Literature DB >> 33811437

miR-365 secreted from M2 Macrophage-derived extracellular vesicles promotes pancreatic ductal adenocarcinoma progression through the BTG2/FAK/AKT axis.

Xin Li1, Hao Xu1,2, Jianfeng Yi1, Chunlu Dong1,2, Hui Zhang2, Zhengfeng Wang2, Long Miao2, Wence Zhou1,2.   

Abstract

Clinical and experimental evidence indicates that tumour-associated macrophages support cancer progression. Moreover, macrophage-derived extracellular vesicles (EVs) are involved in pathogenesis of multiple cancers, yet the functions of molecular determinants in which have not been fully understood. Herein, we aim to understand whether macrophage modulates pancreatic ductal adenocarcinoma (PDAC) progression in an EV-dependent manner and the underlying mechanisms. microRNA (miR)-365 was experimentally determined to be enriched in the EVs from M2 macrophages (M2-EVs), which could be transferred into PDAC cells. Using a co-culture system, M2-EVs could enhance the proliferating, migrating and invading potentials of PDAC cells, while inhibition of miR-365 in M2-EVs could repress these malignant functions. B-cell translocation gene 2 (BTG2) was identified to be a direct target of miR-365, while the focal adhesion kinase (F/ATP)-dependent tyrosine kinase (AKT) pathway was activated by miR-365. We further demonstrated that overexpression of BTG2 could delay the progression of PDAC in vitro, whereas by impairing BTG2-mediated anti-tumour effect, M2-EV-miR-365 promoted PDAC progression. For validation, a nude mouse model of tumorigenesis was established, in which we found that targeting M2-EV-miR-365 contributed to suppression of tumour growth. Collectively, M2-EVs carry miR-365 to suppress BTG2 expression, which activated FAK/AKT pathway, thus promoting PDAC development.
© 2021 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.

Entities:  

Keywords:  BTG2; FAK/AKT pathway; cell invasion; extracellular vesicles; macrophages; microRNA-365; pancreatic ductal adenocarcinoma

Year:  2021        PMID: 33811437      PMCID: PMC8107105          DOI: 10.1111/jcmm.16405

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


INTRODUCTION

Pancreatic ductal adenocarcinoma (PDAC) is the fourth leading cause of death from cancer. Approximately, 50 000 new cases are diagnosed each year, with the overall 5‐year survival rate less than 5%. PDAC is characterized by the severe fibrotic stroma and extensive macrophages infiltration. Preclinical and clinical experiments suggest that TAM accumulation in tumours negatively correlates with cancer outcome, and blocking the entry of macrophage into tumour enhances cancer therapy. Macrophages also secrete large number of extracellular vesicles (EVs), how these vesicles regulate cancer growth remains to be elucidated. EVs are small double‐membrane compartments secreted by nearly all cell types, with abundant cargos, including RNA, mRNA and microRNA (miRs or miRNAs). However, little is known about the role of EVs‐derived cargos, especially miRNA. miRNAs are small RNAs that modulate gene expression at the post‐transcriptional level. Different miRNAs have been addressed to be critical players in human cancers. For example, miR‐365 is a negative regulator of IL‐6 by directly binding to the 3′‐untranslated region (3′‐UTR) of IL‐6 mRNA. The function of miR‐365 in PDAC is yet not completely understood. To clarify its downstream target genes, we performed bioinformatics analysis, which revealed that B‐cell translocation gene 2 (BTG2) could be targeted by miR‐365. BTG2 is a cancer suppressive gene and C‐reactive protein treatment could enhance the human monocyte expression of BTG2, which arrests monocytes at G2/M cycle and promotes their apoptosis through p53. BTG2 also regulates mRNA at post‐transcriptional level. It promotes shortening of poly(A) tail through its interaction with CAF1/CCR4, thus inducing the instability of mRNA. The regulation of BTG2 in PDAC has been associated with seif‐miR‐21, miR‐23, and miR‐27a. Yet it is not known how EV‐derived miRNA regulates PDAC progression. AKT pathway is the most critical signalling pathway in regulating protein translation and cell homeostasis. Upon receptor activation, activated PI3‐kinase phosphorylates PI(4,5)P2 into P(3,4,5)P3, which recruits AKT to plasma membrane where PKB activates AKT. Phosphorylated‐AKT further activates mTORC1 and promotes protein translation, which contributes to cancer growth. Focal adhesion kinase (FAK) promotes integrin and growth factor signals, thus critical for cancer cell invasion. The regulation of these two kinases have been studied extensively, yet little evidence has been pointed to BTG2. In this study, we aim to investigate how miRNA secreted from M2 macrophage‐derived EVs (M2‐EVs) regulates PDAC the progression. We demonstrated that miR‐365 from M2‐EVs specifically targeted BTG2, which contributed to enhanced AKT/FAK activation in PDAC cells, resulting in potentiated malignant behaviours.

MATERIALS AND METHODS

Ethics statement

All animal experimentation protocols were approved by the Ethics Committee of the First Hospital of Lanzhou University. All animal procedures were performed according to the US National Institutes of Health principles of laboratory animal care.

Bioinformatics analysis

The downstream genes of miR‐365 were predicted using TargetScan (http://www.targetscan.org/vert_71), mirDIP (http://ophid.utoronto.ca/mirDIP/index.jsp#r) and starBase (http://starbase.sysu.edu.cn/). PDAC‐related data sets GSE71989 (with 7 normal and 25 tumour samples) and GSE32676 (with 8 normal and 13 tumour samples) were obtained from Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). Differential analysis was performed using linear modelling with the ‘limma’ package in ‘R’. Genes were considered differentially expressed in PDAC if they had |logFoldChange|>1 and P < .05. Expression of BTG2 in PDAC was retrieved in TCGA and GTEx using GEPIA2 database (http://gepia2.cancer‐pku.cn/#index).

Cell culture

PDAC cell lines (PANC‐1, BxPC‐3, MIA Paca‐2 and Capan‐2), human normal pancreatic ductal epithelial cell line H6c7 and human monocyte/macrophage cell line THP‐1 were purchased from American Type Culture Collection (ATCC; Manassas, VA, USA; https://www.atcc.org/). EVs in culture media were depleted by overnight centrifugation at 10 000 g, 4℃. PANC‐1, BxPC‐3, MIA Paca‐2, Capan‐2 and H6c7 cells were cultured using Dulbecco's modified eagle medium (DEME) (31600‐034; Hyclone, Pittsburg, PA, USA) supplemented with 10% foetal bovine serum (FBS) (10099141; Gibco, Perinton, NY, USA). , THP‐1 was cultured using RPMI (Hyclone) supplemented with 10% FBS. All cells were grown in a 37℃ incubator containing 5% CO2. They were passaged at ratio of 1/3‐1/4 once reached 90% confluence. All cell lines were tested using short tandem repeats analysis (STR) and confirmed mycoplasma negative. THP‐1 cells were differentiated into macrophages with 100 ng/mL polarized 12‐myristate 13‐acetate (P8139; Sigma, St. Louis, MO, USA), 100 ng/mL lipopolyasccharide (LPS, 8630; Sigma). M1 macrophages were differentiated with addition of 20 ng/mL Interferon (IFN)‐γ (285‐IF; R&D, Minneapolis, MN, USA) for 24 hours; M2 macrophages were induced by adding interleukin (IL)‐4 (AF‐200‐04‐5; Peprotech, Rocky Hill, NJ, USA) for 72 hours. Untreated THP‐1 cells served as control for M2‐EVs.

