Literature DB >> 33811025

A LysR Family Transcriptional Regulator Modulates Burkholderia cenocepacia Biofilm Formation and Protease Production.

Kai Wang1, Xia Li2, Chunxi Yang3, Shihao Song1,2, Chaoyu Cui4, Xiaofan Zhou1, Yinyue Deng2.   

Abstract

Quorum-sensing (QS) signals are widely employed by bacteria to regulate biological functions in response to cell densities. Previous studies showed that Burkholderia cenocepacia mostly utilizes two types of QS systems, including the N-acylhomoserine lactone (AHL) and cis-2-dodecenoic acid (BDSF) systems, to regulate biological functions. We demonstrated here that a LysR family transcriptional regulator, Bcal3178, controls the QS-regulated phenotypes, including biofilm formation and protease production, in B. cenocepacia H111. Expression of Bcal3178 at the transcriptional level was obviously downregulated in both the AHL-deficient and BDSF-deficient mutant strains compared to the wild-type H111 strain. It was further identified that Bcal3178 regulated target gene expression by directly binding to the promoter DNA regions. We also revealed that Bcal3178 was directly controlled by the AHL system regulator CepR. These results show that Bcal3178 is a new downstream component of the QS signaling network that modulates a subset of genes and functions coregulated by the AHL and BDSF QS systems in B. cenocepacia. IMPORTANCE Burkholderia cenocepacia is an important opportunistic pathogen in humans that utilizes the BDSF and AHL quorum-sensing (QS) systems to regulate biological functions and virulence. We demonstrated here that a new downstream regulator, Bcal3178 of the QS signaling network, controls biofilm formation and protease production. Bcal3178 is a LysR family transcriptional regulator modulated by both the BDSF and AHL QS systems. Furthermore, Bcal3178 controls many target genes, which are regulated by the QS systems in B. cenocepacia. Collectively, our findings depict a novel molecular mechanism with which QS systems regulate some target gene expression and biological functions by modulating the expression level of a LysR family transcriptional regulator in B. cenocepacia.

Entities:  

Keywords:  Burkholderia cenocepacia; LysR family transcriptional regulator; biofilm; protease; quorum sensing

Year:  2021        PMID: 33811025      PMCID: PMC8174753          DOI: 10.1128/AEM.00202-21

Source DB:  PubMed          Journal:  Appl Environ Microbiol        ISSN: 0099-2240            Impact factor:   4.792


INTRODUCTION

Quorum sensing (QS) is a cell-cell communication mechanism used by various bacteria (1–3). The first, most characterized QS system is the AHL-type system, which usually consists of two components, LuxI and LuxR proteins. The LuxI protein is an autoinducer synthetase that synthesizes the chemical signaling molecule N-acyl homoserine lactone (AHL). The LuxR protein is a cytoplasmic autoinducer receptor that contains a DNA-binding transcriptional activation domain. Autoinducers (AHLs) diffuse into the extracellular matrix and accumulate with the increasing number of cells. When the density of the signal reaches a threshold, the signal molecule will bind to the LuxR protein, and then the activated LuxR protein stimulates the expression of target genes (4–7). In addition to AHL-type signals, there are many other kinds of QS signals. One of them is the diffusible signal factor (DSF)-type signal, which was first identified in Xanthomonas campestris (8, 9). Burkholderia cenocepacia is a major opportunistic pathogen that causes infection in cystic fibrosis and immunocompromised patients (10, 11). It can produce biofilm and numerous virulence factors, including lipopolysaccharide, exopolysaccharide, protease, and toxin. B. cenocepacia possesses the CepIR QS system, which is a LuxIR-type QS system (12). CepI synthesizes two different AHL signals; one is N-octanoyl homoserine lactone (C8-HSL, OHL), and the other one is N-hexanoyl homoserine lactone (C6-HSL, HHL). CepR is a homolog of the LuxR protein; it contains two domains, the signal binding domain and the transcriptional activation domain, and uses the same regulatory mechanism as other LuxR-type regulators to control target gene expression (12–16). Furthermore, a fatty acid signal molecule synthesized by B. cenocepacia was identified as cis-2-dodecenoic acid, which was also called Burkholderia diffusible signal factor (BDSF) (17). Previous study showed that BDSF signal is biosynthesized by B. cenocepacia RpfF (RpfFBC). It accumulates in a cell density-dependent manner and regulates the production of various virulence factors. With the bacterial cells gradually accumulating to a high density, BDSF signals bind to RpfR to enhance the phosphodiesterase activity of RpfR and decrease the intracellular cyclic diguanosine monophosphate (c-di-GMP) level, and then they increase the ability of the RpfR-GtrR complex to bind to the promoter DNA of target genes (18). The AHL- and BDSF-type QS systems coordinate to control virulence and physiological functions in B. cenocepacia. In addition, BDSF was also revealed to positively regulate AHL signal production (19). LysR-type transcriptional regulators (LTTRs) are the most widespread transcriptional regulators in prokaryotes (20). Structures of this type of regulator are conserved and usually contain an N-terminal DNA-binding helix-turn-helix motif and a C-terminal coinducer-binding domain. The coinducing agents are mostly metabolic intermediate substances (21, 22). Increasing evidence suggests that LTTR ShvR controls QS, protease, type II secretion, and colony morphology in B. cenocepacia (23, 24). In this study, we demonstrated that a novel LysR family transcriptional regulator, Bcal3178, was positively controlled by both the AHL and BDSF systems. We also uncovered the regulatory mechanism of Bcal3178 to modulate the phenotypes and QS-regulated target genes in B. cenocepacia H111. In general, our results identify a novel downstream component of the QS systems that help us to further understand the QS signaling hierarchy in B. cenocepacia.

