Genetic Diversity of Symbiotic Green Algae of Paramecium bursaria Syngens Originating from Distant Geographical Locations.

Paramecium bursaria (Ehrenberg 1831) is a ciliate species living in a symbiotic relationship with green algae. The aim of the study was to identify green algal symbionts of P. bursaria originating from distant geographical locations and to answer the question of whether the occurrence of endosymbiont taxa was correlated with a specific ciliate syngen (sexually separated sibling group). In a comparative analysis, we investigated 43 P. bursaria symbiont strains based on molecular features. Three DNA fragments were sequenced: two from the nuclear genomes-a fragment of the ITS1-5.8S rDNA-ITS2 region and a fragment of the gene encoding large subunit ribosomal RNA (28S rDNA), as well as a fragment of the plastid genome comprising the 3'rpl36-5'infA genes. The analysis of two ribosomal sequences showed the presence of 29 haplotypes (haplotype diversity Hd = 0.98736 for ITS1-5.8S rDNA-ITS2 and Hd = 0.908 for 28S rDNA) in the former two regions, and 36 haplotypes in the 3'rpl36-5'infA gene fragment (Hd = 0.984). The following symbiotic strains were identified: Chlorella vulgaris, Chlorella variabilis, Chlorella sorokiniana and Micractinium conductrix. We rejected the hypotheses concerning (i) the correlation between P. bursaria syngen and symbiotic species, and (ii) the relationship between symbiotic species and geographic distribution.

1. Introduction

The unicellular ciliate Paramecium bursaria (Peniculia, Oligohymenophorea) is a host of endosymbiotic algal species. The mutualistic symbiosis exhibited by P. bursaria suppresses the genetic change of the inhabitant and ensures a nutritionally stable environment. Doebeli and Knowlton [1] reported that the rate of nucleotide substitutions was lower in symbiotic algae than in free-living relatives and their corresponding inhabitants since their co-evolution from an ancient association. Paramecium spp. usually comprise several sexually separated sibling groups, termed “syngens”, which are morphologically indistinguishable. Currently, P. bursaria strains have been assigned to five syngens (R1 to R5), which may correspond to some syngens described by Bomford [2,3]. Each syngen in Bomford’s collection (which was lost) had specific geographical distributions. Based on some similarities between syngens from the “old” and “new” collections, it has been suggested that syngen R1 is widespread in Europe; syngen R2 is widespread in Europe, extending eastwards to Siberia and Australia; syngen R4 is fairly widespread in the USA; and syngen R3 is present in Russia, Japan, China and the USA; finally, syngen R5 is represented by only four strains from two locations in western Europe [4].

Symbiotic algae isolated from different Paramecium bursaria syngens are represented by Chlorella-like species belonging to two genetically distinct “European” and “American” populations [5]. Gaponova et al. [6] confirmed the existence of two groups of symbionts based on the analysis of rDNA PCR products of two different lengths, which corresponded to the southern (three introns) or northern (single intron) group. Phylogenetic analyses based on the 28S rDNA gene, ITS 1, 5.8S rDNA and ITS 2 sequences suggested the existence of five different endosymbionts: Chlorella vulgaris, Chlorella variabilis, Micractinium conductrix comb. nov., Choricystis minor (Choriocystis parasitica comb. nov.) and Coccomyxa simplex. Pröschold et al. [7] have confirmed the occurrence of two endosymbiont groups and found that Micractinium conductrix and Chlorella vulgaris belonged to the “European” population. Hoshina and Imamura [8] have found that Chlorella vulgaris is a symbiont of Paramecium bursaria strain. Chlorella variabilis represents the “American” population and has been found in Paramecium bursaria strains (CCAP211/84, 211/109 and 211/110) collected in the USA [7]. Algal symbionts of all P. bursaria strains of two different origins form one clade, but are split into two distinct lineages.

An evolutionary scenario for P. bursaria with respect to algal acquisition and subsequent switching assumes the coexistence of both species belonging to the “American” and “European” endosymbiont groups in one cell of ancestral P. bursaria. This sympatric relationship led to a continuous intron transmission. During evolution, the host “chose” one of the endosymbionts, and later “European” algae may have diverged into a lineage with a weakened host–algal partnership, in which accidental switching of the algae occurred twice [9,10].

Hoshina and Imamura [8] and Gaponova et al. [6] have shown that P. bursaria can contain different endosymbionts, depending on their origin. Nakahara et al. [11] identified an additional endosymbiont, Choricystis minor, in a strain from Florida (USA). Pröschold et al. [7] studied 17 strains of endosymbionts isolated from various hosts and different geographical locations. Phylogenetic analyses revealed that they were polyphyletic. The most studied ciliate, P. bursaria, harbors endosymbionts representing at least five different species: Coccomyxa sp., Choricystis minor, Micractinium conductrix, Chlorella vulgaris and Chlorella variabilis. C. vulgaris, C. variabilis and Micractinium conductrix are obligate endosymbionts of P. bursaria [7]. M. tetrahymenae forms a symbiotic association with Tetrahymena utriculariae only under anoxic or microaerobic conditions. Phylogenetic analyses using complex evolutionary models based on secondary structure have demonstrated that this endosymbiont represents a new species of Micractinium, which belongs to the so-called Chlorella clade (Trebouxiophyceae) [12].

