Chronic obstructive pulmonary disease (COPD) is a major cause of morbidity and mortality worldwide. The major bacterial cause of COPD exacerbations is non-typeable Haemophilus influenzae (NTHi). 25 to over 80% of cases are associated with NTHi. This susceptibility to infection involves a defective production of interleukin (IL)-22 which plays an important role in mucosal defense. Prophylactic administration of flagellin, a Toll-like receptor 5 (TLR5) agonist, protects healthy mice against respiratory pathogenic bacteria. We hypothesized that TLR5-mediated stimulation of lung immunity might prevent COPD exacerbations. Mice chronically exposed to cigarette smoke (CS), which presented COPD symptoms, were infected with NTHi and intraperitoneally treated with recombinant flagellin following a prophylactic or therapeutic protocol. Compared with control, cigarette smoke-exposed mice treated with flagellin showed a lower bacterial load in the airways, the lungs and the blood. This protection was associated with an early neutrophilia, a lower production of pro-inflammatory cytokines and an increased IL-22 production. Flagellin treatment decreased the recruitment of inflammatory cells and the lung damages related to exacerbation. Morover, the protective effect of flagellin against NTHi was altered by treatment with anti-IL-22 blocking antibodies in cigarette smoke-exposed mice and in Il22-/- mice. The effect of flagellin treatment did not implicated the anti-bacterial peptides calgranulins and defensin-β2. This study shows that stimulation of innate immunity by a TLR5 ligand is a potent antibacterial treatment in CS-exposed mice, suggesting innovative therapeutic strategies against acute exacerbation in COPD.
Chronic obstructive pulmonary disease (COPD) is a major cause of morbidity and mortality worldwide. The major bacterial cause of COPD exacerbations is non-typeable Haemophilus influenzae (NTHi). 25 to over 80% of cases are associated with NTHi. This susceptibility to infection involves a defective production of interleukin (IL)-22 which plays an important role in mucosal defense. Prophylactic administration of flagellin, a Toll-like receptor 5 (TLR5) agonist, protects healthy mice against respiratory pathogenic bacteria. We hypothesized that TLR5-mediated stimulation of lung immunity might prevent COPD exacerbations. Mice chronically exposed to cigarette smoke (CS), which presented COPD symptoms, were infected with NTHi and intraperitoneally treated with recombinant flagellin following a prophylactic or therapeutic protocol. Compared with control, cigarette smoke-exposed mice treated with flagellin showed a lower bacterial load in the airways, the lungs and the blood. This protection was associated with an early neutrophilia, a lower production of pro-inflammatory cytokines and an increased IL-22 production. Flagellin treatment decreased the recruitment of inflammatory cells and the lung damages related to exacerbation. Morover, the protective effect of flagellin against NTHi was altered by treatment with anti-IL-22 blocking antibodies in cigarette smoke-exposed mice and in Il22-/- mice. The effect of flagellin treatment did not implicated the anti-bacterial peptides calgranulins and defensin-β2. This study shows that stimulation of innate immunity by a TLR5 ligand is a potent antibacterial treatment in CS-exposed mice, suggesting innovative therapeutic strategies against acute exacerbation in COPD.
Chronic obstructive pulmonary disease (COPD) is characterized by a progressive and irreversible decline in lung function [1]. Being the third leading cause of death worldwide, it is mainly caused by chronic exposure to cigarette smoke (CS) or pollutants [2]. Inhalation of CS essentially leads to activation of epithelial cells and macrophages responsible for the mobilization of effector and immuno-modulatory cells including neutrophils and natural killer T (NKT) cells [3,4]. The chronic inflammatory response progressively leads to airway remodeling, impaired bacterial clearance and parenchymal destruction in the lungs, further culminating in irreversible airflow limitation [5] as experienced in our murine model of chronic exposure to CS. These components are involved in the increased susceptibility of COPDpatients to bacterial and viral airway infections.Airway colonization with bacteria such as Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis contributes to the pathogenesis and clinical course of the disease [6]. This colonization is responsible for lung infection leading to exacerbations of the disease, which have a strong impact on health status, exercise capacity, lung function, and mortality. Non-typeable Haemophilus influenzae (NTHi), a Gram-negative coccobacillus that lacks a polysaccharide capsule, is an important cause of COPD exacerbations and comorbidity [7,8]. Acute exacerbations in patients invariably scarred the chronic course of COPD [9]. Bacterial infections are first controlled by the innate immune system, which implicated pathogen-associated molecular pattern (PAMP) recognition by Toll-like receptors (TLR) such as those recognizing flagellin (TLR5) responsible for the mobilization of effector cells [10]. During COPD, bacterial infection is characterized by an increased influx of immune cells, including neutrophils, macrophages, dendritic cells (DC) and T lymphocytes [3,11,12]. However, this response is not effective enough to clear the pathogens. In this context, we recently reported a defective production of IL-22 in response to bacteria both in COPDpatients and mice chronically exposed to CS, whereas IL-17 production is only altered after infection by S. pneumoniae [13,14]. Interestingly, the Th17 cytokines IL-17 and IL-22 promote the recruitment of neutrophils, the synthesis of antimicrobial peptides and the expression of tight junction molecules [15,16], a mechanism explaining the essential role of IL-22 in the clearance of NTHi [14]. Morover, supplementation of COPDmice with recombinant IL-22 increases the clearance of the bacteria and prevents the development of COPD exacerbations in mice. However, IL-22 expression is also promoted by exposure to CS and is involved in COPD pathogenesis [17]. Several reports showed that activation of innate receptors, including TLR, is able to elicit protective immune responses against infections [18,19]. Among them, systemic administration of flagellin, the main component of bacterial flagella and the TLR5 ligand, induces immediate production of Th17 cytokines through the activation of DC and type 3 innate lymphoid cells [20].In this study, we hypothesized that systemic administration of recombinant form of flagellin could inhibit the development of NTHi-induced COPD exacerbation episodes through an appropriate protective IL-22 response. We reported here that systemic stimulation of the innate immunity by flagellin from Salmonella enterica serovar Typhimurium (FliC) prevents COPD exacerbation induced by NTHi. We also showed that the protective effect of flagellin against NTHi is dependent of IL-22 but was not associated with the modulation of calgranulins (S100A8/S100A9) and defensin-β2.
