Munawwar Ali Khan1, Shams Tabrez Khan2, Milred Cedric Sequeira3, Sultan Mohammad Faheem3, Naushad Rais3. 1. Department of Life and Environmental Sciences, College of Natural and Health Sciences, Zayed University, Dubai, United Arab Emirates. 2. Department of Agricultural Microbiology, Aligarh Muslim University, Aligarh, Uttar Pradesh, India. 3. School of Life Sciences, Manipal Academy of Higher Education, Academic City, Dubai, United Arab Emirates.
Abstract
Understanding the microbial communities in anaerobic digesters, especially bacteria and archaea, is key to its better operation and regulation. Microbial communities in the anaerobic digesters of the Gulf region where climatic conditions and other factors may impact the incoming feed are not documented. Therefore, Archaeal and Bacterial communities of three full-scale anaerobic digesters, namely AD1, AD3, and AD5 of the Jebel Ali Sewage water Treatment Plant (JASTP) were analyzed by Illumina sequencing of 16S rRNA genes. Among bacteria, the most abundant genus was fermentative bacteria Acetobacteroides (Blvii28). Other predominant bacterial genera in the digesters included thermophilic bacteria (Fervidobacterium and Coprothermobacter) and halophilic bacteria like Haloterrigena and Sediminibacter. This can be correlated with the climatic condition in Dubai, where the bacteria in the incoming feed may be thermophilic or halophilic as much of the water used in the country is desalinated seawater. The predominant Archaea include mainly the members of the phyla Euryarchaeota and Crenarchaeota belonging to the genus Methanocorpusculum, Metallosphaera, Methanocella, and Methanococcus. The highest population of Methanocorpusculum (more than 50% of total Archaea), and other hydrogenotrophic archaea, is in agreement with the high population of bacterial genera Acetobacteroides (Blvii28) and Fervidobacterium, capable of fermenting organic substrates into acetate and H2. Coprothermobacter, which is known to improve protein degradation by establishing syntrophy with hydrogenotrophic archaea, is also one of the digesters' dominant genera. The results suggest that the microbial community in three full-scale anaerobic digesters is different. To best of our knowledge this is the first detailed report from the UAE.
Understanding the microbial communities in anaerobic digesters, especially bacteria and archaea, is key to its better operation and regulation. Microbial communities in the anaerobic digesters of the Gulf region where climatic conditions and other factors may impact the incoming feed are not documented. Therefore, Archaeal and Bacterial communities of three full-scale anaerobic digesters, namely AD1, AD3, and AD5 of the Jebel Ali Sewage water Treatment Plant (JASTP) were analyzed by Illumina sequencing of 16S rRNA genes. Among bacteria, the most abundant genus was fermentative bacteria Acetobacteroides (Blvii28). Other predominant bacterial genera in the digesters included thermophilic bacteria (Fervidobacterium and Coprothermobacter) and halophilic bacteria like Haloterrigena and Sediminibacter. This can be correlated with the climatic condition in Dubai, where the bacteria in the incoming feed may be thermophilic or halophilic as much of the water used in the country is desalinated seawater. The predominant Archaea include mainly the members of the phyla Euryarchaeota and Crenarchaeota belonging to the genus Methanocorpusculum, Metallosphaera, Methanocella, and Methanococcus. The highest population of Methanocorpusculum (more than 50% of total Archaea), and other hydrogenotrophic archaea, is in agreement with the high population of bacterial genera Acetobacteroides (Blvii28) and Fervidobacterium, capable of fermenting organic substrates into acetate and H2. Coprothermobacter, which is known to improve protein degradation by establishing syntrophy with hydrogenotrophic archaea, is also one of the digesters' dominant genera. The results suggest that the microbial community in three full-scale anaerobic digesters is different. To best of our knowledge this is the first detailed report from the UAE.
The process of anaerobic digestion is a multistep microbial process that includes the microbes mediated breakdown of organic matter to produce CO2, CH4, and H2O by a complex microbial community including archaea and bacteria. These products can be used as biogas, which can be further processed to generate electricity or fuel for transportation [1, 2]. The energy obtained from anaerobic digesters can also be used for the operation of the wastewater treatment plant itself [3]. Due to these possible applications of the gases and the rising cost of conventional fossil fuels, the anaerobic digestion process is emerging as one of the most sustainable methods for the management of organic waste [4]. The process is already being used for the generation of renewable energy in many countries worldwide [5]. Besides, anaerobic digestion is of environmental significance as it helps manage waste and reduce greenhouse gases [6]. There are, however, clear challenges in translating the technology for simple commercial applications and general use [7]. One of the reasons is the complexity of the microbial community involved in the process, making it difficult to understand the specific roles of different bacteria and their maintenance as consortia [8, 9]. Therefore, it is important to understand the roles of various microorganisms in the process of anaerobic digestion.During the conversion of organic wastes into CH4 gas, a number of microbial processes are involved [10]. The anaerobic digestion process involves the following basic steps: the breakdown of complex organic compounds to simple organic molecules, the conversion of these simple organic molecules to organic acids (acidification), and the conversion of these organic acids into CH4 gas. Methanogens are also of two major types: hydrogenotrophic and acetolactic, depending on the type of substrate they utilize for CH4 production. Each of these processes is carried out by different microorganisms in the presence of various other unrelated microorganisms. The complex interplay between these microorganisms may influence these processes adversely or favorably. Multiple factors influence the composition of the microbial community present in the anaerobic digesters [11]. One important factor can be the microbial community in the feed of the anaerobic digester, which influences the anaerobic digester’s microbial community [12, 13]. The composition of the microbial community in the feed can also change with environmental conditions. It has been demonstrated earlier that environmental conditions affect the type of methanogens present in anaerobic digesters [14].Although several studies have reported the microbial community associated with full-scale anaerobic sludge systems worldwide, exhaustive research based on next-generation sequencing describing the microbial community structure in full-scale anaerobic sludge digesters of the UAE and other wastewater treatment plants (WWTPs) in the Gulf is missing. It is also essential to understand the microbial community in these WWTPs due to two main reasons. First, the climatic conditions in these countries are different, and secondly, much of the water used is desalinated water from the sea, which may influence the microbial community in the incoming feed, consequently affecting the process of digestion. Knowledge of the microbial community in these digesters and its role in the anaerobic digestion process can help in improving the performance of WWTPs, not only in Dubai but also in the whole Gulf region, sharing similar climatic conditions and water resources. Since JASTP is one of the two main municipal sewage treatment plants operating in Dubai, its successful operation is of critical importance. Both treated wastewater and digested sludge produce are reused for various purposes. The biogas produced by anaerobic digesters is partly utilized to maintain digester temperature and run the boiler systems. Dubai also has future plans to use biogas produced from these WWTPs. Therefore, we have previously reported the microbial community in these digesters using the fluorescent in situ hybridization and quantitative PCR technique [15]. Here we report a comprehensive mapping of key microbial operational taxonomic units present in these digesters. To the best of our knowledge, the microbial community of these anaerobic digesters is not documented, especially using next-generation sequencing approaches like Illumina sequencing. Therefore, this study reports a preliminary analysis of the microbial community present in the anaerobic digesters of JASTP, including bacteria and archaea, using Illumina sequencing.