In the present study, we investigated 43 strains of algal symbionts isolated from P. bursaria strains belonging to five syngens. The strains were collected in remote geographical locations. Twenty sequences of symbionts were available in GenBank (28S rDNA and ITS1-5.8S rDNA-ITS2 fragment). The strains of Coccomyxa chodatii, Stigeoclonium tenue, Stigeoclonium variabile, Parachlorella kessleri and Actinastrum hantzschii were used as outgroups. Three loci: a fragment of the ITS1-5.8S rDNA-ITS2 region and a fragment 28S rDNA, as well as chloroplast genes encoding ribosomal protein L36 (rpl36) and translation initiation factor IF-1 (infA) were applied to study phylogenetic relationships of symbiotic algae. The selected ribosomal primers were specific to symbiotic cells, which did not allow the simultaneous amplification of P. bursaria rDNA fragments. The 28S rDNA is characterized by higher variability than the 18S rDNA [8]. The ITS1-5.8S rDNA-ITS2 region is highly variable among the sequences of different species, while it is relatively conserved among the sequences of the same species of algae. Furthermore, this fragment is most commonly available in GenBank, which facilitates comparative analysis. The 3′rpl36-5′infA gene fragment has been selected due to the presence of an intergenic region, which is suspected to have more potential substitution sites than the gene-coding regions.

The main aim of the study was to determine the molecular phylogenetic relationships among green algal endosymbionts of P. bursaria in order to explore the history of the symbiosis events. We tried to answer whether endosymbiosis of a green algae in the host P. bursaria took place prior to the diversification of the host lineage into the various syngens or if endosymbionts are incorporated over and over again. In the latter case we assess whether endosymbionts are host-specific or if there is no relationship between host syngens and endosymbiont lineage.

2. Results

2.1. Syngen Identification

Identification of Paramecium bursaria syngens was performed by mating the studied strain with standard strains representing all mating types of each syngen. The number of symbiotic strains of algal species identified in each of the five P. bursaria syngens is presented in Table 1.

Table 1

The number of symbiotic strains of particular algal species identified in five syngens of Paramecium bursaria.

Endosymbiont Species	Syngen of Paramecium bursaria
	R1	R2	R3	R4	R5
Chlorella vulgaris	2	10	4	1	1
Chlorella variabilis	1	4	2	1	1
Chlorella sorokiniana	0	3	1	0	0
Micractinium conductrix	3	7	0	0	0

2.2. Geographical Distribution of Paramecium Bursaria Symbionts

P. bursaria syngens and their geographical distribution are shown in Figure 1 and Table 2. Syngen R1 from central Asia (Tajikistan) harbored C. vulgaris strain but those from Europe (Wien) contained C. variabilis. Endosymbiotic Micractinium conductrix was isolated from the syngen originating from north-eastern Europe (St. Petersburg, Tver). Syngen R2 of P. bursaria was collected most frequently, and 10 endosymbionts from central Asia (Altai, Lake Baikal), eastern Europe (Astrakhan), eastern Europe (Tver, Yaroslavl, Kaliningrad), and Scotland (Europe) were assigned to C. vulgaris. Four strains from eastern Europe (Astrakhan), Far East (Kamchatka) and from Germany (Europe) belonged to C. variabilis. Two strains from Kamchatka and one from central Asia (Lake Baikal) were assigned to C. sorokiniana. Seven strains of Micractinium conductrix from Asia and Europe were found in this syngen. Green endosymbionts from syngen R3 sampled in Japan and Far East (Khabarovsk) belonged to the C. vulgaris clade, but C. variabilis (Khanka Nature Reserve) and C. sorokiniana strains were also found in China. One strain of C. variabilis was isolated in Europe (Italy). Strains isolated from syngen R4 of P. bursaria originating from the USA were assigned to C. vulgaris and C. variabilis. Endosymbionts isolated from syngen R5 originating from eastern Europe (Astrakhan) were assigned to C. vulgaris, while the strain isolated from the same P. bursaria syngen sampled in north-eastern Europe (St. Petersburg) was C. variabilis.

Figure 1

Geographical distribution of Paramecium bursaria symbionts with numbers corresponding to those in Table 2.

Table 2

Strains of symbiotic algae studied in the current survey.