RESULTS

Bcal3178 controls QS-regulated phenotypes in B. cenocepacia.

To further investigate the regulatory mechanism, especially the downstream signaling pathways, of the BDSF QS system, we constructed a library of Tn5 random insertion mutants. The bclACB operon is simultaneously regulated by the BDSF and CepIR QS systems in B. cenocepacia H111 (25, 26). Taking advantage of this feature, the bclACB operon promoter lacZ was fused to a plasmid and transferred into the wild-type B. cenocepacia H111 strain. We screened and identified about 40,000 colonies of the mutant library of B. cenocepacia H111, and the light blue colonies grown in LB agar medium (5 g yeast extract, 10 g tryptone, 10 g NaCl, and 15 g agar per liter) supplemented with X-Gal (5-bromo-4-chloro-3-indolyl β-d-galactopyranoside) were picked out for the identification of insertion sites. Among those identified genes (see Table S1 in the supplemental material), there was a LysR family transcriptional regulator (Bcal3178; I35_RS03450) whose homologues are widely present in many bacteria and play an important role in various physiological activities (27, 28). However, the functions and regulatory mechanisms of Bcal3178 are unclear in B. cenocepacia. Domain structure analysis of Bcal3178 by using the SMART program (http://smart.embl-heidelberg.de/) shows that it has an N-terminal DNA-binding helix-turn-helix motif and a C-terminal coinducer-binding domain (Fig. 1A). In-frame deletion of Bcal3178 caused a significant downregulation of biofilm formation and protease activity, which are the phenotypes controlled by the two different types of QS systems in B. cenocepacia, and the complemented strain exhibited restored phenotypes (Fig. 1B and C).
FIG 1

Effects of Bcal3178 on the QS-regulated phenotypes. (A) Genomic organization and domain structure analysis of Bcal3178 in B. cenocepacia H111 (domain structure was analyzed by using the SMART program at http://smart.embl-heidelberg.de). (B and C) Effects of Bcal3178 on biofilm formation (B) and protease activity (C). The data are means ± standard deviations from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (unpaired t test).

Effects of Bcal3178 on the QS-regulated phenotypes. (A) Genomic organization and domain structure analysis of Bcal3178 in B. cenocepacia H111 (domain structure was analyzed by using the SMART program at http://smart.embl-heidelberg.de). (B and C) Effects of Bcal3178 on biofilm formation (B) and protease activity (C). The data are means ± standard deviations from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (unpaired t test).

Bcal3178 regulates the target genes by directly binding to the promoter.

As an insertion mutation of Bcal3178 resulted in a light blue colony with a bclACB operon promoter-lacZ fusion plasmid, we supposed that Bcal3178 controls the expression level of the bclACB operon. To confirm this speculation, we constructed the PbclACB-lacZ reporter system in the Bcal3178 deletion mutant strain. The expression of bclACB in the Bcal3178 deletion mutant was remarkably lower than that in the wild-type B. cenocepacia H111 strain, as determined by measuring the β-galactosidase activity, suggesting that Bcal3178 positively regulates the expression of bclACB (Fig. 2A). To further study whether transcriptional regulation of bclACB was achieved by direct binding of Bcal3178 to the promoter, we continued to perform electrophoretic mobility shift analyses (EMSAs) to identify the regulatory mechanism of Bcal3178. A 506-bp DNA fragment of the bclACB promoter was obtained by PCR amplification for use as the probe. Bcal3178 is composed of 327 amino acids and was purified using affinity chromatography (Fig. 2B). The EMSAs showed that the complex of Bcal3178 and bclACB probe migrated slower than the unbound probe, and the bclACB promoter probe that bound to Bcal3178 significantly increased with increasing amounts of Bcal3178 protein (Fig. 2C). Moreover, the amount of labeled probe bound to Bcal3178 decreased in the presence of unlabeled probe (Fig. 2C).
FIG 2

Effects of Bcal3178 on a QS-controlled target gene. (A) The effects of Bcal3178 on the expression level of bclACB were measured by assessing β-galactosidase activity of the bclACB-lacZ transcriptional fusion in the B. cenocepacia H111 wild-type strain (●) and Bcal3178 deletion mutant strain (■). (B) SDS-PAGE of the GST-Bcal3178 protein. (C) EMSA detection of Bcal3178 binding to the promoter DNA of bclACB.

Effects of Bcal3178 on a QS-controlled target gene. (A) The effects of Bcal3178 on the expression level of bclACB were measured by assessing β-galactosidase activity of the bclACB-lacZ transcriptional fusion in the B. cenocepacia H111 wild-type strain (●) and Bcal3178 deletion mutant strain (■). (B) SDS-PAGE of the GST-Bcal3178 protein. (C) EMSA detection of Bcal3178 binding to the promoter DNA of bclACB.

Transcriptional expression of Bcal3178 is positively regulated by both the BDSF and AHL QS systems.