Material and methods
Animals
Male C57BL/6 (WT) or IL-22-/- C57BL/6j mice of both sexes, 6–8 weeks old were obtained from Janvier Labs (Le Genest-St-Isle, France) or Jean-Christophe Renauld (Brussel, Belgium), respectively. WT mice were daily exposed to cigarette smoke (CS) during 12 weeks (5 cigarettes/day, 5 days/week during 12 weeks) to induce COPD pathogenesis [4]. They were exposed in a whole-body chamber integrated to the Inexpose system (EMKA, Paris-France). Research cigarettes 3R4F were obtained from the University of Kentucky Tobacco and Health Research Institute (Lexington, KY, USA). The control group was exposed to ambient air. After 12 weeks of CS or air exposure, mice were either treated intranasally with phosphate buffered saline (PBS) or NTHi (n = 4 per group), three days after the last exposure to CS. Il22mice were not exposed to CS before before infection with NTHi and controls received PBS. All procedures were performed according to the Pasteur Institute, Lille, Animal Care and Use Committee guidelines (agreement number N°AF16/20090). The present project has been approved by the national Institutional Animal Care and Use Committee (CEEA 75) and received the authorization number APAFIS# 7281.
Mice infection and flagellin treatment
NTHi 3224A strain was grown to log-phase in brain-heart infusion (BHI) broth (AES Laboratory) supplemented with 10μg/ml haematin and 10μg/ml nicotinamide adenine dinucleotide (NAD) (SIGMA, St Louis, MI, USA), and stored à -80°C in BHI 10% glycerol for up to 3 months.For mouseinfection, working stocks were thawed, washed with sterile PBS, and diluted to the appropriate concentration. The number of infectant bacteria was confirmed by plating serial dilutions onto chocolateagar plates. Mice were anesthetized and intranasally (i.n.) infected with 2.5x106 CFU of NTHi.For preparation of heat-killed (HK) NTHi, bacteria were grown to a log-phase (O.D600nm = 0.7–0.8 units) and inactivated at 56°C for 1 hour in a hot-water-bath. Broth cultures were then plated onto chocolateagar plates and incubated overnight to check bacterial inactivation.Native flagellin was purified and depleted in endotoxin as described previously [21]. To evaluate the prophylactic effect, 5μg of flagellin was administrated intraperitoneally (i.p.) just before bacterial challenge. In some experiments, we evaluated a therapeutic protocol in which flagellin was intraperitoneally injected 6h after the infection. For IL-22 neutralizing experiment, mice received 200μg of neutralizing anti-IL-22 (AM22) or control isotype (a mouseIgG2a) antibodies intravenously 5 minutes before infection.
Sample collection and processing
Mice were sacrificed 24h and 48h post-infection by NTHi. Broncho-alveolar Lavage (BAL) fluids, lungs, spleen and blood were collected and kept on ice till the processing or immediately frozen in liquid nitrogen.BAL was performed by instilling 5 x 0.5 ml of sterile PBS + 2% fetal bovine serum (FBS) via a 1 ml sterile syringe with 23-gauge lavage needle into a tracheal incision. BAL samples were used for cytokine analysis, flow cytometry analysis and numbering of CFUs. Lung tissues were collected aseptically and analyzed for CFU counts, cytokines analysis, histology and pulmonary cell analysis (flow cytometry analysis and lung cell restimulation). For this, lungs were perfused with PBS and the left lobe was treated with collagenase (Sigma-Aldrich). The leucocyte-enriched fraction was collected using a Percoll gradient (GE Healthcare) before flow cytometry staining and culture. Blood was used for the determination of CFU counts and measurement of cytokine concentrations.
Flow cytometry
Cells harvested from BAL and lungs were washed and incubated with antibodies (BD, Franklin lakes, NJ, USA) for 30 min in PBS before being washed. Staining was performed as described in online supplementary information. Data were acquired on a LSR Fortessa (BD Biosciences) and analyzed with FlowJo™ software v7.6.5 (Stanford, CA, USA). Gating strategies are previously reported by Sharan et al. [22]. Debris were excluded according to size (FSC) and granularity (SSC). Immune cells expressing CD45 were gated to analyse frequency, activation and number of cell subsets. Phenotypes are shown in the Table 1.
Table 1
Phenotype of the major cell populations identified in this report.
Cell population
Phenotype
Alveolar Macrophages
F4/80+ CD11c+ CD64+ SiglecF+
Neutrophils
F4/80- CD11c- CD11b+ Ly6G+
Dendritic cells
F4/80- CD11c+ I-Ab+ CD64-
Inflammatory monocytes
F4/80+ CD11c- Ly6G- Ly6C+ CCR2+
Conventional T cells
CD5+ TCRαβ+ NK1.1-
NKT like cells
NK1.1+ TCRαβ+
Cytokine measurement
Levels of IFN-γ, IL-1β, IL-6, IL-17, IL-22, IL-23 and tumor necrosis factor alpha (TNF-α) were quantified in blood, lung tissue lysates and BAL using commercial ELISA kits (Invitrogen, San Diego, USA; Biotechne, Minneapolis, USA) (Table 2). In addition, defensin-β2 concentrations were also measured in lung extracts and BAL by ELISA (Abbexa, Cambridge, UK). Similarly, levels of IFN-γ, IL-17, and IL-22 were measured in the supernatants of dissociated lung cells (0.5x106 of cells) alone or re-stimulated with HK NTHi during 72h.