No.	Algal (Endosymbiont) Species	Algal (Endosymbiont) Strain	Paramecium bursaria (Host) Strain	Taxonomic Designation of the Host	Origin of the Host	GenBank Accession Number			References
						28S rDNA	3′rpl36-5′infA	ITS1-5.8S-ITS2
1.	Chlorella vulgaris	CVG-SHT-56	SHT-56	R1	Tajikistan	KX639563	KX639603	KX639535	This study
2.	Chlorella vulgaris	CVG-TR54-4	TR54-4	R2	Tver, Russia	KX639564	KX639604	KX639536	This study
3.	Chlorella vulgaris	CVG-RA2-1	RA2-1	R2	Altai Forelands, Russia	KX639562	KX639602	nd	This study
4.	Chlorella vulgaris	CVG-MitR	MitR	R3	Japan	KX639561	KX639601	KX639534	This study
5.	Chlorella vulgaris	CVG-JR-16	JR-16	R3	Japan	KX639560	KX639600	nd	This study
6.	Chlorella vulgaris	CVG-HKV19-12	HKV19-12	R3	Khabarovsk, Russia	KM203671	KM203663	nd	[13]
7.	Chlorella vulgaris	CVG-Bya129-5	Bya129-5	R2	Yaroslavl, Russia	KX639559	KX639598	nd	This study
8.	Chlorella vulgaris	CVG-BBR180-10	BBR180-10	R2	Lake Baikal, Russia	KX639557	KX639596	KX639531	This study
9.	Chlorella vulgaris	CVG-BBR178-9	BBR178-9	R2	Lake Baikal, Russia	KX639556	KX639595	KX639530	This study
10.	Chlorella vulgaris	CVG-AZ21-3	AZ21-3	R2	Astrakhan Nature Reserve, Russia	KX639555	KX639594	nd	This study
11.	Chlorella vulgaris	CVG-AZ20-1	AZ20-1	R5	Astrakhan Nature Reserve, Russia	KX639554	KX639593	nd	This study
12.	Chlorella vulgaris	CVG-AZ10-1	AZ10-1	R5	Astrakhan Nature Reserve, Russia	KM203670	KM203662	KX639528	[13], this study (ITS1-5.8S-ITS2)
13.	Chlorella vulgaris	CVG-Yad1-g	Yad1-g	R3	Yamaguchi, Japan	KX639565	KX639605	nd	This study
14.	Chlorella vulgaris	CVG-Ard7	Ard7	R4	Ardmore, USA	KX639552	KX639591	KX639526	This study
15.	Chlorella vulgaris	CVG-AZ7-14	AZ7-14	R2	Astrakhan Nature Reserve, Russia	KX639553	KX639592	KX639527	This study
16.	Chlorella vulgaris	CVG-AB2-51	AB2-51	R4	Boston, USA	KM203673	KM203661	nd	[13]
17.	Chlorella vulgaris	CVG-GB15-2	GB15-2	R2	Lake Loch Linnhe, Scotland	KX639551	KX639599	KX639525	This study
18.	Chlorella vulgaris	CVG-KZ-126	KZ-126	R2	Kaliningrad, Russia	KM203672	KM203660	KX639533	[13], this study (ITS1-5.8S-ITS2)
19.	Chlorella vulgaris	CVG-BL15-3	BL15-3	R2	Lake Baikal, Russia	KX639558	KX639597	KX639532	This study
20	Chlorella vulgaris	CVG-B4-1	B4-1	R1	Volgograd, Russia	KX639546	KX639586	KX639529	This study
21.	Chlorella variabilis	CVA-AZ8-2	AZ8-2	R2	Astrakhan Nature Reserve, Russia	KX639544	KX639584	KX639520	This study
22.	Chlorella variabilis	CVA-IP	IP	R3	Pisa, Italy	KX639549	KX639589	nd	This study
23.	Chlorella variabilis	CVA-Ard10-3	Ard10-3	R4	Ardmore, USA	KM203667	KM203658	nd	[13]
24.	Chlorella variabilis	CVA-AZ20-4	AZ20-4	R2	Astrakhan Nature Reserve, Russia	KX639545	KX639585	KX639521	This study
25.	Chlorella variabilis	CVA-Wien4a-12	Wien4a-12	R1	Wien, Austria	KX639550	KX639590	nd	This study
26.	Chlorella variabilis	CVA-B5-7	B5-7	R5	Botanical Garden in St. Petersburg, Russia	KM203669	KM203659	KX639522	[13], this study (ITS1-5.8S-ITS2)
27.	Chlorella variabilis	CVA-KD64	KD64	R2	Kamchatka, Russia	KM203668	KM203657	nd	[13]
28.	Chlorella variabilis	CVA-HZ85-1	HZ85-1	R3	Khanka Nature Reserve, Russia	KX639548	KX639587	KX639524	This study
29.
30.	Chlorella variabilis	CVA-GT-2	GT-2	R2	Tübingen, Germany	KX639547	KX639587	KX639523	This study