As bclACB operon expression, biofilm formation, and protease activity are regulated by both the BDSF and AHL systems in B. cenocepacia H111, we continued to investigate the relationship between Bcal3178 and the QS systems. We first measured the expression levels of Bcal3178 in the wild-type H111, BDSF-deficient mutant (rpfF deletion mutant), rpfR deletion mutant, AHL-deficient mutant (cepI deletion mutant), and cepR deletion mutant strains by using quantitative reverse transcription-PCR (RT-PCR) analysis. The results showed that the expression levels of Bcal3178 of the mutant strains were lower than that of the wild-type H111 strain (Fig. 3A). We then constructed the Bcal3178-lacZ reporter system in the wild-type H111, rpfF mutant, and cepI mutant strains. The β-galactosidase activity assays revealed that Bcal3178 expression levels were downregulated in both rpfF and cepI mutant strains, and the expression levels were restored with addition of 20 μM BDSF and AHL (OHL), respectively (Fig. 3B).
FIG 3

Effects of QS systems on the expression of Bcal3178. (A) The expression levels of Bcal3178 in the wild-type strain and ΔrpfF, ΔrpfR, ΔcepI, and ΔcepR mutant strains were analyzed by using qRT-PCR. The expression level of Bcal3178 in the wild-type strain was arbitrarily defined as 100% and used to normalize the expression ratios of Bcal3178 in the mutant strains. (B) The expression levels of Bcal3178 in the wild-type strain and QS signal-deficient mutant strains were measured by assessing β-galactosidase activity of the Bcal3178-lacZ transcriptional fusions. BDSF and AHL (OHL) were added at a final concentration of 20 μM. The data are means ± standard deviations from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (unpaired t test).

Effects of QS systems on the expression of Bcal3178. (A) The expression levels of Bcal3178 in the wild-type strain and ΔrpfF, ΔrpfR, ΔcepI, and ΔcepR mutant strains were analyzed by using qRT-PCR. The expression level of Bcal3178 in the wild-type strain was arbitrarily defined as 100% and used to normalize the expression ratios of Bcal3178 in the mutant strains. (B) The expression levels of Bcal3178 in the wild-type strain and QS signal-deficient mutant strains were measured by assessing β-galactosidase activity of the Bcal3178-lacZ transcriptional fusions. BDSF and AHL (OHL) were added at a final concentration of 20 μM. The data are means ± standard deviations from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (unpaired t test).

Bcal3178 is a downstream component of the BDSF and AHL QS systems.

Based on the facts that Bcal3178 controlled QS-regulated phenotypes and its expression was modulated by QS systems at the transcriptional level, we then expressed Bcal3178 in trans in the rpfF mutant and cepI mutant strains. It was shown that in trans, the expression of Bcal3178 in the two mutant strains increased biofilm formation to 75% and 87% of the wild-type strain level (Fig. 4A), and the in trans expression of Bcal3178 in the rpfF mutant and cepI mutant strains can almost fully restore protease production to the wild-type strain level (Fig. 4B). These results suggested that Bcal3178 is a downstream component of the QS signaling network in B. cenocepacia.
FIG 4

Complementation of the QS signal-deficient mutants with Bcal3178. In trans expression of Bcal3178 complemented biofilm formation (A) and protease production (B) in the BDSF-deficient ΔrpfF mutant and AHL-deficient ΔcepI mutant. The data are means ± standard deviations from three independent experiments. ***, P < 0.001 (unpaired t test).

Complementation of the QS signal-deficient mutants with Bcal3178. In trans expression of Bcal3178 complemented biofilm formation (A) and protease production (B) in the BDSF-deficient ΔrpfF mutant and AHL-deficient ΔcepI mutant. The data are means ± standard deviations from three independent experiments. ***, P < 0.001 (unpaired t test).

CepR regulates Bcal3178 expression by directly binding to the promoter.

To study how the QS systems control Bcal3178, we investigated whether transcriptional regulation of Bcal3178 is achieved by direct binding of regulators of QS systems to the target gene promoter. Since GtrR and CepR are the regulators of the BDSF and AHL systems, respectively, in B. cenocepacia, we used EMSAs to test whether GtrR and CepR can bind the Bcal3178 promoter. A 223-bp DNA fragment of the Bcal3178 promoter was obtained by PCR amplification for use as the probe. CepR and GtrR, which are composed of 239 and 463 amino acids, respectively, were purified by affinity chromatography (Fig. 5A and Fig. S1A). It was shown that GtrR did not bind to the probe (Fig. S1B), and the expression levels of Bcal3178 showed no detectable difference in the wild-type and gtrR deletion mutant strains (Fig. S1C and D). CepR, which was purified in the presence of OHL signal, formed a stable DNA-protein complex with the Bcal3178 promoter DNA fragment, and the migration rate of the complex was slower than that of the unbound probe (Fig. 5B). The amount of labeled probe that bound to CepR increased with increasing amounts of CepR and decreased in the presence of both 25- and 50-fold unlabeled probe (Fig. 5B). Moreover, the binding of CepR to the Bcal3178 promoter probes was enhanced in the presence of OHL signal (Fig. 5C). These results suggested that CepR is responsible for modulating Bcal3178 expression. Intriguingly, it was reported that CepR usually binds to the sequence called lux-box, which contains the conserved sequence NCTGTNNNGATCNNNCAGNN (12, 15, 27). However, we analyzed the promoter sequence of Bcal3178 and found no lux-box but only a similar sequence, TTCGATACGAGAGCGAAC, in the promoter of Bcal3178. Deletion of this fragment from the promoter region of Bcal3178 did not affect the binding of CepR to the promoter of Bcal3178 (Fig. S2), suggesting that there is a new binding site for CepR in the promoter region of Bcal3178.
FIG 5

Analysis of the binding between CepR and Bcal3178 promoters. (A) SDS-PAGE of the CepR protein. (B) EMSA detection of in vitro binding of CepR to the promoter of Bcal3178, in which a biotin-labeled Bcal3178 promoter DNA probe was used for protein-binding assays. (C) EMSA detection of in vitro binding of CepR to the promoter of Bcal3178 with the addition of different amounts of AHL (OHL).