Cell treatment

The cells were transfected following the instructions of lipofectamine 2000 (11668‐019; Invitrogen, Carlsbad, CA, USA) upon 80%‐90% confluence. In detail, PANC‐1 and BxPC‐3 cells were transfected with 50 nM miR‐365 mimic, miR‐365 inhibitor or their matched negative controls (NC), namely, miR‐365 mimic group and miR‐365 inhibitor group, NC‐mimic group and NC‐inhibitor groups. In the EV experiment, PANC‐1 and BxPC‐3 cells were treated with the EVs derived from the M2 macrophages transduced by lentivirus‐mediated miR‐365 inhibitor or inhibitor‐NC, being (M2‐EVs + miR‐365 inhibitor group and M2‐EVs + NC‐inhibitor group). Lentiviral packaging of miR‐365 inhibitor or relevant NC was conducted by Inovogen Tech. Co. (Beijing, China). In addition, PANC‐1 and BxPC‐3 cells were transduced by adenovirus carrying BTG2 overexpression vector (oe‐BTG2) or relevant NC (oe‐NC) alone (the oe‐NC group and the oe‐BTG2 group), or treated with M2‐EVs in the presence of adenovirus‐mediated oe‐BTG2 or oe‐NC (the M2‐EVs + oe‐NC or the M2‐EVs + oe‐BTG2 group). miR‐365 mimic, miR‐365 inhibitor or their matched NCs, adenovirus‐packaged oe‐BTG2 or oe‐NC were purchased from RiboBio (Guangzhou, China). In the co‐culture experiment, PANC‐1 and BxPC‐3 cells were treated with phosphate buffer saline (PBS) as control group. PANC‐1 and BxPC‐3 were co‐cultured with M2 macrophages alone or in the presence of EV secretion inhibitor GW4869 (5 µM; MCE, HY‐19363, Monmouth Junction, NJ, USA) or co‐cultured with M2 macrophage‐conditioned medium (M2‐CM) or incubated with M2‐EVs. miR‐365 mimic labelled with Cy3 by Ambion (Austin, TX, USA) was transfected to M2 macrophages. After transfection, EVs were isolated from macrophages in logarithmic growth phase (Cy3‐miR‐365‐M2‐EVs). PANC‐1 and BxPC‐3 cells of 50%‐80% confluence were treated with Cy3‐miR‐365‐M2‐EVs or EV‐depleted M2 macrophages in 24‐well plates, with PBS treatment only as control. After 48 hours, uptake of Cy3‐miR‐365‐M2‐EVs by PANC‐1 and BxPC‐3 cells was examined under an automatic fluorescent inverted microscope. At the end of co‐culture, cells were washed with PBS 3 times. The dose of EV in each single experiment was 1 μg. Experiments were performed 3 times.

PKG67 labelling of M2‐EVs

Isolated M2‐EVs were labelled with PKH67 (PKH67GL‐1KT, Sigma) as previously described. Essentially, M2‐EVs were mixed with Diluent C and incubated with PKH‐67‐Diluent C staining solution for 5 minutes. The staining was terminated by adding 2 mL 10% bovine serum albumin (BSA) in PBS (D8537). Liquid was transferred to the bottom of the tube, and 1.5 mL sucrose solution was added and centrifuged for 2 hours at 95589g, 2‐8℃. M2‐EV pellets were resuspended in PBS and transferred into Amicon filter column. Next, 9 mL of PBS and 0.75 mL medium were added to the tube. The tube was centrifuged at 300 rpm for 40 min, by which the volume was reduced to 0.5‐1 mL. Each experiment was performed 3 times.

EV isolation and identification

Extracellular vesicles from supernatant were isolated using ultracentrifugation. Cell debris was depleted by centrifugation at 500 g for 15 minutes at 4℃; apoptotic body was subtracted by centrifugation at 2000 g for 15 minutes, 4℃. Large vesicles were depleted by centrifugation at 10 000 g for 20 minutes, 4℃. The resulting supernatants were filtered using 0.22 μm filter, followed by centrifugation at 110 000 g for 70 minutes at 4℃. The final pellet was resuspended with 100 μL sterile PBS. Ultracentrifugation was performed using Beckman ultracentrifuge (TL‐100), Rotor TLS‐55. Regular centrifugation was done using Beckman Allegra X‐15R. The vesicles were saved in −80℃ freezer for future use. Extracellular vesicle was identified using transmission electron microscopy (TEM). Briefly, a total of 20 μL EVs were counterstained with 30 μL Phosphotungstic acid solution (pH 6.8). Images were taken using TEM. EVs were analysed using nano‐particle tracking analysis (NTA) (NS300, MIL, Malvern, UK). EV‐specific protein tumour susceptibility gene 101 (TSG101), CD63, CD81 and endoplasmic reticulum (ER) marker GRP94 were characterized by Western blot assay. The methods were modified from previously described methods. Each experiment was performed 3 times.

Cell counting kit‐8 (CCK‐8) assay

Cells in logarithmic growth phase were seeded in a 96‐well plate at the density of 5 × 103 cells/well for 3 days. Upon seeded (0 h), 10 μL CCK‐8 solution (CA1210‐100; Solarbio, Santa Clarita, CA, USA) was added to each culture well, and incubated for 2 hours at 37℃. Absorbance at 450 nm was measured using plate reader (BIO‐RAD 680, BIO‐RAD) for different time points (0, 24, 48, 72 hours). Each experiment was done 3 times.

Transwell experiment

In cell migration assay, cells were seeded onto Transwell (8 µm filter) chambers at a density of 5 × 104 cells/mL with 200 μL each chamber. Cells or 500 μL 10% FBS medium was loaded into basolateral chamber with triplicates for each group. After 24‐hour incubation in 37℃, 5% CO2 incubator, Transwell chambers were removed and washed with PBS for twice, fixed with 4% paraformaldehyde, and stained with crystal violet for 5 min. Surface cells on chambers were wiped off and observed using inverted fluorescence microscope (TE2000; NIKON, Beijing, China) with 5 randomly chosen visual fields. The average number of cell crossing the chambers was recorded. Each experiment was done 3 times. As for cell invasion assay, pre‐cooled Matrigel (40111ES08; Yeason, Shanghai, China) was diluted in serum‐free DMEM (1:2) and loaded to upper part of Transwell chamber. Matrigel was solidified by incubating in 37℃ incubator for 4‐5 hours. Transfected cells were resuspended using 100 µL serum‐free medium at the concentration of 106/mL and seeded onto apical chamber. The following procedures were performed as the cell migration assay described.