31.	Chlorella sorokiniana	CS-BBR51-1	BBR51-1	R2	Lake Baikal, Russia	KX639542	KX639582	nd	This study
32.	Chlorella sorokiniana	CS-Cs2	Cs2	R3	Shanghai, China	KX639543	KX639583	nd	This study
33.	Chlorella sorokiniana	CS-11 231-2	11 231-2	R2	Kamchatka, Russia	KX639540	KX639580	nd	This study
34.	Chlorella sorokiniana	CS-11 35-2	11 35-2	R2	Kamchatka, Russia	KX639541	KX639581	nd	This study
35.	Micractinium conductrix	MC-11 42-2	11 42-2	R2	Kamchatka, Russia	KX639567	KX639574	nd	This study
36.	Micractinium conductrix	MC-RN88-4	RN88-4	R2	Tver, Russia	KX639570	KX639577	nd	This study
37.	Micractinium conductrix	MC-4 231-1	4 231-1	R2	Kamchatka, Russia	KX639566	KX639573	KX639537	This study
38.	Micractinium conductrix	MC-MS-1	MS-1	R1	St. Petersburg, Russia	KM203675	KM203666	KX639538	[13], this study (ITS1-5.8S-ITS2)
39.	Micractinium conductrix	MC-GB7-2	GB7-2	R2	Lake Loch Linnhe, Scotland	KX639568	KX639575	nd	This study
40.	Micractinium conductrix	MC-VM-14	VM-14	R2	Valaam, Russia	KM203674	KM203664	nd	[13]
41.	Micractinium conductrix	MC-PMP1-3-1	PMP1-3-1	R1	St. Petersburg, Russia	KX639569	KX639576	nd	This study
42.	Micractinium conductrix	MC-TR54-1	TR54-1	R1	Tver, Russia	KX639572	KX639579	nd	This study
43.	Micractinium conductrix	MC-SRB9-1	SRB9-1	R2	River Danube, Serbia	KX639571	KX639578	KX639539	This study
44.	Micractinium conductrix	MC-TOS1-7	TOS1-7	R2	Togliatti, Russia	KM203676	KM203665	nd	[13]
45.	Micractinium inermum	NLP-F014	nd	nd	nd	KF597304.1	nd	nd	Unpublished data
46.	Chlorella sorokiniana	UTEX 1665	nd	nd	nd	KJ676113.1	nd	nd	[14]
47.	Micractinium sp.	KNUA029	nd	nd	nd	KM243321.1	nd	nd	[15]
48.	Micractinium reisseri (conductrix)	SW1-ZK, (SW1)	nd	nd	Black Forest, Germany	AB437256.1	nd	AB437244.1	[10]
49.	Micractinium sp.	MCWWW15	nd	nd	nd	nd	nd	KP204593.1	[16]
50.	Micractinium sp.	MCWWW4	nd	nd	nd	nd	nd	KP204582.1	[16]
51.	Micractinium sp.	MCWWW5	nd	nd	nd	nd	nd	KP204583.1	[16]
52.	Micractinium sp.	MCWWW10	nd	nd	nd	nd	nd	KP204588.1	[16]
53.	Micractinium sp.	MCWWW11	nd	nd	nd	nd	nd	KP204589.1	[16]
54.	Micractinium sp.	KNUA032	nd	nd	nd	nd	nd	KM243324.1	[15]
55.	Micractinium reisseri (conductrix)	EdL_Cl1_MAF	nd	nd	nd	nd	nd	KF887345.1	Unpublished data
56.		SAG 13.81	nd	nd	nd	nd	nd	FM205866.1	[17]
57.	Chlorella sp.	CB4	nd	nd	nd	nd	nd	JQ710683.1	Unpublished data
58.	Chlorella sp.	IFRPD	nd	nd	nd	nd	nd	AB260898.1	[8]
59.	Chlorella sorokiniana	KLL-G018	nd	nd	nd	nd	nd	KP726221.1	[18]
60.	Chlorella sorokiniana	KU219	nd	nd	nd	nd	nd	KM061463.1	Unpublished data
61.	Chlorella variabilis	CCAP 211/84	nd	nd	nd	nd	nd	FN298923.1	[7]
62.	Chlorella variabilis	SAG 211-6	nd	nd	nd	nd	nd	FM205849.1	[17]
63.	Chlorella variabilis	EdL_Cl2_3NB	nd	nd	nd	nd	nd	KF887350.1	Unpublished data
64.	Chlorella vulgaris	DRL3	nd	nd	nd	nd	nd	JX139000.1	Unpublished data
65.	Coccomyxa chodatii	SAG: 216-2	nd	nd	nd	HG972989.1	nd	nd	[19]
66.	Stigeoclonium tenue	CCAP 477/11A	nd	nd	nd	HF920680.1	nd	nd	[20]
67.	Stigeoclonium variabile	CCAP 477/13	nd	nd	nd	HF920679.1	nd	nd	[20]
68.	Parachlorella kessleri	SAG: 211-11g	nd	nd	nd	nd	X65099.1	nd	[21]
69.	Actinastrum hantzschii	SAG 2015	nd	nd	nd	nd	nd	FM205841.1	[18]