Table 2
List of the antibodies and of the ELISA kits used in this study.
Flow cytometry mAb
Target
Manufacturer
Catalog Nb
FITC- I-Ab
Miltenyi Biotech
130-102-168
PE-F4/80
Miltenyi Biotech
130-102-422
PerCP-Cy5.5—CD103
BD Biosciences
563637
PE-Cy7—CD11c
BD Biosciences
558079
APC—CCR2
Miltenyi Biotech
130-119-658
AF700—CD86
BD Biosciences
560581
APC-H7- Ly6G
BD Biosciences
560600
V450—CD11b
BD Biosciences
560455
VioGreen—CD45
Miltenyi Biotech
130-110-665
BV605—Ly6C
Biolegend
128036
BV786—CD64
BD Biosciences
741024
PE-CF594—SiglecF
BD Biosciences
562757
FITC—CD5
Miltenyi Biotech
130-102-574
Tetramer mCD1d 167ms
NIH facility
30663
PerCP-Cy5.5—NK1.1
Miltenyi Biotech
130-103-963
PE-Cy7—CD4
Miltenyi Biotech
130-102-411
APC—CD25
Miltenyi Biotech
130-102-550
AF700—CD69
BD Biosciences
561238
APC-Vio770—TCRγδ
Miltenyi Biotech
130-104-016
VioBlue -TCRβ
Miltenyi Biotech
130-104-815
V500—CD8
BD Biosciences
130-109-252
BV605—CD45
Biolegend
103140
ELISA kits
Target
Manufacturer
Catalog Nb
IFN-γ ELISA kit
Invitrogen
88-7314-88
IL-1β Duoset
Biotechne
DY401
IL-6 ELISA kit
Invitrogen
88-7064-88
IL-17 ELISA kit
Invitrogen
88-7371-88
IL-22 Duoset
Biotechne
DY582
IL-23 ELISA kit
Invitrogen
88-7230-88
TNF-α ELISA kit
Invitrogen
88-7371-88
Defensin-β2
Abbexa
Abx254734
RT-PCR quantification of mRNA expression
Quantitative RT-PCR was performed to quantify mRNA of interest (Table 3). Results were expressed as mean ± SEM of the relative gene expression calculated for each experiment in folds (2-ΔΔCt) using Gapdh as a reference, and compared to non-infectedPBS-treated control mice.
Table 3
Primer sequences for qRT-PCR in mice.
Forward (F) and reverse (R) primers are cited.
Genes
Sequences
Gapdh
F
TGCCCAGAACATCATCCCTG
R
TCAGATCCACGACGGACACA
Defβ2
F
AAAGTATTGGATACGAAGCAGAACTTG
R
GGAGGACAAATGGCTCTGACA
Defβ3
F
TGAGGAAAGGAGGCAGATGCT
R
GGAACTCCACAACTGCCAATC
Camp
F
CAGAGCGGCAGCTACCTGAG
R
TCACCACCCCCTGTTCCTT
S100a8
F
TGTCCTCAGTTTGTGCAGAATATAAA
R
TCACCATCGCAAGGAACTCC
S100a9
F
CACCCTGAGCAAGAAGGAAT
R
TGTCATTTATGAGGGCTTCATTT
Reg3b
F
ATGCTGCTCTCCTGCCTGATG
R
CTAATGCGTGCGGAGGGTATATTC
Reg3g
F
CTGTGGTACCCTGTCAAGAGC
R
GGCCTTGAATTTGCAGACAT
Primer sequences for qRT-PCR in mice.
Forward (F) and reverse (R) primers are cited.
Histological analysis
To study lung remodeling post-infection with NTHi, lungs were inflated and fixed in formalin. The lungs were then paraffin-embedded; cross-sections were cut and stained with hematoxylin and eosin. To define the lung lesions we have used a histopathologic score quantifying lung injury and including both lung remodeling and inflammation (Table 4). More specifically, this scoring includes the Extent of lung injury, the alveolar wall thickness, the presence of hyaline membrane, the neutrophilic alveolitis, the bronchial epithelial degeneration, the neutrophilic and lymphocytic peribronchitis, the vasculitis, the emphysema and the hemorrage for a cumulative score from 0 to 30. The evaluation was blindly performed. In order to evaluate emphysema, we measured mean linear intercept on photos from lung sections by using Image J software (NIH). Results were expressed as pixels (mean ± SD)
Table 4
Lung injury scoring criteria.