Materials and methods
Sampling
Ten waste sludge samples were collected from three anaerobic digesters (AD1, AD3 & AD5) of the Jebel Ali Sewage Water Treatment Plant (JASTP) over a period from September 2016 to February 2017. JASTP is one of the two municipal wastewater treatment plants in Dubai, which serves a population of approximately 3.37 million and processes 375,000 m3 of wastewater per day. The three AD systems chosen for this study are operating for a long time and are considered representative digesters of JASTP and Dubai. Furthermore, the sludge produced during anaerobic digestion is used as a biofertilizer in public parks and local agricultural farms in Dubai. All three digesters had a capacity of 7433 m3 and operated at a mesophilic temperature ranging between 32–37°C [15]. The digesters were fed with 60 and 40% of raw and activated sludge, respectively. Details on the configuration and characteristics of the digesters are listed in Table 1.
Table 1
Characteristics and configuration of anaerobic digestors.
Characteristics of digester
Digester number
AD1
AD3
AD5
Type of digester
CSTRa
CSTR
CSTR
Operating temperature
mesophilic
mesophilic
mesophilic
Input feed
RSb-60%
RS-60%
RS-60%
ASc-40%
AS-40%
AS-40%
Digester capacity (m3)
7433
7433
7433
Digester feeding rate (m3/day)
2248
2148
2552
Solid retention time (Days)
16
16
16
Hydraulic Retention time (Days)
3.3
3
2.91
Upflow Velocity (m3/hr)
120
120
120
Organic loading rate (Kg. ODS/m3. d)
6.84
5.84
6.61
aCSTR = continuously stirred tank reactors
bRS = raw sludge
cAS = activated sludge
aCSTR = continuously stirred tank reactorsbRS = raw sludgecAS = activated sludgeThe samples used for extraction of genomic DNA for Illumina sequencing were collected simultaneously with other samples used in our previously published studies involving fluorescence in situ hybridization (FISH) and real-time PCR assay. The samples collected from three anaerobic digesters were designated asAD1, AD3, and AD5. Temperature, pH, and electrical conductivity (EC) were measured in sludge samples at the time of collection using HORIBA U-50 Multi Water Quality Checker (HORIBA Instruments Incorporated, USA). The collected samples were stored at 4°C until DNA extraction.
Genomic DNA extraction
Genomic DNA was extracted in triplicate from the sludge samples using the Power Soil DNA Extraction Kit (MO Bio Laboratories, Inc., Solana Beach, CA). The composite samples were vortexed and then centrifuged at 4000 rpm for 5 min. DNA was then extracted from 0.25g of pellet according to the manufacturer’s protocol. The extracted DNA was stored at -20°C until further use. DNA concentration and purity were checked using a Qubit fluorometer (Thermo Fisher Scientific, USA).
Illumina sequencing of samples
The diversity of bacterial and archaeal communities in the samples was determined by amplifying the V3-V4 regions of bacterial and archaeal 16S ribosomal RNA (rRNA) genes. Briefly, quality check of the extracted genomic DNA samples was performed by quantification using the Qubit DNA BR Assay kit (Thermo Fisher Scientific, USA Cat#Q32853). For the generation of 16S amplicon, the extracted DNA samples were diluted to 10 ng and were amplified for 16S (~1500 bp) using 16S (5’ AGAGTTTGATCCTGGCTCAG 3’), & 16S reverse primers (5’ GGTTACCTTGTTACGACTT 3’), positive control (internal metagenomic DNA sample), and no template control. These amplicons were checked on 1% agarose gel. To generate V3-V4 amplicon, 16S amplicon was used as a template with all the samples subjected to V3-V4 amplification (~460 bp) using V3-V4 forward and V3-V4 reverse primers (primer sequences V3-V4-forward 5’ CCTACGGGNGGCWGCAG 3’ and V3-V4 reverse 5’ GACTACHVGGGTATCTAATCC 3’) and a positive control (internal metagenomic DNA sample), without template control [16]. The amplicons were checked on 1% agarose gel. The V3-V4 amplicons were then cleaned using AMPure XP beads (Beckman Coulter, CA, USA, Cat# A63882) to get rid of non-specific fragments. The V3-V4 products were used for DNA library preparation using NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolab, UK, Cat# E7370L). First, the amplicons were end-repaired and mono-adenylated at the 3’ end in a single enzymatic reaction. Next, NEB hairpin-loop adapters are ligated to the DNA fragments in a T4-DNA ligase-based reaction. Following ligation, the loop containing Uracil is linearized using USER Enzyme (a combination of UDG and Endo VIII), to make it available as a substrate for PCR-based indexing in the next step. During PCR, barcodes were incorporated using unique primers for each of the samples, thereby enabling multiplexing. The prepared libraries were checked for fragment distribution using D1000 Screen Tapes (Cat# 5067–5582, Agilent, CA, USA) and reagents (Cat# 5067–5583, Agilent, CA, USA). The obtained libraries were pooled and diluted to the final optimal loading concentration before cluster amplification on the Illumina flow cell. Once the cluster generation is completed, the clustered flow cell is loaded on Illumina HiSeq2500 instrument (Illumina, Inc., San Diego, USA) for amplicon sequencing to generate 0.5M, 250 bp paired-end reads per sample using the pair-end approach.