2.3. Molecular Results

Results of the analysis of ITS1-5.8S-rDNA-ITS2, 28S rDNA and 3′rpl36-5′infA chloroplast gene fragments revealed similarity of the isolated strains to the species described as Chlorella vulgaris, Chlorella variabilis, Chlorella sorokiniana and Micractinium conductrix. Phylogenetic inference showed that these strains belonged to four distinct clades, thus the endosymbionts were polyphyletic.

2.3.1. Analysis of the ITS1-5.8S rDNA-ITS2 Fragment

Results of the analysis of the ITS1-5.8S rDNA-ITS2 fragments (543 bp) of 37 endosymbionts revealed the existence of 29 haplotypes in the studied dataset. The value of the interspecific haplotype diversity was Hd = 0.987 and the nucleotide diversity was π = 0.16040. Nucleotide frequencies were as follows: A = 20.5%, T = 22.6%, C = 30.1% and G = 26.8%.

The haplotype network of the ITS1-5.8S rDNA-ITS2 fragment was constructed for the inference and visualization of genetic relationships between green endosymbionts of P. bursaria (Figure 2). Four haplogroups were identified for the rDNA fragment in the studied strains, i.e., C. vulgaris, C. variabilis, C. sorokiniana and M. conductrix. The clade of C. vulgaris was composed of 12 haplotypes; one of them comprised two strains isolated from P. bursaria syngen R2: CVG-BBR-180-10 and CVG-BL15-3 sampled from the Baikal Lake (central Asia). The clade of C. variabilis included six haplotypes. Three strains: CCAP 211/84, SAG 211-6 and Edl_Cl2_3NB from GenBank formed a common haplotype. The remaining strains represented single haplotypes.

Figure 2

Haplotype network constructed for 37 symbiotic alga strains based on the comparison of the ITS1-5.8S rDNA-ITS2 sequences, (a) with strain abbreviations, (b) geographical origin of P. bursaria strains and syngens. The size of the dots is proportional to haplotype frequency. Median vectors that represent hypothetical intermediates or unsampled haplotypes are shown as black dots. Hatch marks on individual branches represent nucleotide substitutions between individual haplotypes (corresponding number was assigned for more than 10). Haplotypes marked as “no locality data” were acquired from GenBank.

The clade of C. sorokiniana was composed of two unique haplotypes. The first one consisted of two Chlorella sp. strains, CB4 and IFRPD, and the second one of Chlorella sorokiniana KLL-G018 and KU219 from GenBank.

The following clade, Micractinium, included nine haplotypes and seven of them represented unique haplotypes; two of them were composed of two strains: Micractinium sp., MCWWW5 and MCWWW10 from GenBank, and the second haplotype: Micractinium reisseri EDL_Cl1_MAF from GenBank and SW1-ZK1 from Germany. There were 88 to 112 differences between C. variabilis and C. sorokiniana, 81 to 128 between C. vulgaris and C. variabilis, 72 to 100 between C. variabilis and Micractinium, 149 to 192 between Micractinium and C. vulgaris and 168 to 204 differences between C. vulgaris and C. sorokiniana. Intraspecific variation among haplotypes was the result of several substitutions (Table 2, Figure 2).

2.3.2. Analysis of the 28S rDNA Fragment

Results of the analysis of 28S rDNA fragments (555 bp) of 43 symbionts isolated from different P. bursaria strains showed the presence of 29 haplotypes. The value of the interspecific haplotype diversity was Hd = 0.908 and the nucleotide diversity was π = 0.03165. Nucleotide frequencies were as follows: A = 26.7%, T = 18.7%, C = 23.8% and G = 30.8%.

The haplotype network of the 28S rDNA fragment grouped the strains into four clades: C. vulgaris, C. variabilis, C. sorokiniana and Micractinium. The clade of C. variabilis was composed of 10 unique haplotypes with 2 to 9 substitutions between them (Figure 3).

Figure 3

Haplotype network constructed for 43 symbiotic algae of P. bursaria strains based on sequence comparison of the 28S rDNA gene fragment, (a) with strain abbreviations, (b) geographical origin of P. bursaria strains and syngens. The size of the dots is proportional to haplotype frequency. Median vectors that represent hypothetical intermediates or un-sampled haplotypes are shown as black dots. Hatch marks on individual branches represent nucleotide substitutions between individual haplotypes (corresponding number was assigned for more than 10). Haplotypes marked as “no locality data” were acquired from GenBank.

The C. vulgaris clade consisted of five unique haplotypes. One of them included 14 strains: CVG-Bya129-5 (Yaroslavl) and CVG-TR54-4 (Tver) from eastern Europe, CVG-SHT56 (Tajikistan) from central Asia, CVG-RA2-1 (Altai) and CVG-BBR178-9, CVG-BBR180-10 (Baikal Lake) from central Asia, CVG-AZ10-1, CVG-AZ20-1, CVG-AZ21-3, (Astrakhan) from eastern Europe, CVG-HKV19-12 (Khabarovsk) from the Far East, CVG-JR-16, CVG-MitR and CVG-Yad1-g from Japan, CVG-AB2-51 (Boston) from USA. The second haplotype was composed of two strains: CVG-AZ7-14 (Astakhan) from eastern Europe and CVG-Ard7 (Ardmore) from USAj. The other haplotypes were represented by the following single strains: CVG-BL15-3, CVG-KZ-126 and CVG-GB15-2. The C. variabilis clade was composed of 10 single strains.