Lung injury
Score
Scale
0
1
2
3
4
Extent of lung injury
Absence
<25%
26 to 50%
51 to 75%
>75%
Alveolar wall thickness
≤ 1 rbc
> 1 ≤ 2 rbc
3 to 5 rbc
6 to 10 rbc
> 10 rbc
Hyaline membranes
Absence
Presence
NA
NA
NA
Neutrophilic alveolitis
Absence
<10 neutrophils/HPF
10 to 20/HPF
21 to 50/HPF
> 50/HPF
Suppuration
Absence
Presence
NA
NA
NA
Bronchial epithelial degeneration
Absence
Presence
NA
NA
NA
Neutrophilic peribronchitis
Absence
<10 neutrophils/HPF
10 to 20/HPF
21 to 50/HPF
> 50/HPF
Lympho-hiostiocytic peribronchitis
Absence
<10 mononuclear cells/HPF
10 to 20/HPF
21 to 50/HPF
> 50/HPF
Vasculitis (inflammation)
Absence
Presence
NA
NA
NA
Vasculitis (necrosis)
Absence
Presence
NA
NA
NA
Emphysema
Absence
< 25%
25 to 50%
to 75%
> 75%
Hemorrhage
Absence
Presence
NA
NA
NA
rbc: Red blood cells; NA: Not applicable; HPF: High Power Field (magnification x250).
rbc: Red blood cells; NA: Not applicable; HPF: High Power Field (magnification x250).
Statistical analysis
The data are expressed as mean ± SEM. Results were statistically analyzed using one way anova analysis (Kruskal Wallis test) followed by Dunn’s multiple comparison test (PRISM software, v5 GraphPad)), and expressed in terms of probability (p). Differences were considered significant when p<0.05 (*: p<0.05; **: p<0.01; ***: p<0.001).
Results
Intraperitoneal administration of flagellin accelerates the clearance of NTHi in CS-exposed mice
Mice chronically exposed to CS developed the major COPD features [4] and were intranasally challenged with NTHi and previously treated or not with flagellin (FliC) before infection (Fig 1A). As we previously reported [22], the bacterial load was higher in CS-exposed miceinfected with NTHi (in the BAL and lung tissue at 24h and in the BAL at 48h) (Fig 1B) than in infected control mice. Intraperitoneal injection of FliC significantly enhanced 24h post-infection (p.i.), the clearance of NTHi in BAL, lungs (Fig 1B) and the blood (S1 Fig) from CS-exposed mice compared to the PBS-treated mice. At 48h p.i., treatment with flagellin decreased the bacterial load in the BAL but not in the lungs and blood at this time point.
Fig 1
Treatment with Flagellin prevents the NTHi-induced COPD exacerbation in CS-exposed mice.
(a) To assess the impact of flagellin treatment on COPD exacerbation by NTHi, mice were chronically exposed to cigarette smoke during 12 weeks followed by intranasal challenge with NTHi 2.5x10 CFU and flagellin administration (5 μg; i.p.). Mice were euthanized at 24h or 48h after NTHi challenge for analysis of (b) Colony Forming Unit (CFU) counts in Broncho-alveolar lavage fluid (BAL) and lungs. (c) The total number of recruited cells as well as the absolute number of neutrophils, dendritic cells and NKT was reported in BAL and lungs of control versus COPD mice infected or not with NTHi and treated or not with flagellin. The samples were collected 24h after NTHi challenge. (d) Lung histopathology was performed on control and CS-exposed mice injected with PBS or FliC and infected or not with NTHi at 24h and 48h after challenge. Three independent experiments have been performed with 4 mice in each group. Data are expressed as mean ± SEM. *: p<0.05, **: p<0.01, ***: p<0.001.
Treatment with Flagellin prevents the NTHi-induced COPD exacerbation in CS-exposed mice.
(a) To assess the impact of flagellin treatment on COPD exacerbation by NTHi, mice were chronically exposed to cigarette smoke during 12 weeks followed by intranasal challenge with NTHi 2.5x10 CFU and flagellin administration (5 μg; i.p.). Mice were euthanized at 24h or 48h after NTHi challenge for analysis of (b) Colony Forming Unit (CFU) counts in Broncho-alveolar lavage fluid (BAL) and lungs. (c) The total number of recruited cells as well as the absolute number of neutrophils, dendritic cells and NKT was reported in BAL and lungs of control versus COPDmiceinfected or not with NTHi and treated or not with flagellin. The samples were collected 24h after NTHi challenge. (d) Lung histopathology was performed on control and CS-exposed mice injected with PBS or FliC and infected or not with NTHi at 24h and 48h after challenge. Three independent experiments have been performed with 4 mice in each group. Data are expressed as mean ± SEM. *: p<0.05, **: p<0.01, ***: p<0.001.Since COPD exacerbation is associated with an altered immune cell response relative to control mice [13,23], we next characterized immune cells in the lungs and BAL. At 24h p.i., we observed an increased total cell number in the BAL and lungs of infectedCS-exposed mice, compared to controls (Fig 2A). An increased number of neutrophils, alveolar macrophages (AM) and dendritic cells (DC) (p<0.05) in the BAL were reported of infectedCS-exposed mice compared to uninfectedmice, whereas neutrophils and DC were higher in the lungs (Figs 1D and S2). This increase was consistent at 48h p.i. for the total cell number and the neutrophil count (S2C Fig, p<0.01). After treatment with FliC, the total cell number was reduced in both control and CS-exposed miceinfected with NTHi. This was related in CS-exposed mice to a lower number of neutrophils in the BAL, and a trend for AM and DC. DC activation evaluated in the airways by the expression of CD86 and the MHC molecule I-Ab was not modulated in CS-exposed mice treated with FliC (S2B and S2D Fig). Regarding lymphocytes, we showed a significantly higher recruitment of both NKT and T cells in the BAL (p<0.05) and the lungs upon infection of controls and CS-exposed mice (Figs 1D and S2A). Treatment with FliC strongly reduced the number of T lymphocytes at both day 1 and 2 p.i. whereas the activation of these cells was not modulated in comparison with infectedmice as evaluated by CD69 expression was not changed (S2B Fig).