Bioinformatics and statistical analyses
The bioinformatics analysis was carried out using standard methods. Briefly, the following steps were involved. Quality checking of the raw fastq files was carried out using FASTQC to check for the base quality, base composition, and GC content. The sequence reads were trimmed using fastq-mcf to retain only high-quality sequences for further analysis, and the low-quality sequence reads were excluded from the analysis. Sequences were assembled using forward and reverse sequences of the V3-V4 region. Spacer and conserved regions were removed from paired-end reads. Dereplication and the identification of the sequences were carried out using USEARCH. The UCHIME utility from USEARCH was used to remove chimeras using the de novo approach [17]. One representative sequence from each OTU was picked for taxonomic classification using the RDP classifier against the green gene database at 97% similarity. OTUs thus determined were aggregated at the genus level, and all the downstream processing was carried out at the genus level until unless otherwise mentioned. The raw sequences have been deposited in the National Center for Biotechnology Information (NCBI Bethesda MD, 20894 USA) under Bio-Project accession number PRJNA602372. Alpha diversity in the samples was calculated using the online Calypso program. Two diversity indices, namely Shannon and Chao1 diversity indices, were used to indicate alpha diversity. Venn diagrams showing the genera shared by different samples based on the tables of shared OTUs were also prepared using Calypso. Heat maps were also plotted using calypso, as described earlier [18]. SPSS software version 26 (IBM Corp. Chicago, IL, USA) was used to determine correlations between physicochemical parameters and the predominant bacterial and archaea genera present in the sludges using bivariate Pearson’s coefficient of correlation with a level of significance 0.05.
Results and discussion
Physicochemical conditions of anaerobic digesters
The physicochemical conditions of the digester operation are given in Table 2.
Table 2
Physicochemical parameters of anaerobic digesters samples.
Digester
Temperature (°C)
pH
EC (mS cm- 1)
Dry solids (% [wt/vol])
Volatile solids (% [wt/wt] of TS)
Volatile fatty acids (mg HAc/L)
Dissolved sulfide (mg/L)
Alkalinity (mg/L)
AD1
33–34.3
7.13–7.33
9.77–13.45
2.91–3.34
70.27–70.95
177–195
30.6–38
3014–3249
AD3
34.2–34.5
7.22–7.55
11.71–14.44
2.56–5.74
43.75–70.15
153–205
32.40–37.20
2992–3512
AD5
32.9–34.4
7.36–7.50
12.33–15.46
2.79–3.54
50.3–67.49
145.5–195
16.80–47.20
2893–3498
aminimum-maximum range
aminimum-maximum rangeAll three digesters were operated in almost similar physicochemical conditions of mesophilic temperature (34°C) and a neutral pH range of 7.13–7.55. Among the three digesters, however, AD3 had a relatively low organic loading rate of 5.84 kg. ODS/m3.d compared to AD1 (6.84 kg. ODS/m3. d) and AD5 (6.61 kg. ODS/m3. d). The electrical conductivity (EC) of all sludge digestors was found to be towards the higher range. The highest conductivity of sludge samples was found for AD5 (12.33–15.46 mS cm-1) followed by AD3 (11.71-14.44 mS cm-1) and AD1 (9.77–13.45 mS cm-1). The EC value range found in this study was similar to that observed in another study in Austria evaluating the effects of various co-substates on the microbial community composition of full-scale anaerobic digesters fed with or without co-substrates [19]. Overall, all three anaerobic digesters showed acceptable levels of the main operational parameters and were performing stably during the sampling period.
Bacterial community in the anaerobic digesters
The reads per sample varied between 1 million and 1.6 million. After quality filtering, 60% of the total reads were removed, resulting in an average of 0.6 million reads per sample. The sequences were assigned to OTUs based on 97% sequence similarities. The detected OTUs were assigned to 33 phyla, 64 classes, 99 orders, 116 families, and 107 genera. Bacteroidetes, Firmicutes, Synergistetes, Theromotogae, OP8, and Chloroflexi were dominant in all the digesters, accounting for 90.85% of all sequences (Fig 1).
Fig 1
The relative abundance of different bacterial phyla in the three anaerobic digester samples.
Bacteroidetes were found to be the most abundant phylum (41.44%), followed by Firmicutes (23.42%), Synergistetes (7.22%), Thermotogae (6.70%), Chloroflexi (6.69%), and OP8 (5.3%). Other phyla, with a population of >1% were Actinobacteria (3.1%), Proteobacteria (1.4%), and WWE1 (1.21%). The overall abundance of bacterial community phyla observed is similar to those from anaerobic sludge digester samples in previous studies [19, 20]. However, unlike these studies, the percentages of Bacteroidetes (41.44%) detected in this study were significantly high, and the population of proteobacteria was very low (1.4%). The higher population of Bacteroidetes phyla can be associated with high hydrolytic activity in full-scale anaerobic digesters [21]. Degradation of macromolecules is the first step in the digestion process, and a high population of Bacteroidetes indicates effective degradation (Fig 2).