The Micractinium clade was composed of 10 haplotypes. One of them included four strains from Europe: MC-PMP1-3-1, (St. Petersburg, north-eastern Europe), MC-SRB9-1 (Serbia, southern Europe), MC-TOS1-7 (Togliatii, south-eastern Europe) and SW1-ZK (Germany, western Europe). The other nine corresponded to single strains: MC-4 231-1, MC-VM-14, MC-RN88-4, MC-MS-1, MC-GB7-2, MC-11 42-2, MC-TR54-1, NLP-F014 and KNUA029.

The last clade consisted of C. sorokiniana representatives, and included four haplotypes. One haplotype was formed by two strains from the Far East origin: CS-11 231-2 and CS-11 35-2 (Kamchatka) and the other two represented single strains: CS-BBR51-1 and CS-Cs2.

Interspecific variability was higher when C. vulgaris to Micractinium or C. variabilis to Micractinium were compared (28–58 differences). There was a low number of substitutions between C. vulgaris and C. variabilis (1–20 differences) (Table 2, Figure 3).

2.3.3. Analysis of the rpl36-infA Genes Fragment

Results of the rpl36-infA gene fragment (267 bp) analysis in symbionts isolated from 43 P. bursaria strains showed the presence of 36 haplotypes. The value of the interspecific haplotype diversity was Hd = 0.984, and the nucleotide diversity was π = 0.07886. Nucleotide frequencies were as follows: A = 29.6%, T = 36.0%, C = 18.5% and G = 15.9%.

The haplotype network of chloroplast gene fragments grouped the strains into four clades: C. vulgaris, C. variabilis, C. sorokiniana and M. conductrix (Figure 4). The C. vulgaris clade included 17 haplotypes; one haplotype was represented by three strains. Two strains from Europe: CVG-GB15-2 (Scotland), CVG-KZ-126 (Kaliningrad) isolated from P. bursaria syngen R2, and one strain from central Asia: CVG-SHT-56 (Tajikistan) from syngen R1. The remaining haplotypes consisted of single strains.

Figure 4

Haplotype network constructed for 43 symbiotic algae strains based on the comparison of the 3′rpl36-5′infA genes sequences, (a) with strain abbreviations, (b) geographical origin of P. bursaria strains and syngens. The size of the dots is proportional to haplotype frequency. Median vectors that represent hypothetical intermediates or unsampled haplotypes are shown as black dots. Hatch marks on individual branches represent nucleotide substitutions between individual haplotypes (corresponding number was assigned for more than 10).

The clade of C. variabilis consisted of nine haplotypes and eight of them included single strains. Strain CVA-B5-7 (St. Petersburg, north-eastern Europe) from syngen R5 and strain CVA-AZ20-4 (Astrakhan, eastern Europe) from syngen R2 belonged to the ninth haplotype.

The C. sorokiniana clade was composed of four unique haplotypes corresponding to single strains.

The M. conductrix clade included six haplotypes, five of them represented single strains and one haplotype was composed of the five following strains: MC-PMP1-3-1 and MC-MS-1 (St. Petersburg, north-eastern Europe), isolated from syngen R1, MC-SRB9-1 (Serbia, southern Europe), MC-TOS1-7 (Togliatii, south-eastern Europe), and MC-VM-14 (Valaam, northern Europe) isolated from syngen R2.

There were 18 to 43 substitutions between C. vulgaris and C. variabilis, 19 to 49 substitutions between C. vulgaris and C. sorokiniana, 41 to 51 between C. sorokiniana and M. conductrix, and 35 to 57 substitutions between M. conductrix and C. variabilis (Table 2, Figure 4).