Western blot assay

Extracellular vesicles were resuspended in pre‐cooled cell lysis buffer (20 mM Tris‐HCl, pH = 7.5, 10 mM NaF, 150 mM NaCl, 1% Nonidet P‐40, 1 mM phenylmethylsulphonyl fluoride, 1 mM Na3VO4) in the presence of protease inhibitor (Roche, Basel, Switzerland). Lysate was mixed with 3× Laemmli's sample buffer, boiled for 5 min and separated by 12% sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDS‐PAGE). After separation, the protein was electroblotted to membrane and then blocked with PBS (pH = 7.4) containing 5% BSA and 0.05% tween 20. The membrane was probed with rabbit anti‐CD63 (ab6841, 1:1000; Abcam, Cambridge, UK) CD81 (ab109201, 1:2000; Abcam), TSG101 (ab30871, 1:1000; Abcam), GRP94 (ab3674, 1:3000; Abcam). Horseradish peroxidase (HRP)‐conjugated anti‐rabbit secondary antibody (Ab6721, 1:10 000; Abcam) was added to the membrane. Enhanced chemiluminescence (ECL) was applied to detect protein signal (170‐8280; Bio‐Rad Laboratories, Hercules, CA, USA) with Ponceau red as internal control. As for other proteins, the tissues, cells or EV total proteins were extracted with high‐efficiency radioimmunoprecipitation assay lysis buffer (R0010; Solarbio). After 15‐minute lysis at 4℃, lysate was centrifuged at 6540.3g for 15 min. Protein concentration was quantified by bicinchoninic acid (BCA) kit (20201ES76; Yeason). Lysates were separated by SDS‐PAGE. After separation, the protein was electroblotted to phenylmethylsulphonyl fluoride membrane, and blocked with 5% skimmed milk for 1 hour. Primary antibodies BTG2 (ab85051, 1:800; Abcam), FAK (ab72140, 1:2000; Abcam), phosphorylated‐FAK (ab4792, 1:1000; Abcam), AKT (ab179463, 1:10 000; Abcam), phosphorylated‐AKT (ab192623, 1:800; Abcam), M1 marker CD68 (ab125212, 1:1000; Abcam) and iNOS (ab3523, 1:800; Abcam), M2 marker Arginase (ab124917, 1:5000) and CD206 (ab64693, 1:2000; Abcam), proliferation‐related factor Ki‐67 (ab92742, 1:5000; Abcam) and PCNA (ab92552, 1:5000; Abcam), apoptotic‐related factors Bax (ab32503, 1:2000; Abcam), Bcl‐2 (ab59348, 1:1000; Abcam), and cleaved caspase3 (ab49822, 1:500; Abcam), epithelial‐to‐mesenchymal transition (EMT)‐related factors Vimentin (ab92547, 1:3000; Abcam), Snail (ab180714, 1:1000; Abcam), and E‐cadherin (ab15148, 1:500; Abcam), glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH; ab8245, 1:5000; Abcam) were incubated at 4℃ under shaking overnight. After incubation, membranes were incubated with HRP‐conjugated goat anti‐rabbit secondary IgG (ab6721, 1:5000; Abcam) or goat anti‐mouse IgG (ab6789, 1:5000; Abcam) for 1 hour at room temperature. ECL was applied to detect protein signals. ImageJ 1.48u (HIN) was used to quantify proteins. The relative grey scale ratio of expression of target protein to internal reference GAPDH was calculated.

Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR)

RNA from cells, tissues and EVs was extracted using RNA extraction kit (AM1552; Thermo Fisher, Waltham, MA, USA) following manual instruction. After extraction, RNA concentration was determined. All primers were synthesized by Takara (Dalian, China) (Table 1). DNA was obtained using one step miRNA reverse transcription kit (D1801; HaiGene, Harbin, China) following the instructions. Complementary DNA (cDNA) was synthesized by reverse transcription kit (D0401; HaiGene). The RNA level was quantified in Real‐time PCR system (ABI ViiA 7; Daan Gene Co., Ltd. of Sun Yat‐Sen University, Guangzhou, China). mRNA from cell and tissue lysates was referenced to internal control β‐actin; miRNA from cell and tissue lysates was referenced to U6, while miRNA from serum and EVs was further referenced to external control cel‐miR‐39. The relative expression of target genes was measured by 2−ΔΔCt method. ΔΔCt = ΔCtexperimental − ΔCtcontrol, ΔCt = Ct (target gene) − Ct (internal control), target gene mRNA transcription level = 2−ΔΔCt. Each experiment was performed for three times.
TABLE 1

RT‐qPCR primer sequence

Primer sequence (5′–3′)
Human‐miR‐365F: CGTAATGCCCCTAAAAAT
R: GTGCAGGGTCCGAGGT
Mouse‐miR‐365F: ACCGCAGGGAAAATGAGGGA
R: AGCAATAAGGATTTTTAGGGGCAT
BTG2F: GCGCGGGCTCTTCCTCTTTG
R: AAGGAAGGCTGGAAGAGTGC
CD68F: CATCAGAGCCCGAGTACAG
R: TGCGCCATGAATGTCCACT
iNOSF: GCCCAACAATACAAGATGACCC
R: ATGATGGACCCCAAGCAAGACT
ArginaseF: CATATCTGCCAAAGACATCGTGT
R: TCTTCCATCACCTTGCCAATCCC
CD206F: CAGGTGTGGGCTCAGGTAGT
R: TGTGGTGAGCTGAAAGGTGA
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
cel‐miR‐39F: ACACTCCAGCTGGGTCACCGGGTGTAAATC
R: TGGTGTCGTGGAGTCG
β‐actinF: CTGAGAGGGAAATCGTGCGT
R: CCACAGGATTCCATACCCAAGA

Abbreviations: BTG2, B‐cell translocation gene 2; F, forward; R, reverse; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction.

RT‐qPCR primer sequence Abbreviations: BTG2, B‐cell translocation gene 2; F, forward; R, reverse; RT‐qPCR, reverse transcription‐quantitative polymerase chain reaction.

Dual‐luciferase reporter assay

BTG2 or BTG2 carrying mutation at miR‐365 binding domain was inserted into pGL3 vector: pGL3BTG2 wild type (WT) and pGL3BTG2 mutant type (MUT). The reporter plasmids were co‐transfected with miR‐365 overexpression vector and pRL‐TK (the internal reference plasmid expressing renilla luciferase) into HEK293 cells. After 24‐hour transfection, cells were lysed following manual instructions from TransDetect Double‐Luciferase Reporter Assay Kit (FR201‐01; TransGen Biotech, Beijing, China) and luciferase activity was measured using a dual‐luciferase assay system (Dual‐Luciferase® Reporter Assay System, E1910; Promega, Madison, MI, USA). Briefly, 100 μL Luciferase Reaction Reagent was added to the tube at room temperature, and mixed with 20 μL lysate, followed by the quantification of firefly luciferase activity. Meanwhile, 100 μL Luciferase Reaction Reagent Ⅱ was added to determine the activity of renilla luciferase. The relative luciferase activity was calculated by the ratio of firefly luciferase activity to renilla luciferase activity. Each experiment was performed 3 times.

Nude mice tumour experiment

A total of 40 BALB/c male mice (3‐6‐week old, 16‐22 g) were purchased from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). Nude mice were housed in specific pathogen free (SPF) barrier system with regularly sterilized environment, feeding at 24‐26℃, and humidity of 40%‐60%. PANC‐1 cells in exponential growing phase were collected and resuspended in PBS at 107/mL. Nude mice were subcutaneously injected with 100 µL cell suspension on the right groin, while, M2‐EVs or saline was injected to mice through tail vein. The dose of EVs in each single experiment was 1 μg per mouse. After 4 weeks, tumours were isolated, and cut into sections smaller than 1 mm3, and transplanted to pancreas capsule of nude mice. Also, M2‐EVs or saline was injected via tail vein. After 4 weeks, mice were euthanized by injection of 9% pentobarbital sodium (P3761; Sigma) intraperitoneally. Tumours were dissected, and the width (a) and length (b) of the tumour were measured by vernier caliper. Tumour size was calculated by formula π(a2b)/6, and tumours were weighed on a scale. Peripheral blood was collected for serum, and serum‐derived EVs were isolated, followed by the determination of miR‐365 level in EVs and tumour tissues using RT‐qPCR as described above (with cel‐miR‐39 as internal reference). Mice were grouped as PBS group, M2‐EVs group, M2‐EVs + NC antagomir group and M2‐EVs + miR‐365 antagomiR group with 10 mice each group. EVs were extracted after M2 macrophages were transfected with NC antagomiR or miR‐365 antagomiR.

Statistical analysis

The data were processed using SPSS 21.0 statistical software (SPSS, IBM Corporation, Armonk, NY, USA). Measurement data were summarized by mean ± SD. Unpaired data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA with Tukey's post hoc test. Data from different time point were compared by repeated measures ANOVA. The correlation between TAM accumulation in pancreatic duct and overall survival was analysed by Kaplan‐Meier. For all statistical tests, a 0.05 level of confidence was accepted for statistical significance.