Analysis of the binding between CepR and Bcal3178 promoters. (A) SDS-PAGE of the CepR protein. (B) EMSA detection of in vitro binding of CepR to the promoter of Bcal3178, in which a biotin-labeled Bcal3178 promoter DNA probe was used for protein-binding assays. (C) EMSA detection of in vitro binding of CepR to the promoter of Bcal3178 with the addition of different amounts of AHL (OHL).

Bcal3178 controls a wide range of QS-regulated genes.

The BDSF and AHL QS systems control numerous genes and many physiological functions in B. cenocepacia (26). As Bcal3178 is a downstream component of the QS signaling network, we continued to test whether Bcal3178 controls the genes regulated by the BDSF and AHL QS systems (26). Quantitative real-time fluorescence PCR (qRT-PCR) results showed that at least 25 genes were decreased in the rpfF, cepI, cepR, and Bcal3178 mutant strains compared with their expression levels in the wild-type H111 strain (Fig. 6). These differentially expressed genes are involved in a range of biological functions (Table S2). However, the expression levels of rpfF and cepI showed no detectable differences between the wild-type and Bcal3178 mutant strains (Fig. S3). These findings suggested that Bcal3178 controls at least a subset of target genes of the QS systems.
FIG 6

qRT-PCR analysis of the genes that showed differential expression between the ΔrpfF, ΔcepI, ΔcepR, and ΔBcal3178 mutant strains and the wild-type strain. The data are based on three independent experiments, and error bars represent standard deviations.

qRT-PCR analysis of the genes that showed differential expression between the ΔrpfF, ΔcepI, ΔcepR, and ΔBcal3178 mutant strains and the wild-type strain. The data are based on three independent experiments, and error bars represent standard deviations.

DISCUSSION

In this study, we identified that a LysR family transcriptional regulator, Bcal3178, is a new global transcriptional regulator controlling various gene expression and biological functions (Fig. 1, 2, and 6). Intriguingly, both of these genes and biological functions are coregulated by the BDSF and AHL systems in B. cenocepacia. Moreover, the expression levels of Bcal3178 were significantly downregulated in the QS-deficient mutant strains compared to the wild-type B. cenocepacia H111 strain (Fig. 3), while Bcal3178 exhibited no detectable effect on the expression levels of BDSF or AHL signal synthase-encoding genes (Fig. S3). Previous studies showed that another LysR family transcriptional regulator, ShvR, was controlled by the AHL QS system in B. cenocepacia K56-2 (23, 24). ShvR also influenced the production of a set of virulence factors and AHL signal production in B. cenocepacia K56-2 (23, 24), suggesting the distinguishing roles of Bcal3178 from other LysR family transcriptional regulators in B. cenocepacia. It was already demonstrated that the AHL and BDSF QS systems are not completely independent and form a signaling network (19). The two QS systems coregulate various genes and phenotypes. BapA (encoded by BCAM2143) is a large surface protein that plays a vital role in biofilm formation (29, 30). A cluster of three genes, bclACB (BCAM0184 to -0186), encode lectins, which are also needed for biofilm structural development (26, 29). ZmpB is a zinc metalloprotease that is a vital component of proteolytic activity (31). All of these genes were significantly downregulated in both the BDSF-deficient and AHL-deficient mutant strains, as previously reported (26), and were downregulated in the Bcal3178 deletion mutant strain compared to the wild-type H111 strain (Fig. 6). In addition, the deletion of Bcal3178 impaired biofilm formation and protease production, while in trans expression of Bcal3178 restored the biofilm formation and protease production of both the QS signal-deficient mutants and the Bcal3178 deletion mutant (Fig. 1 and 4). Moreover, the substantially overlapping genes controlled by both the BDSF and AHL systems were regulated by Bcal3178 (Fig. 6). Taken together, these findings support that Bcal3178 is a novel key downstream component of the QS signaling network in B. cenocepacia (Fig. 7).
FIG 7

Schematic diagram of the QS signaling network in B. cenocepacia. The two-component system RqpSR positively regulates expression of the cepI and rpfF genes, which are required for the synthesis of the BDSF and AHL signals, respectively. Binding of BDSF to the receptor RpfR substantially increases its c-di-GMP degradation activity and results in a reduced intracellular c-di-GMP level and, consequently, affects cepI transcriptional expression. CepR, activated by AHL signals, directly binds to the promoter of Bcal3178 and enhances the expression of Bcal3178, which finally controls some QS-regulated target gene expression and biological functions. Solid arrows indicate regulation or signal transduction.