Fig 2
Flagellin limits NTHi induced inflammation in CS-exposed mice.
(a) The concentrations of IFN-γ, IL-17 and IL-22 were analyzed in the BAL and the lungs of control and CS-exposed mice injected with PBS or FliC and infected or not with NTHi at 24h after NTHi challenge. (b) These cytokines were also evaluated in supernatants of lung cells either unstimulated or in vitro restimulated with heat-killes NTHi. (c) The concentrations of IFN-γ, IL-17 and IL-22 were measured in the sera at 24h after NTHi challenge. Three independent experiments have been performed with at least 3 mice in each group. The data are expressed as mean ± SEM. *: p<0.05, **: p<0.01, ***: p<0.001.
Flagellin limits NTHi induced inflammation in CS-exposed mice.
(a) The concentrations of IFN-γ, IL-17 and IL-22 were analyzed in the BAL and the lungs of control and CS-exposed mice injected with PBS or FliC and infected or not with NTHi at 24h after NTHi challenge. (b) These cytokines were also evaluated in supernatants of lung cells either unstimulated or in vitro restimulated with heat-killes NTHi. (c) The concentrations of IFN-γ, IL-17 and IL-22 were measured in the sera at 24h after NTHi challenge. Three independent experiments have been performed with at least 3 mice in each group. The data are expressed as mean ± SEM. *: p<0.05, **: p<0.01, ***: p<0.001.Histopathological analysis of lung tissues showed that infection with NTHi in CS-exposed mice induced more inflammation and remodeling tissue than in control mice (Figs 1D and S2). Histopathologic analysis confirmed that treatment with FliC markedly decreased inflammatory cell recruitment both in peribronchial and alveolar spaces of NTHi-infectedCS-exposed mice at 48h p.i. compared to control mice. Moreover, infectedCS-exposed mice exhibited some features of pneumonia with alveolitis and a strong vasculitis 48h p.i. whereas these lesions were not observed in animals treated with FliC. This was confirmed by the histopathological score evaluating both inflammation and lung tissue remodeling (7±0.41 vs 4.33±0.31 in PBS- and FliC-treated infectedCS-exposed mice, respectively, p<0.05). Whereas the MLI was increased in not infectedCS-exposed mice as compared with Air mice (S3 Fig), infection by NTHI decreased the MLI only at day 1p.i. in CS-exposed mice. Treatment with FliC also reduces the emphysema at day 2 p.i.Altogether, these data demonstrated that treatment with FliCamplified the clearance of NTHi in CS-exposed mice, a result associated with a lower lung inflammation and less damage mostly due to the infection.
Flagellin treatment modifies the cytokine response consecutive to NTHi infection within the lung of CS-exposed mice
Since Th1 and Th17 cytokines are involved in the control of lung inflammation and bacterial infection, we analyzed their concentrations as well as those of cytokines involved in their production in the BAL and the lung lysates. Significantly higher levels of IL-17 (Fig 2A), IL-1β, IL-6 and TNF-α (S4A Fig) were detected in BAL and lung tissue lysates from infectedCS-exposed mice, compared to non-infected animals at 24h after infection. IL-22 production was only increased in lung lysates and there was no difference between Air and CS-exposed mice (Fig 2A). Interestingly, treatment with FliC significantly reduced the concentrations of IFN-γ, IL-1β, and TNF-α in the BAL (S4A Fig; p≤0.05). There was no effect in control mice. Treatment with flagellin significantly increased the production of IL-22 in the BAL but not in the lung of CS-exposed mice at day 1 p.i. (Fig 1C) as well as IL-23 levels (p = NS, S4B Fig). To further analyze the potential of lung immune cells to promote efficient antibacterial immune response, these cells were restimulated ex vivo with heat-killed (HK) bacteria and their ability to produce cytokine profiles were assessed. Infection with NTHi increased the production of IFN-γ, IL-17, and IL-22 in Air-mice as compared with PBSmice at 24h p.i. (Fig 2B). In infectedCS-exposed mice, higher levels of IFN-γ, IL-17 were detected compared to the controls whereas the levels of IL-22 were not induced by the infection in both unstimulated and HK NTHi stimulated lung cells (p<0.05). In CS-exposed mice treated with FliC, lung cells produced more IL-22 than PBS-treated infectedmice (p<0.05) whereas the levels of IL-17 and IFN-γ remained unchanged. There was no difference in control mice.In parallel, we also analyzed the production of these cytokines in the blood. Infection by NTHi did not modulate the blood concentration of IFN-γ and IL-22 whereas it tended to increase the levels of IL-17 in CS-exposed mice (Fig 2C). Interestingly, FliC significantly increased the concentrations of IL-22 in CS-exposed mice.The FliC-induced protection was associated with a lower pro-inflammatory cytokine burst in the lung and an increased IL-22 production both in the lung and the blood of CS-exposed mice.
Flagellin increases the ability of spleen T cells to produce IL-22
Since FliC was administered intraperitonally, we evaluated its impact on the immune cell phenotype within the spleen. We did not detect a significant modification of the number of the major APC in flagellin-treated and infectedmice compared to only infectedmice as illustrated for inflammatory monocytes and cDC2 (S5 Fig). In addition, we observed no statistical modulation of the expression of I-Ab in both cell types. Regarding T lymphocytes, their absolute number was not significantly modulated in both Air and CS-exposed mice after infection but also after treatment with FliC as shown for iNKT cells and T CD8+ cells. Similarly, treatment with FliC did not significantly amplify CD25 expression on both cell types in both Air- and CS-exposed mice. Production of IFN-γ, IL-17 and IL-22 was measured in supernatants of total spleen cells. Infection by NTHi and treatment with Flagellin had no effect on the production of these cytokines in unstimulated cells (Fig 3A). Administration of FliC significantly increased the ability of spleen cells from Air mice to produce IL-17 whereas it significantly amplify the IL-22 production in mice exposed to CS after stimulation by NTHi (Fig 3B).