3. Discussion

Paramecium bursaria is an archetypical outbreeder, which presumably means that its effective population size is large. P. bursaria is divided into five syngens which are characterized by a specific geographical distribution. Nyberg [22] concluded that P. bursaria syngens, as extreme outbreeders, should be globally distributed, but Bomford [2] and Greczek-Stachura et al. [4] postulated that most sibling species were restricted to certain geographical regions, and thus adapted to specific conditions. Based on the comparison of syngens from Bomford’s collection and new syngen annotations, it is known that syngens R3 and R4 have been found in the United States [23], and syngen R3 has been reported later in China [24]. According to the study by Hoshina et al. [25], P. bursaria strains from Japan were also classified as syngen R3. Two syngens, R1 and R2, are only of Eurasian origin, and have been recorded at various locations from Great Britain to central Siberia; in addition, two strains of syngen 2 have been found in one locality in Australia. Syngen R3 strains have been isolated in far-eastern Russia and south-eastern Siberia (but never western Siberia), China, Japan, and the USA. Recently, this syngen has been reported in Europe, namely in Austria and in Italy (although the strain from Pisa was collected in a botanical garden, where it could have been brought along with some tropical plants). Syngen 4 strains are restricted to the USA. Strains belonging to syngen 5 have been found in the Volga delta, known for its great migration routes of waterfowl that are suspected transmitters of paramecia [4,26]. The current investigation of different syngens of P. bursaria collected in Europe, Asia and North America confirmed the previous knowledge about their biogeography. P. bursaria syngen R1 has been found in central Asia and north-eastern Europe. Strains of syngen R2 have been found in Asia and Europe. Syngen R3 was sampled in Japan, Far East and China. Strains of syngen R4 originate from the USA and syngen R5 strains are derived from eastern Europe and north-eastern Europe (Figure 1, Table 2).

The existence of syngens is the result of the process of speciation. The key question regarding evolution is: what are the driving forces behind initial speciation of Paramecium bursaria? Geographic isolation is often the main speciation factor, but its significance in protists is uncertain as there is still disagreement over their distribution—whether it is cosmopolitan or endemic.

If P. bursaria syngens are hosting the same species of endosymbiotic algae, they can be sympatric or other speciation mechanisms may play a leading role. Therefore, in our opinion, identification of species of endosymbiotic algae can explain a possible process of co-evolution. In the present study, we have identified four species of endosymbiotic algae, i.e., C. vulgaris, C. variabilis, C. sorokiniana and M. conductrix. Spanner et al. [27], based on ITS-2 sequencing, identified Chlorella variabilis and Micractinium conductrix in Paramecium bursaria cells. The two above endosymbionts have been identified in strains belonging to syngens R1 and R2 of P. bursaria, which originated from Europe. Moreover, we have found C. vulgaris and C. variabilis in all five syngens of P. bursaria, M. conductrix was present in syngen R1 and R2, and C. sorokiniana in syngen R2 and R3 (Table 1). Gaponova et al. [6] have also found M. conductrix in P. bursaria isolates collected in North Karelia (Russia). Overall, it seems that M. conductrix occurs only in Europe, whereas C. variabilis is distributed worldwide. Hoshina et al. [5,10] established the geographical distribution of Micractinium sp. in the regions of England, Germany, Austria and northern Karelia, which was consistent with the results obtained by Luo et al. [17,28]. Strains belonging to the American group derived from USA, Japan, China and southern Australia carried symbiotic algae classified as Chlorella vulgaris and Chlorella variabilis [7]. Hoshina and Imamura [9] identified the strains from Kaliningrad as C. vulgaris, similar to our findings i.e., the strain isolated from syngen R2. Pröschold et al. [7] have suggested that C. variabilis is characteristic of the American but not the European group; however, according to our results, the strains from St. Petersburg and Valaam as well as strains from central Europe (Pisa, River Danube in Serbia) have been assigned to C. variabilis and M. conductrix.

Our findings suggests that there is no correlation between P. bursaria syngen and the species of symbiont, as was previously argued by Weis [29]. Similarly, Reisser et al. [30] stated that P. bursaria strains of American or European origin formed a stable symbiosis with symbionts of both groups. Then, Meier and Wiessner [31] demonstrated that P. bursaria could eliminate symbionts and subsequently be reinfected by new symbionts. Summerer et al. [32] mixed two aposymbiotic P. bursaria strains with symbiotic and free-living Chlorella strains. Symbioses were formed with endosymbiotic Chlorella, with the exception of those from H. viridis and free-living algae. Similarly, in the current survey we demonstrated that there is no strong relationship between species of symbionts and the geographical distribution of their host, P. bursaria. This may be explained by the ancestral aposymbiotic ciliate P. bursaria possibly having acquired different species of green algae and later diverging into a lineage with a host-algal partnership where accidental algal change may have occurred. Summerer et al. [33] analyzed nuclear 18S rDNA, the ITS1 region and chloroplast 16S rDNA from algal symbionts of P. bursaria strains originating from two lakes in Austria. These strains formed a clade with two distinct lineages, suggesting the existence of a biogeographic pattern. Genetic differences between symbiotic algae are 10 times higher than between free-living algae. This suggests that multiple symbiotic origins are more likely than the divergence of one symbiotic species to different symbiotic algae existing currently [25]. The endosymbiotic lifestyle has evolved many times in green algae, as evidenced by the presence of numerous haplotypes of endosymbiotic algae in the haplotype network based on the nuclear ITS1-5.8S rDNA-ITS2 fragment, 28S rDNA fragment and 3′rpl36-5′infA gene sequences. Endosymbionts of the Chlorellaceae species, which also serve as specific hosts for large dsDNA viruses known as chloroviruses, do not cluster together, providing strong evidence for independent transitions to endosymbiosis [34].