Fig 2
Abundant microbial genera and their possible involvement in the process of anaerobic digestion.
A study reported the effect of high salinity on reducing the abundance of members of Bacteroidetes and Chlorflexi [22]. However, in our study, despite high electrical conductivity, indicative of higher salt concentration observed in three digesters, the population of Bacteroidetes remained high i.e., in the range of 44.86% (AD1), 45.95% (AD3), and 35.49% (AD5). The Synergistetes phylum was found to be abundant in AD1 (18.67%) compared to AD 3 (2.76%) and AD5(1.98%). The members of Synergistetes phyla are known to use amino acids for producing short-chain fatty acids and sulphate to methanogens and sulphate-reducing bacteria [23]. The members of the fourth most abundant phyla Thermotogae were previously reported to be linked to polysaccharide fermentation and hydrogen production, which may promote the population of hydrogenotrophic methanogens, as shown in Fig 2 [24]. A previous study has also reported the syntrophic association between methanogenic archaea and the members of Thermotogae [25].A total of 108 bacterial genera were detected in all three samples studied. In addition to these genera, many of the bacteria were grouped asunknown bacteria. Alpha diversity calculated based on the populations of various genera in these samples in terms of Shannon (p = 0.72) and Chao1 (p = 0.48) indices are shown in Fig 3A and 3B, respectively.
Fig 3
Boxplot of Shannon index (A) and Chao 1 (B) showing Alpha diversity in the three anaerobic digesters (AD1, AD3, and AD5) calculated based on the populations of different bacterial genera.
Boxplot of Shannon index (A) and Chao 1 (B) showing Alpha diversity in the three anaerobic digesters (AD1, AD3, and AD5) calculated based on the populations of different bacterial genera.The figures show that the lowest diversity is observed in the AD1 sample, followed by AD3 and AD5. Members of 51 bacterial genera were found to constitute the core microbiome of the three digesters studied (Fig 4A). Some of the predominant genera include Acetobacteroides (Blvii28), Coprothermobacter, Fervidobacterium, Clostridium, Caldilinea, Allochromatium, Sediminibacter, and T78 (Fig 4B).
Fig 4
Panel A: Venn diagram showing the core microbiome and number of genera shared by the samples. Panel B: shows heat map of hierarchical clustering of twenty genera with the highest mean relative abundance across the three anaerobic digesters.
Panel A: Venn diagram showing the core microbiome and number of genera shared by the samples. Panel B: shows heat map of hierarchical clustering of twenty genera with the highest mean relative abundance across the three anaerobic digesters.Most of these genera are associated with an anaerobic digester; some have also been reported from anaerobic digester earlier also [26]. Acetobacteroides (Blvii28) was the genus with the highest population. The cultured representative members of the genus are known to produce acetate, H2, and CO2as fermentation end-products [27]. As shown in Fig 2, this bacterium may be involved in the production of acetate, H2 and CO2, playing an important role in digestion and promoting the growth of hydrogenotrophic methanogens. T78 possibly metabolizes carbohydrates and alcohol via syntrophic interactions [28]. Many of the predominant bacteria found in this study were thermophilic or halophilic. The presence and dominance of diverse halotolerant bacteria with hydrolytic and acidogenic abilities adapted to the high salt concentrations has been reported earlier [22].Coprothermobacter, a known proteolytic anaerobic thermophilic bacteria, is found in many thermophilic anaerobic digesters [29]. This genus can improve protein degradation by establishing syntrophy with hydrogenotrophic archaea [29]. Other thermophilic bacteria found, include Fervidobacterium and Caldilinea that are known to ferment carbohydrates to lactate, acetate, hydrogen, and carbon dioxide, as shown in Fig 2 [30, 31]. The genus Sediminibacter, initially isolated from a sediment sample, was also found as one of the dominant genera [32]. Since most of the water used in Dubai is obtained from the sea after desalination, the incoming feed may contain such bacteria [33, 34].Interestingly, Sediminibacter has a unique light-driven sodium ion pump that helps in its survival in the marine habitat [35]. Several purple sulfur bacteria like Allochormatium and Thermotogales AUTHM297 were also part of the digester microbial communities. Desulfomicrobium and Desulfobacter were the two most dominant sulfate-reducing bacterial (SRB) genera. In our previous study, we have reported consistently high populations of these two genera in the same digesters as detected by fluorescent in-situ hybridization [36]. Notably, Desulfomicrobium is also known to be associated with the marine habitat [37]. The statistical correlation analysis between physicochemical parameters and bacterial genera indicated that the population of Planctomyces was significantly correlated with dry solids. In contrast, the W5 genus was associated with the anaerobic digester’s operating pH (S1 Table).Anaerobic digestion involves the degradation of complex organic matter to simple organic compounds, most likely carried out by the members of the phyla Bacteroidetes, Firmicutes, Proteobacteria, Synergistetes, and Thermotogae. Previous studies also demonstrate the presence of these phyla in anaerobic digesters as macromolecules-degrading bacteria [26]. Mycobacterium, which is associated with the production of Lipases and Lipolytic activity, producing fatty acids was also present in high numbers. Another important process of anaerobic digestion is acidogenesis, wherein bacteria convert organic monomers into acids like acetic, propionic, and butyric acids (Fig 2).The populations of acidogenic bacteria like Acetobacteroides, Fervidobacterium, Clostridium, and Paludibacter producing acetate, lactate, or propionate were high in the digesters as reported above. The conversion of these organic molecules to methane (CH4) is carried out mainly by archaea. However, some bacteria may influence the production of CH4 by competing with the acetoclastic methanogens. An example of such acetate-utilizing uncultured bacteria is the Synergistes group 4 [38].