Fig 3
Flagellin modulate the production of IL-22 cytokines in splenocytes from NTHi-infected cigarette smoke-exposed mice.
(a) IFN-γ, IL-17 and IL-22 concentrations were measured in the supernatants of unstimulated spleen cells of mice infected or not with NTHi and treated or not with FliC, at 48h after infection. (b) IFN-γ, IL-17 and IL-22 concentrations were measured in the supernatants of activated spleen cells of mice infected or not with NTHi and treated or not with FliC, at 48h after infection. Spleen cells were activated by addition of heat-killed-NTHi (MOI 10) during 48 hours. Two independent experiments have been performed with at least 3–4 mice in each group. *: p<0.05 and **: p<0.01.
Flagellin modulate the production of IL-22 cytokines in splenocytes from NTHi-infected cigarette smoke-exposed mice.
(a) IFN-γ, IL-17 and IL-22 concentrations were measured in the supernatants of unstimulated spleen cells of miceinfected or not with NTHi and treated or not with FliC, at 48h after infection. (b) IFN-γ, IL-17 and IL-22 concentrations were measured in the supernatants of activated spleen cells of miceinfected or not with NTHi and treated or not with FliC, at 48h after infection. Spleen cells were activated by addition of heat-killed-NTHi (MOI 10) during 48 hours. Two independent experiments have been performed with at least 3–4 mice in each group. *: p<0.05 and **: p<0.01.
IL-22 is important for Flagellin-mediated protection in COPD exacerbation by NTHi
It has already been described that the prophylactic effect of flagellin against lung infection by S. pneumoniae is mediated by early (between 2 and 24h) overexpression of IL-22, in a TLR5 dependent manner, through the increase of IL-22+ ILC3 in the lung [20]. In order to confirm the implication of IL-22 in the effect of flagellin, we first treated Il22mice with this TLR5 ligand before infection by NTHi (Fig 4A). Compared to wild type (WT) mice, Il22mice cleared NTHi within comparable timing although the bacterial load was higher in mice (Fig 4B). Treatment with FliC did not significantly decrease the bacterial load in the BAL and lung compared to PBS treated Il22mice whereas it did in WT mice (Fig 1B). Regarding the inflammatory cell influx, the administration of FliC did not modulate the absolute number of neutrophils, AM and DC in the BAL or in the lung of Il22-/- mice (Fig 4B and 4C). The levels of IL-17 and IFN-γ were also measured and we did not detect a significant effect of FliC on the concentration of these cytokines in Il22-/- mice except in the BALF at 48h p.i. (S6 Fig) as shown in WT mice. Histological analysis showed that the lesions in infectedIl22-/- mice have the same intensity as in infected WT mice (Figs 1D and 4D). Moreover, FliC slightly limited the lung remodeling in infectedIl22mice but with a lower degree than in WT mice. In contrast with the data obtained in WT mice (Fig 1D), although the inflammatory infiltrate persists in both PBS and FliC-treated NTHi-infectedIl22mice (histologic score: 7.1 ± 0.48 versus 4.77 ± 0.75, respectively).
Fig 4
IL-22 is important in flagellin-mediated protection during NTHi infection.
(a-d) Infection in Il22 mice, (e-g) treatment of COPD mice with anti-IL-22 antibody. (a) To identify the role of IL-22 in the effect of flagellin during NTHi infection, Il22 mice were challenged with NTHi at 2.5x10 CFU for 24h. (b) Bacterial load was assessed in BAL and lungs. (c) Absolute number of neutrophils, alveolar macrophages (AM) and dendritic cells (DC) in BAL and lungs of mice infected with NTHi. (d) Lung histopathology was performed in Il22 mice injected with PBS or FliC and infected or not with NTHi. The data are expressed as mean ± SEM of 3 independent experiments (n≥3). (e) Wild type CS-exposed mice were intravenously injected with anti-IL-22 neutralizing antibodies 5min before FliC treatment and infected with NTHi for 24h. (f) CFU count, (g) Neutrophil numbers, AM and DC count were reported in the BAL and the lungs. The data are expressed as mean ± SEM of 2 independent experiments (n≥3). **: p<0.01, ***: p<0.001.
IL-22 is important in flagellin-mediated protection during NTHi infection.
(a-d) Infection in Il22mice, (e-g) treatment of COPDmice with anti-IL-22 antibody. (a) To identify the role of IL-22 in the effect of flagellin during NTHi infection, Il22mice were challenged with NTHi at 2.5x10 CFU for 24h. (b) Bacterial load was assessed in BAL and lungs. (c) Absolute number of neutrophils, alveolar macrophages (AM) and dendritic cells (DC) in BAL and lungs of miceinfected with NTHi. (d) Lung histopathology was performed in Il22mice injected with PBS or FliC and infected or not with NTHi. The data are expressed as mean ± SEM of 3 independent experiments (n≥3). (e) Wild type CS-exposed mice were intravenously injected with anti-IL-22 neutralizing antibodies 5min before FliC treatment and infected with NTHi for 24h. (f) CFU count, (g) Neutrophil numbers, AM and DC count were reported in the BAL and the lungs. The data are expressed as mean ± SEM of 2 independent experiments (n≥3). **: p<0.01, ***: p<0.001.To further investigate the implication of IL-22 in the protective effect of flagellin, WT CS-exposed mice were intravenously treated with anti-IL-22 blocking antibodies before FliC treatment and NTHi infection (Fig 4E). 24h after infection, anti-IL-22 completely abrogated the effect of FliC on the bacterial load reduction (Fig 4F). Treatment with the blocking antibody and FliC did not affect the number of neutrophils and DC counts in BAL and lung compared with infectedCS-exposed mice (Fig 4G) whereas it slightly increased the absolute number of macrophages within the lung.These results demonstrate that the protective effect of flagellin during COPD exacerbation is at least partly dependent of IL-22.