RESULTS

MiR‐365 is highly expressed in M2‐EVs and M2‐EVs promotes miR‐365 expression in PDAC cells

To explore the expression patterns of miR‐365 in EVs, THP‐1 cells were differentiated to M1 or M2 macrophages. Results of RT‐qPCR analysis demonstrated that LPS and γ‐IFN treatment drove M1 differentiation, marked by CD68 and iNOS. Meanwhile, IL‐4 treatment induced M2 differentiation, marked by Arginase and CD206 (P < 0.05, Figure 1A). We next examined the EVs from THP‐1, M1 and M2 macrophages using TEM. EVs were of different size, round‐ or oval‐shaped and their diameters ranged from 30 to 150 nm (Figure 1B). NTA showed the majority of EVs with diameter within 30‐200 nm (Figure 1C). CD63, CD81 and TSG101 are widely used as EV markers. As reflected by Western blot assay, we confirmed that EV markers CD63, CD81 and TSG101 were highly expressed in the isolated vesicles in comparison to total cell lysate, yet the isolated vesicles were negative for ER marker GRP94 (P < 0.05, Figure 1D). CD68 and iNOS serve as markers for polarized M1 macrophages while CD163, CD206 and Arginase as markers for M2 macrophages. , Compared with THP‐1‐EVs, M1‐EVs exhibited high expression of CD68, iNOS, Arginase, CD206 and M2‐EVs carried high Arginase and CD206 yet low CD68 and iNOS expression. Moreover, M2‐EVs expressed increased Arginase and CD206, and decreased CD68 and iNOS in comparison to M1‐EVs (P < 0.05, Figure 1E). In summary, we successfully isolated EVs from THP‐1, M1 and M2 macrophages.
FIGURE 1

M2‐EVs highly expressed miR‐365 and promotes miR‐365 expression in PDAC. (A) Macrophage marker mRNA expression (CD68, iNOS, Arginase, CD206) in THP‐1, M1 and M2 macrophages examined by RT‐qPCR; (B) Ultrastructure of EVs observed under TEM (scale bar = 100nm); (C) Quantity and diameter of EVs measured through NTA; (D) TSG101, CD63, CD81, GRP194 protein levels in EVs determined by Western blot assay; (E) Macrophage marker protein expression in EVs isolated from THP‐1, M1 and M2 macrophages by Western blot assay; (F) miR‐365 level in EVs quantified by RT‐qPCR. (G) miR‐365 mRNA level in PDAC cells treated with EVs derived from macrophages determined by RT‐qPCR. H. PKH‐67‐labelled M2‐EV uptake by PANC‐1 and BxPC‐3 cells, determined by fluorescence signal (400×, scale bar = 25 µm). * vs THP‐1 cells or THP‐1‐EVs, P < 0.05; # vs M1 or M1‐EVs, P < 0.05, ^ indicates the cells with highest miR‐365 expression. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

M2‐EVs highly expressed miR‐365 and promotes miR‐365 expression in PDAC. (A) Macrophage marker mRNA expression (CD68, iNOS, Arginase, CD206) in THP‐1, M1 and M2 macrophages examined by RT‐qPCR; (B) Ultrastructure of EVs observed under TEM (scale bar = 100nm); (C) Quantity and diameter of EVs measured through NTA; (D) TSG101, CD63, CD81, GRP194 protein levels in EVs determined by Western blot assay; (E) Macrophage marker protein expression in EVs isolated from THP‐1, M1 and M2 macrophages by Western blot assay; (F) miR‐365 level in EVs quantified by RT‐qPCR. (G) miR‐365 mRNA level in PDAC cells treated with EVs derived from macrophages determined by RT‐qPCR. H. PKH‐67‐labelled M2‐EV uptake by PANC‐1 and BxPC‐3 cells, determined by fluorescence signal (400×, scale bar = 25 µm). * vs THP‐1 cells or THP‐1‐EVs, P < 0.05; # vs M1 or M1‐EVs, P < 0.05, ^ indicates the cells with highest miR‐365 expression. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times RT‐qPCR analysis further demonstrated the highest miR‐365 expression in M2‐EVs (P < 0.05, Figure 1F). We chose 4 human PDAC cell lines (PANC‐1, BxPC‐3, MIA Paca‐2, Capan‐2) and 1 normal human pancreatic ductal epithelial cells line H6c7, which were co‐cultured with M2‐EVs. We found miR‐365 level was considerably increased in PDAC cell lines after exposure to M2‐EVs, among which PANC‐1 and BxPC‐3 had the highest expression. Therefore, we chose those two for future experiments (P < 0.05, Figure 1G). Finally, uptake of EVs by PANC‐1 and BxPC‐3 cells was observed using confocal microscopy. All cells co‐cultured with EVs exhibited GFP+, suggesting the uptake of vesicles (Figure 1H). In all, we find that M2‐EVs carry high expression of miR‐365, which promotes the expression of miR‐365 in PDAC cells.

M2‐EVs exert pro‐proliferative, pro‐migratory and pro‐invasive effect on PDAC cells

To understand whether M2‐EVs affect PDAC cell functions, PANC‐1 and BxPC‐3 cells were co‐cultured with EVs, in the presence or absence of GW4869. CCK‐8 experiments demonstrated little difference between the Co‐cul + GW4869 group and the control group (P > 0.05). Co‐culture with M2 macrophages, M2‐CM or M2‐EVs contributed to increased proliferating PANC‐1 and BxPC‐3 cells (P < 0.05, Figure 2A). The results of Transwell assay revealed that co‐culture with M2 macrophages, M2‐CM or M2‐EVs resulted in elevations in the numbers of migrated and invaded PANC‐1 and BxPC‐3 cells (Figure 2B and C). Furthermore, treatment with M2‐EVs showed even enhanced promotive effect on these abilities than M2‐CM (P < 0.05, Figure 2A‐C). Protein levels of proliferation‐, apoptosis‐ and EMT‐related factors were measured through Western blot assay. Meanwhile, co‐culture with M2 macrophages, M2‐CM or M2‐EVs elevated the expression patterns of Ki67, PCNA, Bcl‐2, Vimentin, and Snail, yet dampened Bax, cleaved caspase3 and E‐cadherin in both PANC‐1 and BxPC‐3 cells (P < 0.05). As compared to M2‐CM, M2‐EVs caused further increased Ki67, PCNA, Bcl‐2, Vimentin, and Snail, as well as decreased Bax, cleaved caspase3 and E‐cadherin (P < 0.05, Figure 2D and E). In summary, M2‐EVs promote the malignant progression of PDAC in vitro.
FIGURE 2

M2‐EVs promote PDAC cell proliferation, migration and invasion. (A) Proliferation of PANC‐1 and BxPC‐3 cells assessed by CCK‐8. (B) Invasion of PANC‐1 and BxPC‐3 tested by Transwell experiment (200×, scale bar = 50 µm). (C) Migration of PANC‐1 and BxPC‐3 tested by Transwell experiment (200×, scale bar = 50 µm). (D) Protein levels of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in PANC‐1 and BxPC‐3 cells measured by Western blot assay. (E) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in PANC‐1 and BxPC‐3 cells measured by Western blot assay. * in comparison to Control, P < 0.05. # in comparison to M2‐CM, P < 0.05. NS, non‐statistically significant. M2‐EVs group refers to PANC‐1 and BxPC‐3 cells treated with M2 macrophage‐derived EVs; M2‐CM group refers to PANC‐1 and BxPC‐3 cells co‐cultured with M2 macrophage‐conditioned medium; co‐cul group refers to M2 macrophage‐treated PANC‐1 and BxPC‐3 cells. The dose of EVs in each single experiment was 1 μg. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