Archaea in the anaerobic digesters
When analysed at the genus level, the highest diversity was observed in digester AD5, followed by AD1 and AD3. This was also evident from Shannon index’s, and Chao 1 values obtained for AD1 followed by AD3 and AD5 (Fig 5A and 5B). The boxplot of Shannon (A) and Chao 1 (B) indices was calculated based on the populations of different archaeal genera (AD1, AD3, and AD5).
Fig 5
The alpha diversity of archaea, Shannon (A), and Chao 1 (B) indices.
The alpha diversity of archaea, Shannon (A), and Chao 1 (B) indices.The predominant archaea in the three digesters were the members of the phylum Euryarchaeota, followed by Crenarchaeota. The three digesters share a core archaeal microbiome of 18 genera (Fig 6A). The population of hydrogenotrophic archaea was clearly high in the digesters. Methanocorpusculum alone constitutes more than 50% of the total population. The predominant core genera of archaea included Metallosphaera, Methanocella, Methanococus, Acidianus, Natronobacterium, and others. Metallosphaera was significantly correlated with the dry solids parameter of the anaerobic digesters (S2 Table).
Fig 6
Panel A: Venn diagram showing the core Archaeal genera present in the three anaerobic digesters (AD1, AD3, and AD5) and the number of genera shared by different digesters. Panel B: Heat map of hierarchical clustering of twenty archaeal genera with the highest mean relative abundance across the three anaerobic digesters.
Panel A: Venn diagram showing the core Archaeal genera present in the three anaerobic digesters (AD1, AD3, and AD5) and the number of genera shared by different digesters. Panel B: Heat map of hierarchical clustering of twenty archaeal genera with the highest mean relative abundance across the three anaerobic digesters.Fig 6B shows the heat map of predominant archaea in the three digesters. Methanocorpusculum is one of the hydrogenotrophic methanogens which was isolated for the first time from the biodigester of the wastewater treatment plant [39]. This archaea genus and other hydrogenotrophic methane-producing archaea may utilize the H2 produced by a predominant bacterial genus (Acetobacteroides; Blvii28) were present in the digesters (Fig 2). Interestingly, the population of Acetobacteroides (Blvii28) was significantly related to the population of many other predominant hydrogenotrophic archaea in the digesters, including Methanococcus and Methanothermus (S3 Table). The analysis shows that the population of Methanocorpusculum was also significantly correlated with the population of Coprothermobacter, which is known to improve protein degradation by establishing a syntrophic relationship with the hydrogenotrophic archaea (S3 Table).While the second most predominant genus was Metallosphaera, an extreme thermoacidophile with optimal growth at 74°C and pH 2.0 [40], Methanocella was the third most dominant genus and is a mesophilic, hydrogenotrophic methanogen [41]. At the same time, Methanococus is also a thermophilic hydrogenotrophic methanogen. At least one species of the genus is also known to fix nitrogen [38]. The Methanothermus fervidus species found abundantly are hyperthermophiles methanogen, reported for thermophilic anaerobic digestion of wastewater sludge [42]. Several non-methanogenic archaeal genera members were found in very high populations in our study. Notable among these were genera Acidianus, an archaeal genus found to inhabit halophilic, hyperthermophilic, and acidic environments. One of the unique genera of extremophile detected in our study was Natronobacterium, a haloalkaliphilic archaeon found in extremely hypersaline lakes [43]. Natronobacterium gregoryi species found in this study have not been reported from anaerobic digesters operating at mesophilic temperatures and neutral pH. The genus Natronobacterium are facultative anaerobes with the capability to reduce sulfur under extremely halophilic and alkaline conditions [44]. The archaeal genus Ferroplasma is known to grow at highly acidic pH levels and tolerate heavy metals such asCu. As, Cd, Zn. This was another genus of extremophilic archaea that showed predominance in our study [45].The studied digesters contained high populations of the Crenarchaeota genera Metallosphaera, Acidianus, and Sulfolobus. These genera contain thermophilic enzymes involved in the conversion of CO2 into liquid fuels and industrial chemicals and hence can be engineered for the production of value-added compounds like 3-hydroxypropionate or n-butanol [46]. Candidatus Nitrosocaldus, a novel ammonia-oxidizing archaea genus, was among the top 14 dominating genera found in this study. The genus is a member of the phylum Thaumarchaeota and is generally found in geothermal environments [47]. However, recently its presence in the anaerobic digester has been reported [48].It is clear from the analysis that a unique and atypical microbial community exists in the anaerobic digesters studied. The degradation is carried out by the members of various phylum reported earlier. These include the members of the phyla Bacteroidetes, Firmicutes, Proteobacteria, Synergistetes, and Thermotogae [13]. In contrast, a number of genera mainly involved in the conversion of these organic substrates into acetate, butyric acid, propionate, and H2 were found in the anaerobic digesters. Euryarchaeota, mainly the hydrogenotrophic methanogens, were found as predominant members (Fig 6). Although the digesters were operated under mesophilic conditions, many thermophilic genera of bacteria and archaea were found to predominate.Furthermore, high populations of various halophilic and acidophilic bacteria and archaea were also detected. This may be due to the presence of such bacteria in the incoming feed, as most of the water used in Dubai is obtained from the sea and is used after desalination. Whether such bacteria are initially present in the incoming feed is a matter of future investigation. Similar observations were made in an earlier study that demonstrated how the incoming feed shapes the microbial community structure in anaerobic digesters [49], through the use of different microbial inoculants. Our study here argues that the microbial community present in the incoming feed is influenced by local environmental conditions, which consequently play important roles in shaping the microbial community in anaerobic digesters.