Schematic diagram of the QS signaling network in B. cenocepacia. The two-component system RqpSR positively regulates expression of the cepI and rpfF genes, which are required for the synthesis of the BDSF and AHL signals, respectively. Binding of BDSF to the receptor RpfR substantially increases its c-di-GMP degradation activity and results in a reduced intracellular c-di-GMP level and, consequently, affects cepI transcriptional expression. CepR, activated by AHL signals, directly binds to the promoter of Bcal3178 and enhances the expression of Bcal3178, which finally controls some QS-regulated target gene expression and biological functions. Solid arrows indicate regulation or signal transduction. Several previous reports showed that LTTR was controlled by the AHL-dependent QS system, but the regulatory mechanism is unclear (23, 27). In this study, we discovered that CepR, the receptor of the AHL system, directly bound to the promoter of Bcal3178, and OHL signal enhanced the binding activity (Fig. 5B and C). From these results, we can propose a new regulatory mechanism in which the AHL signals accumulate to the threshold and bind to CepR, and then the activated CepR regulates Bcal3178 by directly binding to the promoter of Bcal3178, thereby controlling target gene expression as well as biofilm formation and protease phenotypes (Fig. 7). Nevertheless, a new issue is that we did not find an obvious lux-box sequence in the promoter region of Bcal3178. Furthermore, the BDSF QS system usually regulates target genes through the BDSF-RpfR-GtrR complex (18), but the EMSA result showed that there was no binding between GtrR and the Bcal3178 promoter (see Fig. S1B in the supplemental material), and the expression levels of Bcal3178 were similar in the wild-type and gtrR deletion mutant strains (Fig. S1C and D), suggesting that BDSF employs another novel regulator or the AHL QS system to regulate Bcal3178 expression, which needs to be investigated further (Fig. 7).

MATERIALS AND METHODS

Bacteria strains and growth conditions.

All the strains used in this study are listed in Table 1. B. cenocepacia H111 strains and Escherichia coli were grown at 37°C in LB medium (5 g yeast extract, 10 g tryptone, and 10 g NaCl per liter; solid medium also contains 15 g agar per liter). In this work, antibiotics were used at the following concentrations: ampicillin, 100 μg/ml; kanamycin, 100 μg/ml; gentamicin, 50 μg/ml; and tetracycline, 20 μg/ml. The chromogenic substrate X-Gal (5-bromo-4-chloro-3-indolyl β-d-galactopyranoside) was used at 40 μg/ml. Bacterial growth was monitored spectrophotometrically by measuring the optical density at a wavelength of 600 nm (OD600).
TABLE 1

Bacterial strains and plasmids used in this study

Strain or plasmidPhenotype and/or characteristicsaReference or source
B. cenocepacia
 H111Wild-type strain, genomovar III of the B. cepacia complex34
 ΔrpfFBCBDSF-minus mutant derived from H111 with rpfFBC deleted17
 ΔrpfRDeletion mutant with rpfR deleted38
 ΔcepIDeletion mutant with cepI deleted19
 ΔcepRDeletion mutant with cepR deleted12
 ΔgtrRDeletion mutant with gtrR deleted18
 ΔBcal3178Deletion mutant with Bcal3178 deletedThis study
 ΔrpfFBC(Bcal3178)ΔrpfFBC mutant harboring expression construct pBBR1-mcs2-Bcal3178This study
 ΔcepI(Bcal3178)ΔcepI mutant harboring expression construct pBBR1-mcs2-Bcal3178This study
 ΔBcal3178(Bcal3178)ΔBcal3178 mutant harboring expression construct pBBR1-mcs2-Bcal3178This study
 H111(PbclACB-lacZ)H111 harboring reporter construct PbclACB-lacZ18
 ΔBcal3178(PbclACB-lacZ)ΔBcal3178 mutant harboring reporter construct PbclACB-lacZThis study
 H111(PBcal3178-lacZ)H111 harboring reporter construct PBcal3178-lacZThis study
 ΔcepI(PBcal3178-lacZ)ΔcepI mutant harboring reporter construct PBcal3178-lacZThis study
 ΔrpfFBC(PBcal3178-lacZ)ΔrpfFBC mutant harboring reporter construct PBcal3178-lacZThis study
 ΔgtrR(PBcal3178-lacZ)ΔgtrR mutant harboring reporter construct PBcal3178-lacZThis study
E. coli
 DH5αsupE44 lacU169(80lacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 pirLaboratory collection
 BL21F ompT hsdS (rBmB) dcm+ Tetr gal(DE3) endAStratagene
Plasmids
 pBBR1-mcs2Broad-host-range cloning vector; KanrLaboratory collection
 pBBR1-mcs2-Bcal3178pBBR1-mcs2 containing Bcal3178This study
 pK18pK18, sacB+; gene replacement vector; KanrLaboratory collection
 pK18-Bcal3178pK18 containing fragments flanking Bcal3178 and Gm-resistant fragment; Kanr, GmrThis study
 pRK2013RK2 derivative, mob+ tra+ ori ColE1; Kanr39
 pME2-lacZTranscriptional level reporter vector; TetrLaboratory collection
 PbclACB-lacZpME2-lacZ containing promoter of bclACB18
 PBcal3178-lacZpME2-lacZ containing promoter of Bcal3178This study
 pGEX-6p-1Expression vector; AmprAmersham
 pGEX-Bcal3178pGEX-6p-1 containing Bcal3178This study
 pDBHT2Expression vector; KanrLaboratory collection
 pDBHT2-cepRpDBHT2 containing cepRThis study
 pDBHT2-gtrRpDBHT2 containing gtrRThis study

Kanr, Tetr, Ampr, and Gmr indicate resistance to kanamycin, tetracycline, ampicillin, and gentamicin, respectively.

Bacterial strains and plasmids used in this study Kanr, Tetr, Ampr, and Gmr indicate resistance to kanamycin, tetracycline, ampicillin, and gentamicin, respectively.

Screening and identification of mutants in which Tn5 was randomly inserted.