M2‐EVs promote PDAC cell proliferation, migration and invasion. (A) Proliferation of PANC‐1 and BxPC‐3 cells assessed by CCK‐8. (B) Invasion of PANC‐1 and BxPC‐3 tested by Transwell experiment (200×, scale bar = 50 µm). (C) Migration of PANC‐1 and BxPC‐3 tested by Transwell experiment (200×, scale bar = 50 µm). (D) Protein levels of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in PANC‐1 and BxPC‐3 cells measured by Western blot assay. (E) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in PANC‐1 and BxPC‐3 cells measured by Western blot assay. * in comparison to Control, P < 0.05. # in comparison to M2‐CM, P < 0.05. NS, non‐statistically significant. M2‐EVs group refers to PANC‐1 and BxPC‐3 cells treated with M2 macrophage‐derived EVs; M2‐CM group refers to PANC‐1 and BxPC‐3 cells co‐cultured with M2 macrophage‐conditioned medium; co‐cul group refers to M2 macrophage‐treated PANC‐1 and BxPC‐3 cells. The dose of EVs in each single experiment was 1 μg. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

Suppression of M2‐EV‐miR‐365 dampens the malignant behaviours of PDAC cells

To understand if miR‐365 in PDAC is acquired from M2‐EVs, we transfected M2 macrophages with Cy3‐labelled miR‐365 mimic and then extracted M2‐EVs. PANC‐1, and BxPC‐3 cells were co‐cultured with Cy3‐miR‐365‐M2‐EVs or EV‐depleted M2 culture supernatant. Immunofluorescence detection showed that PBS group was fluorescence‐negative, 85% cells after co‐culture with Cy3‐miR‐365‐M2‐EVs were red fluorescence‐positive, suggestive of the uptake of Cy3‐miR‐365‐M2‐EVs by PANC‐1 and BxPC‐3 cells (Figure 3A). The PANC‐1 and BxPC‐3 cells expressed high level of miR‐365 after co‐culture with Cy3‐miR‐365‐M2‐EVs, while co‐culture with EV‐depleted M2 culture supernatant caused no difference in miR‐365 expression (P > 0.05) (Figure 3B). These data demonstrate that EVs transfer miR‐365 from M2 macrophages into PDAC cells.
FIGURE 3

Suppression of M2‐EV‐miR‐365 dampens PDAC cell proliferation, migration and invasion. (A) Immunofluorescence analysis demonstrated the uptake of Cy3‐miR‐365‐labelled M2‐EVs by PANC‐1 and BxPC‐3 cells (400×, scale bar = 25 µm); (B) miR‐365 expression in PANC‐1 and BxPC‐3 cells treated with PBS, culture medium and Cy3‐miR‐365‐M2‐EVs measured by RT‐qPCR. (C) miR‐365 expression in PANC‐1 and BxPC‐3 cells treated with PBS, EVs derived from miR‐365 inhibitor/inhibitor‐NC‐treated M2 macrophages measured by RT‐qPCR. (D) Proliferation of PANC‐1 and BxPC‐3 cells from different groups examined by CCK‐8. (E) Invasion of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (F) Migration of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (G) Protein levels of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in PANC‐1 and BxPC‐3 cells from different groups determined by Western blot assay. (H) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in PANC‐1 and BxPC‐3 cells from different groups measured by Western blot assay. * in comparison to Control, P < 0.05. # in comparison to M2‐EVs + inhibitor‐NC, P < 0.05. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

Suppression of M2‐EV‐miR‐365 dampens PDAC cell proliferation, migration and invasion. (A) Immunofluorescence analysis demonstrated the uptake of Cy3‐miR‐365‐labelled M2‐EVs by PANC‐1 and BxPC‐3 cells (400×, scale bar = 25 µm); (B) miR‐365 expression in PANC‐1 and BxPC‐3 cells treated with PBS, culture medium and Cy3‐miR‐365‐M2‐EVs measured by RT‐qPCR. (C) miR‐365 expression in PANC‐1 and BxPC‐3 cells treated with PBS, EVs derived from miR‐365 inhibitor/inhibitor‐NC‐treated M2 macrophages measured by RT‐qPCR. (D) Proliferation of PANC‐1 and BxPC‐3 cells from different groups examined by CCK‐8. (E) Invasion of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (F) Migration of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (G) Protein levels of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in PANC‐1 and BxPC‐3 cells from different groups determined by Western blot assay. (H) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in PANC‐1 and BxPC‐3 cells from different groups measured by Western blot assay. * in comparison to Control, P < 0.05. # in comparison to M2‐EVs + inhibitor‐NC, P < 0.05. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times Next, we added EVs from M2 macrophages transduced with lentivirus‐mediated miR‐365 inhibitor or inhibitor‐NC to PANC‐1 and BxPC‐3 cells. PANC‐1 and BxPC‐3 cells from the M2‐EVs + In‐NC group exhibited increased miR‐365 expression as compared to the control group, while cells from the exhibited decreased miR‐365 expression as compared to M2‐EVs + In‐NC (P < 0.05, Figure 3C). Enhanced proliferative, migratory and invasive properties of PANC‐1 and BxPC‐3 cells were observed after co‐culture with M2‐EVs either when miR‐365 was inhibited in M2 macrophages in advance or not (P < 0.05). When miR‐365 was inhibited in M2 macrophages in advance, M2‐EVs resulted in weaken promoting effects on proliferating, migrated and invaded cells (Figure 3D‐F). Using Western blot assay, we confirmed increased Ki67, PCNA, Bcl‐2, Vimentin, Snail and decreased Bax, cleaved caspase3, E‐cadherin in both the M2‐EVs + inhibitor‐NC group and the M2‐EVs + miR‐365 inhibitor group relative to the control group (P < 0.05). In addition, the M2‐EVs + miR‐365 inhibitor group showed less Ki67, PCNA, Bcl‐2 expression and more Bax, cleaved caspase3, E‐cadherin expression vs the M2‐EVs + inhibitor‐NC group (Figure 3G and H). These data demonstrate that inhibition of M2‐EVs‐miR‐365 delays malignant progression of PDAC in vitro.

MiR‐365 targets BTG2 and regulates BTG2/FAK/AKT pathway

To identify the downstream target genes of miR‐365, we adopted TargetScan, mirDIP and starBase databases. Meanwhile, we analysed samples from GSE71989 and GSE32676 data sets, and identified genes down‐regulated in PDAC vs normal control. The only gene that overlapped was BTG2 (Figure 4A). In addition, BTG2 expression significantly decreased in PDAC samples from GSE71989 and GSE32676 data sets (Figure 4B and C). Further search in GEPIA2, TCGA and GTEx databases exhibited significantly decreased BTG2 in PDAC (Figure 4D). Binding region of BTG2 gene to miR‐365 was identified through Targetscan website (Figure 4E). To demonstrate whether BTG2 gene was indeed the target of miR‐365, we generated point mutation of 3′‐UTR region of BTG2 gene, which interrupted the physical binding between the two. Compared with NC‐mimic group, BTG2‐WT/miR‐365 mimic had significantly reduced luciferase activity signal (P < 0.05), while BTG2‐MUT/miR‐365 showed no difference (P > 0.05) (Figure 4F), demonstrated that miR‐365 could indeed bind to BTG2 mRNA.
FIGURE 4

MiR‐365 targets BTG2 and activates the BTG2/FAK/AKT pathway. (A) The predicted target genes given by the TargetScan, mirDIP and starBase databases and genes significantly down‐regulated in PDAC data sets (GSE71989 and GSE32676), wherein central part is the overlap of the five groups of data; (B and C) BTG2 expression in GSE71989 (B) and GSE32676 (C) data sets, wherein grey column indicates samples from healthy individuals, and red column indicates tumour samples. (D) BTG2 gene expression in TCGA and GTEX database, wherein red indicates tumours samples, grey indicates healthy samples. (E) BTG2 is the target gene of miR‐365, predicted by TargetScan website. (F) The binding of BTG2 to miR‐365 confirmed by dual‐luciferase reporter assay. (G) Expression of miR‐365 and BTG2 in PANC‐1 and BxPC‐3 cells determined by RT‐qPCR. (H) Protein levels of BTG2 and FAK/AKT pathway‐related factors in PABC‐1 and BxPC‐3 cells by Western blot assay. (I) Expression level of miR‐365 and BTG2 in PABC‐1 and BxPC‐3 cells co‐cultured with M2‐EVs by RT‐qPCR. (J) Protein levels of BTG2 and FAK/AKT pathway‐related factors in PABC‐1 and BxPC‐3 cells co‐cultured with M2‐EVs by Western blot assay. * in comparison to NC‐mimic or NC‐inhibitor, or PBS, P < 0.05. # in comparison to M2‐EVs + inhibitor‐NC, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