Conclusions
The bacterial and archaeal community structure of three full-scale anaerobic sludge digesters of a municipal sewage treatment plant in Dubai, UAE, were compared using Illumina sequencing of 16S rRNA genes. Bacteroidetes, Firmicutes, Synergistetes, Theromotogate, OP8, and Chloroflexi were dominant bacterial phyla in all the digesters. The highest diversity was observed in AD5, followed by AD3 and AD1. The predominant archaea included mainly the members of phyla Euryarchaeota and Crenarchaeota. Members of the genus Methanocorpusculum, Metallosphaera, Methanocella, and Methanococcus were predominant. The highest diversity of archaea was also observed in AD5, followed by AD3 and AD1. The presence of many thermotolerant and halotolerant bacteria and archaea in the anaerobic digesters may be due to the influence of environmental conditions on the incoming feed sludge. The anaerobic digesters were also characterized by a high population of bacteria known to ferment organic substrates to acetate and H2. The high population of hydrogenotrophic archaea can utilize the H2 produced by these bacteria. Comparison of microbial communities in these three digesters shows that they contain a core, stable, and functional microbial community as all digesters were operated under more or less similar physicochemical conditions. Furthermore, understanding the microbial communities in these digesters can help design strategies for the better performance of the digesters in Dubai and neighbouring countries sharing similar climatic conditions and water resources.
Correlation between bacterial genera and physicochemical parameters.
(XLSX)Click here for additional data file.
Correlation between archaeal genera and physicochemical parameters.
(XLSX)Click here for additional data file.
Correlation between archaeal and bacterial genera.
(XLSX)Click here for additional data file.29 Jan 2021PONE-D-20-37224Illumina sequencing of 16S rRNA genes reveals a unique microbial community in three anaerobic sludge digesters of Dubai.PLOS ONEDear Dr. Khan,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Mar 05 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,William J BrazeltonAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.4.Thank you for stating the following in the Funding Section of your manuscript:"This work was supported by Zayed University Microbial Diversity and Ecogenomics Research Cluster Project (Grant code: R16092)."We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."Please include your amended statements within your cover letter; we will change the online submission form on your behalf.Additional Editor Comments:Both reviewers recommend rejection, but one of their key reasons for rejection, "significance", is not a valid reason for rejection from PLoS ONE. Moreover, I think that the reported data could be valuable contributions to the public databases and to the literature if properly discussed in the paper. Therefore, if you can make substantial revisions to the manuscript that address the reviewers' concerns, then I will consider a heavily revised manuscript. The revised manuscript must explain how the current study is related to previous work with the same or similar samples. It must attempt to interpret the results from the perspective of trying to understand the microbial processes in anaerobic digester systems, rather than simply concluding that the microbial communities are "different". All microbial communities are different from each other. All microbial communities are unique. The revised manuscript should explain how the reported microbial diversity data helps to improve our knowledge of anaerobic digesters. Finally, the authors should make their data publicly available. Currently, the provided BioProject accession is not associated with any sequence data that I can see.The issues listed above are the minimum that should be addressed for a revised manuscript to be re-submitted. If the revision does not address all of the concerns from the reviewers, then it may be rejected even after revision. If you require additional time to make all necessary revisions, an extension can be requested.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: No**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This study investigated the microbial community in three anaerobic digesters of JASTP using the Illumina sequencing. This article simply describes the species and abundance of archaea and bacteria in three anaerobic digesters. The content is relatively simple and has strong regional limitations. In addition, this study is not of great significance. Hence, it is not suggested to be published in PONE.Comments:1. What is the significance of this study to research the microbial distribution in these three anaerobic digesters? Why did the author choose these three anaerobic digesters of JASTP? Are they representative? What reference can this study provide for sludge disposal in Dubai in the future?2. “Fig 1” should be corrected as “Fig. 1”, so as the others.3. there are write mistakes in line 205, 585.4. there are some format mistakes in the References.Reviewer #2: The authors investigated the microbial community (Bacteria and Archaea) of three anaerobic digesters treating sewage water in Dubai by illumina sequencing.In my opinion, in order to be published in PLOS ONE the paper need a deep revision by the authors and, after that, a re-submission.The biggest issues are related to:Some general mistakes (eg: line 67 Methanogens (methane-producing bacteria)The lack of information about replicates, sampling period etcSome data in the results section that were already present in Khan et al. 2019 (Table 1 and 2). To this regard, I suggest to clarify if the analysed digesters and samples are the same (same extracted DNA?). Accordingly, with this I suggest to report explicitly in the discussion differences or similarities of the two experiments.Moreover, the discussion need to be deepen. As currently, that is not enough. In any case, the bacterial and archaeal populations results should be considered in relation to digester inlet (wastewater) and outlet (digestate and biogas).In my opinion, in the current form, the paper is not enough significant for the current state of the art of anaerobic digestion to be published in PLOS ONE**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.14 Feb 2021Response to Reviewer 1 CommentsComment-1: This study investigated the microbial community in three anaerobic digesters of JASTP using the Illumina sequencing. This article simply describes the species and abundance of archaea and bacteria in three anaerobic digesters. The content is relatively simple and has strong regional limitations. In addition, this study is not of great significance. Hence, it is not suggested to be published in PONE.Response:JASTP is one of the two main municipal sewage treatment plants operating in Dubai. The successful operation of JASTP is of critical importance to Dubai since both wastewater and digested sludge is reused for further application. The biogas produced by anaerobic digesters of the JASTP is partly utilized to maintain digester temperature and run the boiler systems. However, there are plans in Dubai for the future to capture and use of biogas produced during the treatment of domestic organic waste to