A mini-Tn5 transposon with a gentamicin resistance gene was transformed into B. cenocepacia H111 with the bclACB operon promoter-lacZ fusion by triparental mating. The transformants were selected on LB plates supplemented with X-Gal and gentamicin. The light blue colonies were picked out for the identification of insertion sites. High-efficiency thermal PCR was used to identify DNA flanking sequences at the insertion site of the Tn5 transposon as previously described (32).

Construction of in-frame deletion mutant and complemented strains.

B. cenocepacia H111 was used as the parental strain to construct the Bcal3178 deletion mutant by following previously described methods (17). The upstream and downstream fragments of Bcal3178 were generated by using the two PCR primer pairs listed in Table 2. For the generation of complementation, the coding region of Bcal3178 was amplified and cloned into the plasmid pBBR1-MCS2. The resulting construct was conjugated into the B. cenocepacia H111 ΔBcal3178 deletion mutant using triparental mating with pRK2013 as the mobilizing plasmid. The construct was also conjugated into B. cenocepacia H111 ΔrpfF and ΔcepI deletion mutants using the same methods (33).
TABLE 2

PCR primers used in this study

PrimerSequencea (5′–3′)
For deletion
 Bcal3178 L-FCTATGACATGATTACGAATTCCGCTCGTTGATTAGGTGGTGT
 Bcal3178L-RTTCCACGGTGTGCGTCCACTGCGCGCGTCAGCCATCGGA
 Bcal3178R-FTAAATTGTCACAACGCCGCCGGCTTGCGTATTTCTGGCC
 Bcal3178R-RCTGCCGTTCGAATCCCACGGCGCAGCGAACTGA
 Bcal3178GM-FAGTGGACGCACACCGTGGAAA
 Bcal3178GM-RGGCGGCGTTGTGACAATTT
 Bcal3178IN-FGTACTGGCGGTTCGGATAGA
 Bcal3178IN-RCACCTGAACACACGGCTGAT
 Bcal3178OUT-FTCCGCTCGTTGATTAGGTGG
 Bcal3178OUT-RATGAGGAAAGGAAGTGCCCG
For in trans expression and reporter
 Bcal3178C-FGGGGTACCATGAACCAGATTCAGACCATGCG
 Bcal3178C-RGCTCTAGATTACTGCAGGCCCGTGACG
 PbclACB-FCCGCTCGAGCGGAATCTGGCGCTTCAGGAAAGAA
 PbclACB-RCCCAAGCTTGGGGCGGTTGGATGACGTTTGAGA
 PBcal3178-FCCCAAGCTTATATTCGAATACCGCGACGG
 PBcal3178-RCCGCTCGAGATTGGACACGCCGAGATGGT
For EMSA
 EMSA-bclACB-FGATGTCGGTCCTCGGTCT
 EMSA-bclACB-RCGAACATGAATAGGGCCT
 EMSA-Bcal3178-FTGCTGCATTGCAACCTTA
 EMSA-Bcal3178-RGGCTTGCGTATTTCTGGCC
For recombinant protein
 Bcal3178-GST-FCGGGATCCATGAACCAGATTCAGACCATGCG
 Bcal3178-GST-RCGGAATTCTTACTGCAGGCCCGTGACG
 cepR-HIS-FCGGGATCCATGGAACTGCGCTGGCAG
 cepR-HIS-RCGGAATTCTCAGGGTGCTTCGATGAG
 gtrR-HIS-FCGGGATCCATGAGAAATACGCCCGCAAT
 gtrR-HIS-RCGGAATTCTTACTCGCTTTCGCGGGTCT
For RT-qPCR
 Bcal3178-FCATGCGTGTATTCGTCTGCG
 Bcal3178-RTGGATCAGCCGTGTGTTCAG
 cepI-FAGTTCGATCGCGACGATACC
 cepI-RAGCGACTTCAGCAGATACGG
 rpfFBC-FCACGTTCGACTTCTGGGTGA
 rpfFBC-RCCGAAGCCCGTGTAGATCTC
 recA-FGTACGATCAAGCGCACGAAC
 recA-RGATCCGGCGGATATCGAGAC
 BCAL0124-FACCTGTCGTACCTCCTCCTC
 BCAL0124-RCGTGATCATCGAAGCGGAAG
 BCAL0831-FTCCGTATTTGCCCCCGAAAA
 BCAL0831-RTTGCAGGTTGAGTTCGACGA
 BCAL0833-FTAGTCGTCACGTATTCGCCG
 BCAL0833-RCTTCTCGATGCATTGCTGGC
 BCAL1063-FACAACGACGTGATCTCGGTC
 BCAL1063-RTGAACAGGTACGACGTCACC
 BCAL2353-FCTGTTCCGCTCGGTGATGAA
 BCAL2353-RAGCAGGAAGTGGTCGTCATG
 BCAL3285-FACATCACCGCTGACCAGATG
 BCAL3285-RTGCGTCTGGTTGAACAGGTT
 BCAM0184-FCAACCCTTTACCCACGACGA
 BCAM0184-RCGTATTGCGGCAGTTTCTCG
 BCAM0185-FCCCTCCTTTCGGCTTCGATT
 BCAM0185-RGCGATCGCGAAATAGATGCC
 BCAM0186-FCTCAAACGTCATCCAACCGC
 BCAM0186-RGCTGTCGCCGATGAACAATT
 BCAM0191-FTGACCGATTCGACGCTTCAA
 BCAM0191-RGAAATACTCGGCCGCGTAGA
 BCAM0192-FCGTGTGGGATTTCATGTCGC
 BCAM0192-RAGGTACAGGTCGTAGTGGCT
 BCAM0193-FGCACGACTACCACGAGGAAG
 BCAM0193-RGAAGTAGCTGCCTTCCCGAT
 BCAM0194-FTTCCTGCGCGAATACCTGAG
 BCAM0194-RTGACGATCATCGGATGCTGG
 BCAM0195-FACGTCGTCGCGTTCTATCTC
 BCAM0195-RGATAGCCGAAATGCGCATCG
 BCAM0196-FGCTCGACCATACCGACATGA
 BCAM0196-RCGACGTATGGATCAGGCTCC
 BCAM0835-FGTGAACCGCATCTCGATTGC
 BCAM0835-RCAGCGTCGTATGGATCAGCA
 BCAM1005-FGAACACGCCGATGTCGAATG
 BCAM1005-RGTAGACGGTGTAGCTGACGG
 BCAM1010-FTGTCGGGCATCATCGAGAAG
 BCAM1010-RGCTTGCGCAGATGATCGAAG
 BCAM1745-FCCGACATCATCCTGCTCGAA
 BCAM1745-RTGGCCGTCATGTTCAGGTAC
 BCAM1871-FCTCGAACGACAGGTTGACGA
 BCAM1871-RGTATTTGCTGCGCATCTCCG
 BCAM2060-FGTGCTGTACGTGAACCAGGA
 BCAM2060-RGTTGAGCAGGAACAGGTCGA
 BCAM2140-FAATTCTCGACGAAGCTCGCA
 BCAM2140-RGATGTCTTTCACGATGCCGC
 BCAM2141-FCGATCATTTCGGCAAGCAGG
 BCAM2141-RGACGAACGGGATGTCGATCA
 BCAM2142-FGAACCGTGAAAGCCTCGAGA
 BCAM2142-RGCGGTCACTTTCTCGTAGCT
 BCAM2143-FGACGATCCAGGTCGATGGTC
 BCAM2143-RGTATCCACCACGATCCCCAC
 BCAM2169-FGTACACGTGGTACCGCATCA
 BCAM2169-RGTTTCCGTATAGCCGTCGGT
 BCAM2227-FACAGGAAGGCTTGTCGGAAG
 BCAM2227-RCGTCCCAGTTGTAGACCCAG
 BCAM2307-FGATGGACAAGGCGTTCCTGA
 BCAM2307-RGTGCAGCTCTTGTTGTACGC
 BCAM2308-FGCCTACTCTGAAACCGACCC
 BCAM2308-RCATCGATGCGTTGAAGCTGG
 BCAS0292-FGTCTGGTGTTCGTTGCGATG
 BCAS0292-RCAAAGAGCCGGTTGTCGTTG
 BCAS0293-FATGTCACGCGTTACCGATGT
 BCAS0293-RGACATAGCGCCAGTCGATCA