MiR‐365 targets BTG2 and activates the BTG2/FAK/AKT pathway. (A) The predicted target genes given by the TargetScan, mirDIP and starBase databases and genes significantly down‐regulated in PDAC data sets (GSE71989 and GSE32676), wherein central part is the overlap of the five groups of data; (B and C) BTG2 expression in GSE71989 (B) and GSE32676 (C) data sets, wherein grey column indicates samples from healthy individuals, and red column indicates tumour samples. (D) BTG2 gene expression in TCGA and GTEX database, wherein red indicates tumours samples, grey indicates healthy samples. (E) BTG2 is the target gene of miR‐365, predicted by TargetScan website. (F) The binding of BTG2 to miR‐365 confirmed by dual‐luciferase reporter assay. (G) Expression of miR‐365 and BTG2 in PANC‐1 and BxPC‐3 cells determined by RT‐qPCR. (H) Protein levels of BTG2 and FAK/AKT pathway‐related factors in PABC‐1 and BxPC‐3 cells by Western blot assay. (I) Expression level of miR‐365 and BTG2 in PABC‐1 and BxPC‐3 cells co‐cultured with M2‐EVs by RT‐qPCR. (J) Protein levels of BTG2 and FAK/AKT pathway‐related factors in PABC‐1 and BxPC‐3 cells co‐cultured with M2‐EVs by Western blot assay. * in comparison to NC‐mimic or NC‐inhibitor, or PBS, P < 0.05. # in comparison to M2‐EVs + inhibitor‐NC, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times Next, PANC‐1 and BxPC‐3 cells were transfected with miR‐365 mimic and miR‐365 inhibitor. By RT‐qPCR and Western blot analyses, we found that overexpression of miR‐365 dampened BTG2 expression, which promoted the extents of FAK and AKT phosphorylation. However, miR‐365 inhibitor increased BTG2 expression and suppressed the extents of FAK and AKT phosphorylation (P < 0.05). Total FAK and AKT expression was not different among groups (P > 0.05, Figure 4G and H). To further understand whether M2‐EVs‐derived miR‐365 modulates PDAC through BTG2/FAK/AKT pathway, PANC‐1 and BxPC‐3 cells were co‐cultured with EVs from miR‐365 inhibitor/inhibitor‐NC‐treated M2 macrophages. M2‐EVs + inhibitor‐NC and M2‐EVs + miR‐365 inhibitor groups had decreased BTG2 expression and increased extent of FAK and AKT phosphorylation as compared to PBS group (P < 0.05), while the M2‐EVs + miR‐365 inhibitor group exhibited elevated BTG2 expression and dampened extents of FAK and AKT phosphorylation vs the M2‐EVs + inhibitor‐NC group (P < 0.05; Figure 4I and J). Taken together, miR‐365 suppresses BTG2 and activates FAK/AKT pathway, while M2‐EVs transfer miR‐365 to regulate BTG2 and FAK/AKT pathway.

M2‐EV‐miR‐365 regulates the BTG2/FAK/AKT axis and accelerates PDAC progression

To understand how M2‐EV‐miR‐365 regulates BTG2/FAK/AKT axis in PDAC development, PANC‐1 and BxPC‐3 cells were treated with oe‐BTG2, which were co‐cultured with M2‐EVs. In comparison to the oe‐NC group, the cells in the oe‐BTG2 group significantly elevated BTG2 expression and decreased extent of FAK and AKT phosphorylation without affecting miR‐365 (P < 0.05). The M2‐EVs + oe‐BTG2 group showed increased the BTG2 expression and reduced the extents of FAK and AKT phosphorylation as compared to the M2‐EVs + oe‐NC group (P < 0.05, Figure 5A and B). Furthermore, overexpression of BTG2 attenuated the proliferative, migratory and invasive properties of PANC‐1 and BxPC‐3 cells (P < 0.05, Figure 5C,D and E), corresponding to decreased Ki67, PCNA, Bcl‐2, Vimentin, and Snail expression and increased Bax, cleaved caspase3, and E‐cadherin expression (P < 0.05, Figure 5F and G). Also, diminished proliferative, migratory and invasive functions were observed in the M2‐EVs + oe‐BTG2 in comparison to the M2‐EVs + oe‐NC group, along with reductions in Ki67, PCNA, Bcl‐2, Vimentin, and Snail and elevations in Bax, cleaved caspase3 and E‐cadherin. In all, the suppression of M2‐EV‐miR‐365 promotes BTG2 expression and dampens the FAK/AKT pathway, thus delaying the development of PDAC in vitro.
FIGURE 5

M2‐EV‐miR‐365 facilitates the PDAC progression through the BTG2/FAK/AKT axis. (A) MiR‐365 and BTG2 expression in PANC‐1 and BxPC‐3 cells measured by RT‐qPCR. (B) Protein levels of BTG2 and FAK/AKT pathway‐related proteins in PANC‐1 and BxPC‐3 cells examined by Western blot assay. (C) Proliferation of PANC‐1 and BxPC‐3 cells assessed by CCK‐8. (D) Invasion of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (E) Migration of PANC‐1 and BxPC‐3 cells from different groups was examined by Transwell (200×, scale bar = 50 µm). (F) Protein level of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in different groups measured by Western blot assay. (G) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) determined by Western blot assay. * in comparison to oe‐NC, P < 0.05. # in comparison to M2‐EVs + oe‐NC, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

M2‐EV‐miR‐365 facilitates the PDAC progression through the BTG2/FAK/AKT axis. (A) MiR‐365 and BTG2 expression in PANC‐1 and BxPC‐3 cells measured by RT‐qPCR. (B) Protein levels of BTG2 and FAK/AKT pathway‐related proteins in PANC‐1 and BxPC‐3 cells examined by Western blot assay. (C) Proliferation of PANC‐1 and BxPC‐3 cells assessed by CCK‐8. (D) Invasion of PANC‐1 and BxPC‐3 cells from different groups examined by Transwell (200×, scale bar = 50 µm). (E) Migration of PANC‐1 and BxPC‐3 cells from different groups was examined by Transwell (200×, scale bar = 50 µm). (F) Protein level of proliferation‐related factors (Ki67, PCNA), apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in different groups measured by Western blot assay. (G) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) determined by Western blot assay. * in comparison to oe‐NC, P < 0.05. # in comparison to M2‐EVs + oe‐NC, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times

Suppression of M2‐EV‐miR‐365 regulates the BTG2/GAK/AKT axis and limits tumour growth in nude mice

To demonstrate whether M2‐EVs modulate PDAC progression in vivo, we inoculated PANC‐1 cells to nude mice subcutaneously to form tumours and injected M2‐EVs or EVs from the M2 macrophages miR‐365 antagomiR or NC antagomiR into tumour‐bearing mice, with PBS as control. 4‐week tumour growth curve showed, as compared to PBS group, increased tumour size (Figure 6A), and elevated tumour weight (Figure 6B) was detected in the M2‐EVs, M2‐EVs + NC antagomiR and M2‐EVs + miR‐365 antagomiR groups. In contrast to M2‐EVs + NC antagomiR group, suppressed tumour growth was found in the M2‐EVs + miR‐365 antagomiR group (P < 0.05, Figure 6A and B). These data demonstrated that inhibiting M2‐EVs‐miR‐365 constraints PDAC growth in vivo.
FIGURE 6