energy. However, understanding microbial community structure and functions of anaerobic digester systems in this part of the world is lacking. The results reported in our manuscript not only describe the microbial community in these digesters but also helps us to predict the roles of various microorganisms detected in the treatment of sludge during the anaerobic digester stage of the wastewater treatment process. This knowledge will be beneficial for devising appropriate control methods, leading to more efficient operation of anaerobic digester systems of wastewater treatment plants in the UAE. Furthermore, as reported in the manuscript, microorganisms involved in the process seem to be influenced by the local environmental condition and the fact that most of the water used in the country is desalinated water from the sea. This finding has much greater implications as in most Gulf countries; the conditions are almost similar. Furthermore, so far, no such study to our knowledge is available on this aspect from the region. In light of the above discussion, the study is not merely an isolated study of some digesters in Dubai, but it will provide a basis for the whole region.Comment-2: What is the significance of this study to research the microbial distribution in these three anaerobic digesters? Why did the author choose these three anaerobic digesters of JASTP?Are they representative? What reference can this study provide for sludge disposal in Dubai in the future?Response: As discussed above JASTP is one of the two main municipal sewage treatment plants in Dubai. The three AD systems chosen for this study are operating for a long time and are considered representative digesters of JASTP and Dubai. The significance of the study is manifold, as discussed above. It is the first study of this type, which may have greater implications for the ADs of the gulf region. The climatic condition and the type of water used may influence the process of anaerobic digestion. Therefore, this study's findings not only provide a reference to the sludge disposal in Dubai but also to other gulf countries sharing similar climatic condition and water quality.Since the sludge produced during anaerobic digestion is used as a biofertilizer in public parks and local agricultural farms in Dubai. Which may further affect the soil microbial communities and soil fertility. Ensuring stable operation of the digesters is of critical importance to the city of Dubai making it necessary to understand the microbial community involved.Comment-3: “Fig 1” should be corrected as “Fig. 1”, so as the others.Response: Suggested style for citing figures for PLOS ONE journal is “Fig 1”. We have followed journal formatting style for the figures.Comment-4: there are write mistakes in line 205, 585.Response: We have corrected mistakes in line 205 and 585.Comment-5: there are some format mistakes in the References.Response: The reference format is corrected as per the PLOS One formatting style using EndNote software.Response to Reviewer 2 CommentsComment-1: The authors investigated the microbial community (Bacteria and Archaea) of three anaerobic digesters treating sewage water in Dubai by illumina sequencing.In my opinion, in order to be published in PLOS ONE the paper need a deep revision by the authors and, after that, a re-submission.Response: We have thoroughly revised the manuscript as per the reviewer's suggestion.Comment-2: The biggest issues are related to: Some general mistakes (eg: line 67 Methanogens (methane-producing bacteria)Response: This error has been corrected.Comment-3: The lack of information about replicates, sampling period etcResponse: We have included this missing information in the methodology section between lines 88 to 90.Comment-4: Some data in the results section that were already present in Khan et al. 2019 (Table 1 and 2). To this regard, I suggest to clarify if the analysed digesters and samples are the same (same extracted DNA?). Accordingly, with this I suggest to report explicitly in the discussion differences or similarities of the two experiments.Response:The samples used for extraction of genomic DNA for Illumina sequencing were different but collected simultaneously with samples used in our previous published studies involving Fluorescence in situ hybridization FISH and real-time PCR assay. JASTP laboratory has a weekly or biweekly schedule for analysis of digester operational parameters. JASTP officials provided the reported digesters parameters for that sampling period. As suggested, we have reported it clearly in the introduction section (lines 78-84).Comment-5: Moreover, the discussion need to be deepen. As currently, that is not enough. In any case, the bacterial and archaeal populations results should be considered in relation to digester inlet (wastewater) and outlet (digestate and biogas).Response: We have improved the discussion section. The collected digester samples are composite samples. There was only one accessible sampling port used for digester parameters analysis.Comment-6: In my opinion, in the current form, the paper is not enough significant for the current state of the art of anaerobic digestion to be published in PLOS ONE.Response:We have improved the manuscript considerably. We have already discussed the manifold significance of the study. The authors hope that the revised manuscript will be of great interest to its readers and attract readership, especially in the gulf region. This study will also attract readers elsewhere as there is no report to our knowledge on the Gulf region's ADs with particular regard to its climatic condition.Response to Additional Editor CommentsJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfResponse 1: We have reformatted the manuscript to meet PLOS ONE's style requirements.2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQResponse 2: The corresponding author ORCID iD has been updated in the Editorial Manager.3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.Response 3: We have added supporting table information on the last page of the manuscript and amended in-text citations of supporting information according to the journal's guidelines.4.Thank you for stating the following in the Funding Section of your manuscript:"This work was supported by Zayed University Microbial Diversity and Ecogenomics Research Cluster Project (Grant code: R16092)."We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."Please include your amended statements within your cover letter; we will change the online submission form on your behalf.Response 4: This is true that the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. However, the work would not have been possible without the generous financial support from the funding agency, that is why we want to acknowledge the funding agency. We have moved funding-related information to the acknowledgement section in the revised manuscript.Additional Editor Comments:Point 1: Both reviewers recommend rejection, but one of their key reasons for rejection, "significance", is not a valid reason for rejection from PLoS ONE. Moreover, I think that the reported data could be valuable contributions to the public databases and to the literature if properly discussed in the paper. Therefore, if you can make substantial revisions to the manuscript that