Restriction enzyme sites are underlined.

PCR primers used in this study Restriction enzyme sites are underlined.

Biofilm formation and protease activity assays.

The bacterial cells were cultured overnight and diluted to an OD600 of 0.01 by using minimal medium [per liter, 2 g glycerin, 2 g mannitol, 10.5 g K2HPO4, 4.5 g KH2PO4, 2 g(NH4)2SO4, 0.2 g MgSO4·7H2O, 0.005 g FeSO4, 0.01 g CaCl2, 0.002 g MnCl2]. Biofilm formation in 96-well polypropylene microtiter dishes was performed as described previously (34). For analyzing the protease activity, bacteria were cultured in NYG medium (per liter, 3 g yeast extract, 5 g peptone, 20 g glycerin) overnight at 37°C with shaking at 200 rpm, diluted to an OD600 of 0.01 in NYG, and then cultured at 37°C with shaking at 200 rpm for 18 h. Protease activity was determined by following previously published methods (35).

Construction of reporter strains and measurement of β-galactosidase assays.

The bclACB reporter was introduced into the B. cenocepacia H111 and ΔBcal3178 mutant strains by electroporation. The Bcal3178 reporter was introduced into the B. cenocepacia H111, ΔrpfF, ΔgtrR, and ΔcepI strains by triparental mating. The transconjugants were selected on LB agar plates supplemented with ampicillin, tetracycline, and X-Gal. For measurement of β-galactosidase activities, the overnight-cultured bacteria were diluted to the same cell densities (OD600, 0.01) in LB medium supplemented with ampicillin and tetracycline. The inoculated cultures were then incubated at 37°C with shaking at 200 rpm and harvested to measure β-galactosidase activities by following previously described methods (36).

Protein expression and purification assays.

The coding regions of Bcal3178, gtrR, and cepR were amplified with the primers listed in Table 2 and ligated to the expression vectors pGEX-6p-1 and pDBHT2, as indicated. The resulting constructs were transformed into E. coli BL21. The bacteria were cultured in LB medium with ampicillin and kanamycin, respectively, and the strain with pDBHT2-cepR was cultured with the addition of OHL (50 nM) (15). Affinity purifications of GST-Bcal3178, HIS-GtrR, and HIS-CepR fusion proteins were performed by following methods described previously (33). The fusion proteins were eluted and verified by SDS-PAGE.

EMSA.