Suppression of M2‐EV‐miR‐365 restrains tumour growth in nude mice through the BTG2/FAK/AKT axis. (A) Tumour volume growth curve in nude mice. (B) Representative images of dissected tumours from nude mice and tumour weight from different groups. (C) miR‐365 expression in serum‐derived EVs and mouse tumour tissues measured by RT‐qPCR, cel‐miR‐39 as internal control. (D) Protein level of BTG2 and FAK/AKT ratio in mouse tumour tissues measured by Western blot assay. (E) Protein level of proliferation‐related factors (Ki67, PCNA), and apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in mouse tumour tissues measured by Western blot assay. (F) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in mouse tumour tissues determined by Western blot assay. * in comparison to PBS, P < 0.05. # in comparison to M2‐EVs‐NC antagomiR, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times. The dose of EV in each single experiment was 1 μg

Suppression of M2‐EV‐miR‐365 restrains tumour growth in nude mice through the BTG2/FAK/AKT axis. (A) Tumour volume growth curve in nude mice. (B) Representative images of dissected tumours from nude mice and tumour weight from different groups. (C) miR‐365 expression in serum‐derived EVs and mouse tumour tissues measured by RT‐qPCR, cel‐miR‐39 as internal control. (D) Protein level of BTG2 and FAK/AKT ratio in mouse tumour tissues measured by Western blot assay. (E) Protein level of proliferation‐related factors (Ki67, PCNA), and apoptotic factors (Bax, Bcl‐2, cleaved caspase‐3) in mouse tumour tissues measured by Western blot assay. (F) Protein levels of EMT‐related factors (Vimentin, Snail, E‐cadherin) in mouse tumour tissues determined by Western blot assay. * in comparison to PBS, P < 0.05. # in comparison to M2‐EVs‐NC antagomiR, P < 0.05. NS, non‐statistically significant. Measurement data were expressed as mean ± SD. Data between two groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one‐way ANOVA. Experiments were performed 3 times. The dose of EV in each single experiment was 1 μg Furthermore, we found miR‐365 in the serum‐derived EVs and mouse tumour tissues were elevated in all groups except PBS group (P < 0.05). miR‐365 level was comparable between M2‐EVs + NC antagomir and M2‐EVs + miR‐365 antagomiR groups (P > 0.05, Figure 6C). As compared to PBS, M2‐EVs, M2‐EVs + NC antagomiR and M2‐EVs + miR‐365 antagomiR groups exhibited decreased BTG2 and hyperactivated FAK/AKT pathway, increased Ki‐67, PCNA, Bcl‐2, Vimentin, and Snail, and decreased Bax, cleaved caspase3 and E‐cadherin in protein level (P < 0.05); The M2‐EVs + miR‐365 antagomiR group displayed augmented BTG2 expression, reduced FAK/AKT, Ki‐67, PCNA, Bcl‐2, Vimentin, and Snail levels, and enhanced Bax, cleaved caspase3, E‐cadherin levels vs the M2‐EVs + NC antagomiR group (P < 0.05, Figure 6D‐F). These data show that inhibiting M2‐EVs‐miR‐365 increases BTG2 expression in target cells, contributing to decreased PDAC growth in vivo.

DISCUSSION

TAM are the most prominent infiltrated immune cells in PDAC, yet the crosstalk between the two remains not well understood, especially how macrophages modulate the progression of the tumour. In this study, we demonstrated that M2 macrophages secreted the EVs carrying miR‐365 that directly disrupted BTG2 expression in PDAC by binding to the 3′‐UTR region of BTG2 mRNA. Moreover, the consequent down‐regulation of BTG2 activated the FAK/AKT pathway, and strongly promoted the proliferative, migratory and invading properties of PDAC cells, both in vitro and in vivo (Figure 7).
FIGURE 7

Schematic map of the miR‐365/BTG2/FAK/AKT axis involved in the function of M2 macrophage‐secreted EVs in PDAC progression

Schematic map of the miR‐365/BTG2/FAK/AKT axis involved in the function of M2 macrophage‐secreted EVs in PDAC progression Initially, our study showed that miR‐365 was highly expressed in M2‐EVs. Consistently, previous report has shown that macrophage‐derived EVs carry miR‐365, which induces pancreatic cancer drug resistance and progression. Meanwhile, it has also been shown that miR‐365 is highly expressed in PDAC, in which miR‐365 is associated with tumour response. , Hence, we speculated that M2‐EVs carried miR‐365 and transmitted miR‐365 into PDAC cells to facilitate the cancer progression, which was confirmed in the M2/PDAC cell co‐culture system. BTG2, a potential target of miR‐365, is relatively highly expressed in all different tissues, except liver and testis. A recent study showed that the expression level of BTG2 was significantly decreased in breast cancer cell lines, and low BTG2 expression was correlated with tumour metastasis, recurrence and poor survival in breast cancer. Another study reported that BTG2 was down‐regulated in renal cell carcinoma. The gain‐of‐function experiments validated the anti‐tumour action of BTG2 in PDAC by impeding the malignant behaviours of PDAC cells. It is generally believed that BTG2 does not directly bind to DNA. BTG2 in cycling cells results in the accumulation of hypophosphorylated, growth‐inhibitory form of retinoblastoma protein (Rb) and induces cell cycle arrest through interrupting DNA synthesis. Non‐phosphorylated Rb binds to the transcriptional factor E2F family protein, prohibiting transcription of gene required for cell growth. Our study showed that BTG2 repressed the phosphorylation levels of FAK and AKT, contributing to the activation of FAK/AKT pathway. In line with our study, a previous report shows that BTG2 inhibits osteosarcoma cell growth by dampening the AKT pathway. It has been known that in liver cancer, knocking down BTG2 activates the FAK/AKT pathway and promotes the cancer development. FAK/AKT pathway is activated in PDAC and contributes to uncontrolled progression. , , , BTG2 primarily localizes to the nucleus. It is still not understood how BTG2 promotes AKT phosphorylation. Whether the target genes of BTG2 include kinase activating AKT or surface receptors stimulating PI3 Kinase remains not elucidated. Further studies on the protein level of protein kinase B or p85/p110 would be interesting. We demonstrated that miR‐365 was a negative regulator of BTG2 in PDAC using luciferase experiment. miR‐365 sequence is extremely conserved across species. The putative binding site of miR‐365 to the BTG2 3′‐UTR is broadly conserved among vertebrates. The known targets of BTG2 include IL‐6 and histone deacetylase 4. Yet we do not know the expression of miR‐365 by PDAC itself. Our study also brings up an intriguing question that if there are other miRNAs present in PDAC that regulates cancer progression; if so, they could be great targets for therapy. We showed in the subsequent experiments that miR‐365 from M2 macrophages‐derived EVs indeed targeted and negatively regulated the expression of BTG2 in tumours. This is also validated in vivo by nude mice tumour growth experiment. As BTG2 overexpression could reverse the pro‐tumorigenic effect of M2‐EVs in vitro, our data confirmed that M2‐EVs carrying miR‐365 contributed to PDAC progression through down‐regulation of BTG2. We are currently trying to understand if primary M2 macrophage carries same cargos as THP‐1 differentiated macrophages. The suppression efficiency of BTG2 by EVs‐miR‐365 in in vivo model is high, which suggests that EVs are primarily taken by cancer cells. This might due to specific property of M2 macrophage‐derived EVs. Therefore, future study will focus on characterizing the cargos or surface proteins of M2‐EVs which might be used as drug delivery vehicles for cancer therapy. In all, these results collectively demonstrate the pro‐cancerous function of M2 macrophage‐derived EVs both in vitro and in vivo. The crosstalk between immune cells and cancer cells is diverse, and further studies need to be done to understand the whole picture of cancer pathogenesis.

CONFLICTS OF INTEREST

The authors declare no conflicts of interests.