Therefore, we suppose that the speciation of P. bursaria syngens was an earlier evolutionarily event than the establishment of symbiosis, as evidenced by the diversity of symbionts and their lack of specificity.

4. Materials and Methods

4.1. Strain Cultivation and Strain Crosses

Paramecium bursaria strains were cultivated on a lettuce medium according to Sonneborn [35], fed Klebsiella pneumoniae (SMC) and stored at 18 °C (12L/12D). We investigated 43 symbiotic strains isolated from P. bursaria cells derived from different geographical locations. We also analyzed 20 sequences of symbiotic algae available in GenBank and strains of Coccomyxa chodatii, Stigeoclonium tenue, Stigeoclonium variabile, Parachlorella kessleri and Actinastrum hantzschii as outgroups (Table 2).

Identification of P. bursaria syngens was performed by mating reaction of a studied strain with standard strains representing all mating types of each syngen. The studied strains were assigned to a certain syngen based on the occurrence of strong clumping at the beginning of the mating reaction, the presence of mating couples and survival of F1 progeny.

4.2. Molecular Methods

Symbiotic DNA was extracted using the GeneJET Plant Genomic DNA Purification Kit (ThermoScientific) according to the protocol. Dense P. bursaria culture (1.5 mL) was harvested from a liquid culture by centrifugation. Then, the pellet was sonicated on ice for 10 s at 40 W. Subsequently, the standard extraction protocol was followed. The ITS1-5.8S rDNA-ITS2 fragment was amplified using the following primers pairs: ITS1 [32]/ITS2R (primer designed for the present study, Table 3) and ITS1F/ITS2R (primers designed for the present study, Table 3) according to the protocol with the following parameters: initial denaturation at 95 °C for 5 min followed by 30 cycles of denaturation at 95 °C for 1 min, annealing at 54 °C for 2 min, extension at 72 °C for 3 min and a final extension at 72 °C for 5 min.

Table 3

Primers used in the present study.

DNA Fragment	Primer	Sequence 5′-3′	References
ITS1-5.8S rDNA-ITS2	ITS1	TCCGTAGGTGAACCTGCGG	[33]
	ITS1F	AATCTATCGAATCCACTTTGGTAAC	Designed in the present study
	ITS2R	CTGCTAGGTCTCCAGCAAAG	Designed in the present study
28S rDNA frgment	HLR0F	GGCAAGACTACCCGCTGAA	[8]
	HLR4R	TTTCAAGACGGGCCGATT	[8]
3′rpl36-5′infA genes	UCP2F	CCTTGWCKTTGTTTATGTTTKGG	[36]
	UCP2R	GCTCATGTYTCHGGBAAAATWCG	[36]

The fragment of a 28S rDNA was amplified by polymerase chain reaction (PCR) using the HLR0F/HLR4R primer pair [8,37] (Table 3), according to the protocol described by Hoshina et al. [38]. The fragment of 3′rpl36-5′infA genes was amplified using the UCP2F and UCP2R primer set (Table 3), according to Provan et al. [36]. After amplification, PCR products were separated by electrophoresis in 1% agarose gel for 1 h at 95 V and then gel-purified using NucleoSpin Extract II (Macherey-Nagel, Düren, Germany). Sequencing reaction was performed in both directions using the BigDye Terminator v3.1 kit (Applied Biosystems, Foster City, USA). Sequencing products were precipitated using Ex Terminator (A&A Biotechnology, Gdynia, Poland).

4.3. Data Analyzes

Sequences were examined and corrected using Chromas Lite (Technylesium), and aligned using BioEdit [39]. The analysis of haplotype diversity (Hd) and nucleotide diversity (π) was carried out using DnaSP v5.10.01 [39]. The analysis of nucleotide frequencies and identification of the best nucleotide substitution models for maximum likelihood tree reconstruction (T92 + G for three loci) were conducted using Mega v5.1. Haplotype networks were constructed using the Median Joining method implemented in the Network 4.6.1.3 software [40,41].

5. Conclusions

The ITS1-5.8S rDNA-ITS2 fragment is the most appropriate molecular marker to identify and resolve evolutionary relationship between symbionts of Paramecium bursaria. We assigned symbiotic algae of P. bursaria to four species: Chlorella vulgaris, Chlorella variabilis, Chlorella sorokiniana and Micractinium conductrix. The division of P. bursaria endosymbionts into the American and European groups and the correlation between P. bursaria syngen and a symbiotic species has not been confirmed. No strong relationships have been found between symbiotic species and geographical distribution of their host P. bursaria.

Molecular markers: ITS1-5.8S rDNA-ITS2, 28S rDNA fragments and 3′rpl36-5′infA gene fragments are useful molecular tools for distinguishing closely related taxa of P. bursaria symbionts. The ITS1-5.8S rDNA-ITS2 fragment is the most appropriate due to its high interspecific and low intraspecific variability. Additionally, the application of two independent genome fragments (nuclear and chloroplast) increases the reliability of the results.