The DNA probes used for electrophoretic mobility shift assay (EMSA) were harvested by PCR amplification using the primer pairs listed in Table 2. The purified PCR products of bclACB and Bcal3178 promoters were 3′-end labeled with biotin according to the manufacturer’s instructions (Thermo). The biotin-labeled probes and proteins were prepared for the DNA-protein binding reactions by following the manufacturer’s instructions (Thermo). A 5% polyacrylamide gel was used to separate the DNA-protein complexes from the unbound probes by following methods described previously (33). After UV cross-linking, the biotin-labeled probes were detected in the membrane, with different mobilities for the bound probes and unbound probes.

Quantitative real-time fluorescence PCR.

The bacterial cells were collected by centrifuging at 13,000 rpm for 2 min after growth to an OD600 of 1.0. The total RNA was prepared using an RNA extraction kit (Promega). Reverse transcription-PCR was performed using a cDNA synthesis kit (Promega) according to the manufacturer’s instructions. The qRT-PCR assays were performed using a SYBR green qPCR master mix (Thermo Scientific) and a 7300Plus real-time PCR system (Applied Biosystems). recA was used as the control. The relative expression levels of different target genes were analyzed by following the quantitation-comparative threshold cycle (ΔΔC) method as described previously (37).
  39 in total

Review 1.  Quorum sensing in Gram-negative bacteria: small-molecule modulation of AHL and AI-2 quorum sensing pathways.

Authors:  Warren R J D Galloway; James T Hodgkinson; Steven D Bowden; Martin Welch; David R Spring
Journal:  Chem Rev       Date:  2010-12-23       Impact factor: 60.622

Review 2.  Listening to a new language: DSF-based quorum sensing in Gram-negative bacteria.

Authors:  Yinyue Deng; Ji'en Wu; Fei Tao; Lian-Hui Zhang
Journal:  Chem Rev       Date:  2010-12-17       Impact factor: 60.622

Review 3.  Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators.

Authors:  C Fuqua; S C Winans; E P Greenberg
Journal:  Annu Rev Microbiol       Date:  1996       Impact factor: 15.500

4.  Thermally modified azocasein--a new insoluble substrate for the determination of proteolytic activity.

Authors:  I Safarík
Journal:  Biotechnol Appl Biochem       Date:  1987-08       Impact factor: 2.431

Review 5.  Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators.

Authors:  W C Fuqua; S C Winans; E P Greenberg
Journal:  J Bacteriol       Date:  1994-01       Impact factor: 3.490

6.  Direct binding of the quorum sensing regulator CepR of Burkholderia cenocepacia to two target promoters in vitro.

Authors:  Christine L Weingart; Catharine E White; Suping Liu; Yunrong Chai; Hongbaek Cho; Ching-Sung Tsai; Yuping Wei; Nicholas R Delay; Matthew R Gronquist; Anatol Eberhard; Stephen C Winans
Journal:  Mol Microbiol       Date:  2005-07       Impact factor: 3.501

7.  Molecular mechanism of the regulation of Bacillus subtilis gltAB expression by GltC.

Authors:  Silvia Picossi; Boris R Belitsky; Abraham L Sonenshein
Journal:  J Mol Biol       Date:  2006-11-03       Impact factor: 5.469

8.  Infection with Burkholderia cepacia complex genomovars in patients with cystic fibrosis: virulent transmissible strains of genomovar III can replace Burkholderia multivorans.

Authors:  E Mahenthiralingam; P Vandamme; M E Campbell; D A Henry; A M Gravelle; L T Wong; A G Davidson; P G Wilcox; B Nakielna; D P Speert
Journal:  Clin Infect Dis       Date:  2001-10-04       Impact factor: 9.079

9.  Identification of genes and gene products necessary for bacterial bioluminescence.

Authors:  J Engebrecht; M Silverman
Journal:  Proc Natl Acad Sci U S A       Date:  1984-07       Impact factor: 11.205

10.  A LysR-type transcriptional regulator in Burkholderia cenocepacia influences colony morphology and virulence.

Authors:  Steve P Bernier; David T Nguyen; Pamela A Sokol
Journal:  Infect Immun       Date:  2007-10-29       Impact factor: 3.441

View more
  4 in total

Review 1.  The cis-2-Dodecenoic Acid (BDSF) Quorum Sensing System in Burkholderia cenocepacia.

Authors:  Mingfang Wang; Xia Li; Shihao Song; Chaoyu Cui; Lian-Hui Zhang; Yinyue Deng
Journal:  Appl Environ Microbiol       Date:  2022-01-05       Impact factor: 5.005

2.  The Xanthomonas citri Reverse Fitness Deficiency by Activating a Novel β-Glucosidase Under Low Osmostress.

Authors:  Kaihuai Li; Jinxing Liao; Ming Wei; Shanxu Qiu; Weiyin Wu; Yancun Zhao; Haihong Wang; Qiongguang Liu; Fengquan Liu; Changqing Chang
Journal:  Front Microbiol       Date:  2022-05-02       Impact factor: 5.640

Review 3.  Methodological tools to study species of the genus Burkholderia.

Authors:  Viola Camilla Scoffone; Gabriele Trespidi; Giulia Barbieri; Samuele Irudal; Aygun Israyilova; Silvia Buroni
Journal:  Appl Microbiol Biotechnol       Date:  2021-11-10       Impact factor: 4.813

4.  Oridonin Attenuates Burkholderia cenocepacia Virulence by Suppressing Quorum-Sensing Signaling.

Authors:  Xia Li; Kai Wang; Gerun Wang; Binbin Cui; Shihao Song; Xiuyun Sun; Yinyue Deng
Journal:  Microbiol Spectr       Date:  2022-07-20
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.