AUTHOR CONTRIBUTIONS

Xin Li: Conceptualization, Formal analysis, Methodology, Writing‐original draft and Writing‐review and editing; Hao Xu: Data curation, Formal analysis, Methodology, Writing‐original draft and Writing‐review and editing; Jianfeng Yi: Data curation, Investigation, Writing‐original draft and Writing‐review and editing; Chunlu Don: Conceptualization, Investigation, Software and Writing‐review and editing; Hui Zhang: Investigation, Software and Writing‐review and editing; Zhengfeng Wang: Software, Supervision and Writing‐review and editing; Long Miao: Validation, Visualization and Writing‐review and editing; Wence Zhou: Project administration, Visualization and Writing‐review and editing.
  38 in total

1.  Adipose Tissue Macrophage-Derived Exosomal miRNAs Can Modulate In Vivo and In Vitro Insulin Sensitivity.

Authors:  Wei Ying; Matthew Riopel; Gautam Bandyopadhyay; Yi Dong; Amanda Birmingham; Jong Bae Seo; Jachelle M Ofrecio; Joshua Wollam; Angelina Hernandez-Carretero; Wenxian Fu; Pingping Li; Jerrold M Olefsky
Journal:  Cell       Date:  2017-09-21       Impact factor: 41.582

2.  Macrophage-derived exosomes induce inflammatory factors in endothelial cells under hypertensive conditions.

Authors:  Mayuko Osada-Oka; Masayuki Shiota; Yasukatsu Izumi; Masaki Nishiyama; Masako Tanaka; Takehiro Yamaguchi; Emi Sakurai; Katsuyuki Miura; Hiroshi Iwao
Journal:  Hypertens Res       Date:  2016-11-24       Impact factor: 3.872

3.  BTG2 inhibits the proliferation and metastasis of osteosarcoma cells by suppressing the PI3K/AKT pathway.

Authors:  Yi-Jin Li; Bao-Kang Dong; Meng Fan; Wen-Xue Jiang
Journal:  Int J Clin Exp Pathol       Date:  2015-10-01

4.  MiR-365: a mechanosensitive microRNA stimulates chondrocyte differentiation through targeting histone deacetylase 4.

Authors:  Ying-Jie Guan; Xu Yang; Lei Wei; Qian Chen
Journal:  FASEB J       Date:  2011-08-19       Impact factor: 5.191

5.  The role of photobiomodulation on gene expression of cell adhesion molecules in diabetic wounded fibroblasts in vitro.

Authors:  Sandra M Ayuk; Heidi Abrahamse; Nicolette N Houreld
Journal:  J Photochem Photobiol B       Date:  2016-06-01       Impact factor: 6.252

6.  Transfer of miRNA in Macrophage-Derived Exosomes Induces Drug Resistance in Pancreatic Adenocarcinoma.

Authors:  Yoav Binenbaum; Eran Fridman; Zvi Yaari; Neta Milman; Avi Schroeder; Gil Ben David; Tomer Shlomi; Ziv Gil
Journal:  Cancer Res       Date:  2018-07-24       Impact factor: 12.701

7.  MUC13 interaction with receptor tyrosine kinase HER2 drives pancreatic ductal adenocarcinoma progression.

Authors:  S Khan; M Sikander; M C Ebeling; A Ganju; S Kumari; M M Yallapu; B B Hafeez; T Ise; S Nagata; N Zafar; S W Behrman; J Y Wan; H M Ghimire; P Sahay; P Pradhan; S C Chauhan; M Jaggi
Journal:  Oncogene       Date:  2016-06-20       Impact factor: 9.867

8.  Stability of Circulating Exosomal miRNAs in Healthy Subjects.

Authors:  David Sanz-Rubio; Inmaculada Martin-Burriel; Ana Gil; Pablo Cubero; Marta Forner; Abdelnaby Khalyfa; Jose M Marin
Journal:  Sci Rep       Date:  2018-07-09       Impact factor: 4.379

9.  CD163+ M2c-like macrophages predominate in renal biopsies from patients with lupus nephritis.

Authors:  Gregor Olmes; Maike Büttner-Herold; Fulvia Ferrazzi; Luitpold Distel; Kerstin Amann; Christoph Daniel
Journal:  Arthritis Res Ther       Date:  2016-04-18       Impact factor: 5.156

10.  MUC16 contributes to the metastasis of pancreatic ductal adenocarcinoma through focal adhesion mediated signaling mechanism.

Authors:  Sakthivel Muniyan; Dhanya Haridas; Seema Chugh; Satyanarayana Rachagani; Imayavaramban Lakshmanan; Suprit Gupta; Parthasarathy Seshacharyulu; Lynette M Smith; Moorthy P Ponnusamy; Surinder K Batra
Journal:  Genes Cancer       Date:  2016-03
View more
  8 in total

1.  An Eleven-microRNA Signature Related to Tumor-Associated Macrophages Predicts Prognosis of Breast Cancer.

Authors:  Sharmilla Devi Jayasingam; Marimuthu Citartan; Anani Aila Mat Zin; Timofey S Rozhdestvensky; Thean-Hock Tang; Ewe Seng Ch'ng
Journal:  Int J Mol Sci       Date:  2022-06-23       Impact factor: 6.208

Review 2.  Extracellular vesicle-mediated crosstalk between pancreatic cancer and stromal cells in the tumor microenvironment.

Authors:  Ying Li; Wenjing Zhao; Yanli Wang; Haiyan Wang; Shanglong Liu
Journal:  J Nanobiotechnology       Date:  2022-05-02       Impact factor: 9.429

3.  miR-365 secreted from M2 Macrophage-derived extracellular vesicles promotes pancreatic ductal adenocarcinoma progression through the BTG2/FAK/AKT axis.

Authors:  Xin Li; Hao Xu; Jianfeng Yi; Chunlu Dong; Hui Zhang; Zhengfeng Wang; Long Miao; Wence Zhou
Journal:  J Cell Mol Med       Date:  2021-04-03       Impact factor: 5.310

Review 4.  Extracellular vesicles in pancreatic cancer progression and therapies.

Authors:  Chao-Hui Chang; Siim Pauklin
Journal:  Cell Death Dis       Date:  2021-10-20       Impact factor: 8.469

5.  BTG2 Serves as a Potential Prognostic Marker and Correlates with Immune Infiltration in Lung Adenocarcinoma.

Authors:  Xiao Zhen Zhang; Mao Jian Chen; Ping Ming Fan; Wei Jiang; Shi Xiong Liang
Journal:  Int J Gen Med       Date:  2022-03-08

6.  High Blood Concentration of Leukocyte-Derived Extracellular Vesicles Is Predictive of Favorable Clinical Outcomes in Patients with Pancreatic Cancer: Results from a Multicenter Prospective Study.

Authors:  Davide Brocco; Domenico De Bellis; Pietro Di Marino; Pasquale Simeone; Antonino Grassadonia; Michele De Tursi; Tommaso Grottola; Fabio Francesco Di Mola; Patrizia Di Gregorio; Barbara Zappacosta; Antonio Angelone; Laura De Lellis; Serena Veschi; Rosalba Florio; Simone De Fabritiis; Fabio Verginelli; Marco Marchisio; Marta Caporale; Dimitri Luisi; Pierluigi Di Sebastiano; Nicola Tinari; Alessandro Cama; Paola Lanuti
Journal:  Cancers (Basel)       Date:  2022-09-29       Impact factor: 6.575

7.  Pro-tumoral functions of tumor-associated macrophage EV-miRNA.

Authors:  Alexander Cocks; Filippo Del Vecchio; Verena Martinez-Rodriguez; Monique Schukking; Muller Fabbri
Journal:  Semin Cancer Biol       Date:  2021-08-08       Impact factor: 15.707

Review 8.  Anti-Cancer Role and Therapeutic Potential of Extracellular Vesicles.

Authors:  Naoomi Tominaga
Journal:  Cancers (Basel)       Date:  2021-12-15       Impact factor: 6.639

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.