Impact of flagellin on the production of anti-microbial peptides in infected CS-exposed mice
Flagellin as well as IL-22 cytokine are also able to promote the production of antibacterial peptides [24,25]. To investigate this pathway, we analyzed the expression of anti-microbial peptide mRNA in the lung and the protein level of S100A8 and S100A9 in the BAL. The delay in NTHi clearance observed in CS-exposed mice compared to control was not associated with significant changes in the expression of Defb2, S100A8, S100A9 (Fig 5A), Defb3, Reg3g (S7 Fig), as compared to infected control mice. Administration of flagellin increased the levels of Defb2 in CS-exposed mice whereas it decreased the mRNA expression of Defb3 and Reg3g in CS-exposed mice. In order to confirm these data at the protein level, we measured the protein concentration of defensin-β2, S100A8 and S100A9 (Fig 5B). Infection with NTHi markedly increased the concentrations of defensin-β2, S100A8 and S100A9 in the BAL of both control and CS-exposed mice. Treatment with FliC did not modulate the levels of S100A8 and S100A9 in both groups of mice at both 24 and 48h after infection. Upregulation of Defb2 mRNA was not associated with an increased concentrations of defensin-β2 in both BALF and lung extracts in both Air and CS-exposed infectedmice.
Fig 5
Effect of flagellin on the production of anti-microbial peptides in CS-exposed mice infected with NTHi.
(a) mRNA expression of Defb2, S100A8 and S100A9 in the lungs of control versus CS-exposed mice infected or not with NTHi and treated or not with flagellin. (b) Concentrations of Defb2, S100A8 and S100A9 in the BAL of control versus CS-exposed mice infected or not and treated or not with flagellin. BAL were collected 24h and 48h after infection. Three independent experiments have been performed with at least 3 mice in each group. The data are expressed as mean ± SEM*: p<0.05, **: p<0.01, ***: p<0.001.
Effect of flagellin on the production of anti-microbial peptides in CS-exposed mice infected with NTHi.
(a) mRNA expression of Defb2, S100A8 and S100A9 in the lungs of control versus CS-exposed miceinfected or not with NTHi and treated or not with flagellin. (b) Concentrations of Defb2, S100A8 and S100A9 in the BAL of control versus CS-exposed miceinfected or not and treated or not with flagellin. BAL were collected 24h and 48h after infection. Three independent experiments have been performed with at least 3 mice in each group. The data are expressed as mean ± SEM*: p<0.05, **: p<0.01, ***: p<0.001.These data showed that the effects of FliC are not associated with the upregulation of defensin-β2 and calgranulins synthesis.
Discussion
The increased susceptibility to infection during COPD is linked to a defect in IL-22 production related with an altered innate immune response [13,22,23]. In this study, we demonstrated that treatment with flagellin, a TLR5 ligand, is able to improve the ability of CS-exposed mice to clear bacteria including NTHi. The mechanism involved in this bacterial clearance is at least partially dependent of IL-22 but is not associated with an increased production of anti-microbial peptide defensin-β2 and calgranulins. Interestingly, the clearance of the bacteria was associated with a reduced inflammatory infiltrate and a decreased production of inflammatory cytokines in the lung of CS-exposed mice resulting in a less intense remodeling of lung tissues. Moreover, this treatment is also able to promote the NTHi-induced IL-22 production by PBMNC from healthy subjects [26].The efficiency of FliC was demonstrated in an acute model of COPD exacerbation, using NTHi, reproducing most of the biological characteristics of this episode [3,27]. However, the increased inflammatory reaction associated with neutrophil and macrophage influx and the pro-inflammatory cytokine storm in CS-exposed mice did not allow to clear the bacteria. An altered production of IL-22 seems to be an essential mechanism responsible for this defect [13,22].We are the first to demonstrate that treatment with FliC is also efficient against NTHi whereas its interest has been shown in infection with other bacteria including S. pneumoniae in non-CS-exposed mice [28-30]. Since the pathophysiology of COPD exacerbation episodes implicated a defect in IL-22 production and a deleterious effect of neutrophils on lung function, we choose to treat our mice by intraperitoneal route rather than a local administration which promotes a strong neutrophil recruitment in the airways. As previously reported with Sp in control (non COPD) mice [20,31,32] and in CS-exposed mice [26], the systemic treatment with FliC in NTHi-infectedmice increases the IL-22 production in the BAL and in the supernatant of restimulated pulmonary cells without increase of the number and the activation of DC and AM in the airways. Nevertheless, we cannot exclude that the increased ability to produce IL-22 was linked to the recruitment of some populations of lymphocytes including T cells and NKT cells in CS-exposd mice. Both AM and DC expressed TLR5 and it has been reported that they are stimulated after administration of FliC [31,33]. We can suspect that FliC promotes the response to both Sp and NTHi not only in the lung but also in spleen and draining lymph nodes. Indeed, we detect a significant increase of IL-22 concentrations both in the blood and the supernatants of spleen cells from infectedCS-exposed mice suggesting the circulation of immune cells and/or mediators between the spleen and the lung. The implication of IL-22 in the FliC-induced protection against NTHi was confirmed by the lack of bacterial decrease and the lower modulation of the inflammatory cell recruitment in Il22mice. The role of IL-22 in the control of the bacterial load was confirmed by the pre-administration of neutralizing anti-IL-22 antibody in FliC-treated CS-exposed mice. These data are in line with our previous report showing that the supplementation with recombinant IL-22 is able to accelerate