Interestingly, miR-15a-5p was downregulated in cancer cell exosomes that that in normal cell exosomes. Previous studies often showed that exosomal miRNAs from tumor cells promoted tumor growth. Our data found a prominent decreasing exosomal miRNA. So we though that the exosomes secreted by tumor cells during their growth process contain both growth-promoting miRNAs and growth-inhibiting miRNAs, but the number and variety of growth-promoting miRNAs are more, which enables the tumor to maintain its malignant proliferation. Thus, we can focus on these growth-inhibiting miRNAs, and develop novel method for tumor treatment. Tumor immunotherapy has developed rapidly in recent years, in which immunotherapy through PD-1/PD-L1 pathway plays an important role (29). So far, anti-PD-1/PD-L1 therapy performs anti-tumor effect by inhibiting the interaction between PD-1 and PD-L1, which has shown significant clinical benefits (30). Blocking PD-L1 and PD-1 pathway is a promising treatment. PD-1 is an immunosuppressive molecule, which regulates T cell function and maintains immune system homeostasis (31). Through the binding of PD-L1 on tumor cells to PD-1 on T cells, it can initiate T cell programmed death and cause T cell immune checkpoint response (32). Recent study showed that exosomes from tumor cells could transfer circRNA-002178 into CD8+ T cells and blocked PD-1/PD-L1 in lung adenocarcinoma (19). Interestingly, present study also found that miR-15a-5p was encapsulated in cancer cells and secreted into CD8+ T cells. And miR-15a-5p could directly inhibited PD1 expression through a targeted binding. Then, we co-cultured CD8+ T cells transfected with PD1 with HepG2 with miR-15a-5p, and PD1 removed the anti-tumor role of miR-15a-5p on HCC development.

Conclusion

In conclusion, our study revealed that exosomal miR-15a-5p from cancer cells inhibited PD1 expression in CD8+ T cells, which suppressed the development of HCC. And our finding might afford a novel target for prevention and treatment of HCC.

Data Availability Statement

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

Ethics Statement

The studies involving human participants were reviewed and approved by The First Affiliated Hospital of Zhengzhou University. The patients/participants provided their written informed consent to participate in this study.

Author Contributions

H-YZ performed the majority of experiments and analyzed the data. H-XL performed the molecular investigations. S-HW and QW designed and coordinated the research. H-QJ and Z-JY wrote the paper. All authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  32 in total

Review 1.  Exosomal non-coding RNAs: a promising cancer biomarker.

Authors:  Huan Yang; Hailong Fu; Wenrong Xu; Xu Zhang
Journal:  Clin Chem Lab Med       Date:  2016-12-01       Impact factor: 3.694

2.  Intercellular nanovesicle-mediated microRNA transfer: a mechanism of environmental modulation of hepatocellular cancer cell growth.

Authors:  Takayuki Kogure; Wen-Lang Lin; Irene K Yan; Chiara Braconi; Tushar Patel
Journal:  Hepatology       Date:  2011-07-29       Impact factor: 17.425

3.  MET Inhibitors Promote Liver Tumor Evasion of the Immune Response by Stabilizing PDL1.

Authors:  Hui Li; Chia-Wei Li; Xiaoqiang Li; Qingqing Ding; Lei Guo; Shuang Liu; Chunxiao Liu; Chien-Chen Lai; Jung-Mao Hsu; Qiongzhu Dong; Weiya Xia; Jennifer L Hsu; Hirohito Yamaguchi; Yi Du; Yun-Ju Lai; Xian Sun; Paul B Koller; Qinghai Ye; Mien-Chie Hung
Journal:  Gastroenterology       Date:  2019-01-31       Impact factor: 22.682

4.  Nomogram for Preoperative Estimation of Microvascular Invasion Risk in Hepatitis B Virus-Related Hepatocellular Carcinoma Within the Milan Criteria.

Authors:  Zhengqing Lei; Jun Li; Dong Wu; Yong Xia; Qing Wang; Anfeng Si; Kui Wang; Xuying Wan; Wan Yee Lau; Mengchao Wu; Feng Shen
Journal:  JAMA Surg       Date:  2016-04       Impact factor: 14.766

5.  CTC immune escape mediated by PD-L1.

Authors:  Xuefei Wang; Qiang Sun; Qiaofei Liu; Changjun Wang; Ru Yao; Yimin Wang
Journal:  Med Hypotheses       Date:  2016-05-21       Impact factor: 1.538

Review 6.  Detection of Circulating Tumor Cells and Their Implications as a Biomarker for Diagnosis, Prognostication, and Therapeutic Monitoring in Hepatocellular Carcinoma.

Authors:  Joseph C Ahn; Pai-Chi Teng; Pin-Jung Chen; Edwin Posadas; Hsian-Rong Tseng; Shelly C Lu; Ju Dong Yang
Journal:  Hepatology       Date:  2021-01-18       Impact factor: 17.425

Review 7.  Exosomes: New players in cancer (Review).

Authors:  Wei Guo; Yibo Gao; Ning Li; Fei Shao; Chunni Wang; Pan Wang; Zhenlin Yang; Renda Li; Jie He
Journal:  Oncol Rep       Date:  2017-06-13       Impact factor: 3.906

8.  Therapy with high-dose Interleukin-2 (HD IL-2) in metastatic melanoma and renal cell carcinoma following PD1 or PDL1 inhibition.

Authors:  Elizabeth I Buchbinder; Janice P Dutcher; Gregory A Daniels; Brendan D Curti; Sapna P Patel; Shernan G Holtan; Gerald P Miletello; Mayer N Fishman; Rene Gonzalez; Joseph I Clark; John M Richart; Christopher D Lao; Scott S Tykodi; Ann W Silk; David F McDermott
Journal:  J Immunother Cancer       Date:  2019-02-18       Impact factor: 13.751

9.  Gene co-expression network for analysis of plasma exosomal miRNAs in the elderly as markers of aging and cognitive decline.

Authors:  Zheng Ye; Bo Sun; Xue Mi; Zhongdang Xiao
Journal:  PeerJ       Date:  2020-01-06       Impact factor: 2.984

10.  The diagnostic value of the combination of Golgi protein 73, glypican-3 and alpha-fetoprotein in hepatocellular carcinoma: a diagnostic meta-analysis.

Authors:  Shoujie Zhao; Min Long; Xiangnan Zhang; Shixiong Lei; Weijia Dou; Jie Hu; Xilin Du; Lei Liu
Journal:  Ann Transl Med       Date:  2020-04
View more
  3 in total

1.  Exploration of Extracellular Vesicle miRNAs, Targeted mRNAs and Pathways in Prostate Cancer: Relation to Disease Status and Progression.

Authors:  Maija Puhka; Lisse Thierens; Daniel Nicorici; Tarja Forsman; Tuomas Mirtti; Taija Af Hällström; Elina Serkkola; Antti Rannikko
Journal:  Cancers (Basel)       Date:  2022-01-21       Impact factor: 6.639

Review 2.  MicroRNAs at the Crossroad between Immunoediting and Oncogenic Drivers in Hepatocellular Carcinoma.

Authors:  Laura Gramantieri; Francesca Fornari; Catia Giovannini; Davide Trerè
Journal:  Biomolecules       Date:  2022-07-02

Review 3.  Role of Exosomes in Immunotherapy of Hepatocellular Carcinoma.

Authors:  Bao-Wen Tian; Cheng-Long Han; Zhao-Ru Dong; Si-Yu Tan; Dong-Xu Wang; Tao Li
Journal:  Cancers (Basel)       Date:  2022-08-21       Impact factor: 6.575

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.