address the reviewers' concerns, then I will consider a heavily revised manuscript.Response: We appreciate the opportunity provided by the editor to considerably improve our manuscript for possible publication in PlosOne. Keeping in view the comments from the editor and reviewers the manuscript has been improved significantly. I hope the revised manuscript meets the standard of PlosOne and will be published in the journal.Point 2: The revised manuscript must explain how the current study is related to previous work with the same or similar samples.It must attempt to interpret the results from the perspective of trying to understand the microbial processes in anaerobic digester systems, rather than simply concluding that the microbial communities are "different". All microbial communities are different from each other. All microbial communities are unique. The revised manuscript should explain how the reported microbial diversity data helps to improve our knowledge of anaerobic digesters.Response: The sludge samples for the next-generation sequencing analysis, FISH and qPCR analysis were collected simultaneously from the digesters. This information has been added to the revised manuscript. We agree to the editors comment, and we have elaborated the possible role of various microorganisms in the process of anaerobic digestion as also summarised in figure 4. Further information on the role of these microorganisms in the process of anaerobic digestion is also added to the revised manuscript, especially in the discussion section. We have concluded in the manuscript that the processes are mediated by the halophilic and/or thermophilic microorganisms which may be due to the influence of the local climatic condition. This study, therefore, is a primer for the possible role of microorganisms in the process of anaerobic digestion in gulf region. In future studies, we can try to isolate such halophilic or thermophilic bacteria from local environment that can help to improve the process of anaerobic digestion. In future we will do metagenome based study of the same digesters to understand the functional aspects more clearly.Point 3: Finally, the authors should make their data publicly available. Currently, the provided BioProject accession is not associated with any sequence data that I can see.The issues listed above are the minimum that should be addressed for a revised manuscript to be re-submitted. If the revision does not address all of the concerns from the reviewers, then it may be rejected even after revision. If you require additional time to make all necessary revisions, an extension can be requested.Response: We have updated the deposited Nucleotide sequences files in the National Center for Biotechnology Information (Accession no. SRX10004771-SRX10004780) under the Bio-Project ID: PRJNA602372 on February 3, 2021. The sequence data records are now open to the public and accessible with the following link:https://www.ncbi.nlm.nih.gov/sra/PRJNA602372Submitted filename: Authors response to Academic editor.docxClick here for additional data file.22 Feb 2021PONE-D-20-37224R1Illumina sequencing of 16S rRNA genes reveals a unique microbial community in three anaerobic sludge digesters of Dubai.PLOS ONEDear Dr. Khan,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Thank you for revising the manuscript. The revision addresses some but not all of the reviewer concerns. The responses to the reviewer's comments (e.g. the general importance of this study for effective wastewater management in Dubai and why these digesters were chosen) are not fully reflected in the text. Please ensure that the points made in your responses to the reviewers are also in the manuscript text. Also, Figure 4 contains a nice summary of some key results, but this figure is only briefly cited in the text. Please incorporate this figure more fully into the Results and Discussion. Finally, please check the entire manuscript for English grammar. For example, multiple sentences beginning with "Although" and "But" are not complete sentences.Please submit your revised manuscript by Apr 08 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,William J BrazeltonAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.][NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.28 Feb 2021Response to Reviewer’s /Additional Editor CommentsComment: Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Response: Authors thank the reviewers for providing an opportunity to revise the manuscript. The manuscript is thoroughly revised keeping in view the suggestions of reviewers and academics editor. Manuscript is also considerably improved to avoid grammatical, language and editing mistakes.Comment: Thank you for revising the manuscript. The revision addresses some but not all of the reviewer concerns. The responses to the reviewer's comments (e.g. the general importance of this study for effective wastewater management in Dubai and why these digesters were chosen) are not fully reflected in the text. Please ensure that the points made in your responses to the reviewers are also in the manuscript text.Response: The manuscript is revised to include the importance of the study in the manuscript text. Furthermore, we have also modified the manuscript to include the changes suggested by reviewers earlier.Comment: Also, Figure 4 contains a nice summary of some key results, but this figure is only briefly cited in the text. Please incorporate this figure more fully into the Results and Discussion.Response: A detailed and duly discussion on figure 4 (now figure 2) is now included in the revised manuscript. Figure 4 is renamed as figure 2 to follow the in-text figure sequence style of the journal.Comment: Finally, please check the entire manuscript for English grammar. For example, multiple sentences beginning with "Although" and "But" are not complete sentences.Response: The manuscript is thoroughly checked for grammatical and editing mistakes by a native speaker. The authors hope that the language is significantly improved in the revised manuscript.Submitted filename: Author response to reviewers-2nd-revision.docxClick here for additional data file.10 Mar 2021Illumina sequencing of 16S rRNA genes reveals a unique microbial community in three anaerobic sludge digesters of Dubai.PONE-D-20-37224R2Dear Dr. Khan,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,William J BrazeltonAcademic EditorPLOS ONEAdditional Editor Comments (optional):Thank you very much for responding to all of the comments and concerns. I think the manuscript is much improved, and I hope you agree. Best wishes.23 Mar 2021PONE-D-20-37224R2Illumina sequencing of 16S rRNA genes reveals a unique microbial community in three anaerobic sludge digesters of Dubai.Dear Dr. Khan:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. William J BrazeltonAcademic EditorPLOS ONE
Authors: Valerio Paolini; Francesco Petracchini; Marco Segreto; Laura Tomassetti; Nour Naja; Angelo Cecinato Journal: J Environ Sci Health A Tox Hazard Subst Environ Eng Date: 2018-04-13 Impact factor: 2.269
Authors: Anne Daebeler; Craig W Herbold; Julia Vierheilig; Christopher J Sedlacek; Petra Pjevac; Mads Albertsen; Rasmus H Kirkegaard; José R de la Torre; Holger Daims; Michael Wagner Journal: Front Microbiol Date: 2018-02-14 Impact factor: 5.640