the clearance of the bacteria and to limit the consequences of bacterial infection in CS-exposed mice [13]. Interestingly, this is not associated with a modulation of IL-17 and IFN-γ in CS-exposed mice confirming that these cytokines are not essential for the clearance of NTHi [14,23].Interestingly, we also described that the protection induced by prophylactic treatment with FliC was associated with a decrease in lung inflammatory cell recruitment and in airway remodeling in infectedCS-exposed mice. This effect is probably the consequence of the accelerated clearance of the bacteria and/or to the activation of effector cells. IL-22 synthesis upregulation did not seem to be essential for the control of the inflammation since the inflammatory cell recruitment was not affected in FliC-treated Il22-/- mice compared to WT mice. Moreover, the production of IL-17 and/or IFN-γ is not essential in the anti-bacterial activity since flagellin treatment does not increase their production and IL-22 neutralization did not modulate their concentrations [15,16].In order to determine how FliC increase the bacterial clearance, we analyzed the expression of AMP. FliC is known to promote the anti-microbial response as well as the production of chemokines and pro-inflammatory cytokines (including TNF-α and IL-1β) in airway epithelial cells, macrophages and neutrophils [32]. Through this mechanism, FliC might prime the antibacterial activity of effector cells including macrophages and neutrophils. We can also suspect that this treatment restores the barrier function of the airway mucosa since bacteria translocation within the blood is also decreased in CS-exposed mice (S1 Fig). Whereas our data show that the treatment with FliC promotes the production of calgranulins in Sp-infectedmice [26], this is not the case after NTHi infection. It has been reported that S100A8 and 9 are induced by both SP- and NTHi-infection, and they are major players in the host response against pneumococcal infection by increasing lung recruitment of neutrophils and macrophages [34,35]. Their implication in the clearance of NTHi is unknown whereas the lack of effect after FliC treatment is probably related to the high level of induction by NTHi alone. In contrast, defensin-β2 is active against the major pathogens involved in COPD exacerbations including Sp and NTHi, while defensin-β1 appeared to only affect M. catarrhalis [36]. Recent findings show that NOD2-mediated defensin-β2 production participates in the protection against NTHi-induced otitis [37]. Moreover, virus-induced altered expression of defensin-β results in an increased load of NTHi within the upper airways, which likely promotes development of lung infection [38]. However, the measurement of protein concentrations for these AMP did not reveal an increased production after FliC administration although we cannot exclude that this treatment induces the production of other AMP.Interestingly, we also described that the protection induced by prophylactic administration with FliC was associated with a decrease in lung inflammatory cell recruitment and in airway remodeling in infectedCS-exposed mice. Although these data must be confirmed in clinical practice, they suggest that this treatment can limit the consequences of bacterial infection during COPD, particularly the alteration of lung functions and the development of comorbidities. By restoring an efficient barrier, we can also hypothesize that this treatment will reduce the systemic inflammatory effects of the exacerbation. According to previous reports [20,29] and to our data with SP, we can also hypothesize that this treatment was also efficient through curative administration alone or in combination with antibiotics against NTHi. Since the safety of this adjuvant has been shown for clinical application (https://clinicaltrials.gov/ct2/show/results/NCT00966238), the interest of this treatment for COPD exacerbation might be predicted.In conclusion, we demonstrated that treatment by flagellin is able to control bacterial infection in CS-exposed mice and to limit their consequences in terms of lung inflammation and remodeling. Although this effect seems to be partially dependent of the production of IL-22, we also suggest that the protection induced by FliC leads to the modulation of anti-microbial peptide production. FliC-induced restoration of an efficient bacterial clearance and limitation of the inflammatory reaction could be a step forward the treatment of COPD exacerbation.
Treatment with Flagellin prevents the blood dissemination of NTHi in CS-exposed mice.
(PDF)Click here for additional data file.
Flagellin modulated the inflammatory cell recruitment whereas it did not affect their activation in NTHi-infected cigarette smoke-exposed mice.
(PDF)Click here for additional data file.
Flagellin reduce the emphysema in the lung of NTHi-infected cigarette smoke-exposed mice.
(PDF)Click here for additional data file.
Modulation by flagellin of cytokine production in the lung of Air- and cigarette smoke-exposed mice infected with NTHi.
(PDF)Click here for additional data file.
Flagellin did not affect the main immune cell populations nor their activation in the spleen of NTHi-infected cigarette smoke-exposed mice.
(PDF)Click here for additional data file.
Cytokine production in the lung of WT and IL-22-/- mice following flagellin treatment.
(PDF)Click here for additional data file.
Flagellin reduce the Defb3 and REG3g mRNA expression in the lung of NTHi-infected cigarette smoke-exposed mice.
(PDF)Click here for additional data file.(ZIP)Click here for additional data file.13 Aug 2020PONE-D-20-19459The Toll-Like Receptor 5 agonist flagellin prevents Non-typeable Haemophilus influenzae-induced exacerbations in cigarette smoke-exposed micePLOS ONEDear Dr. Gosset,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Both reviewers raised significant issues that must be considered and addressed carefully to allow further consideration of publication. Please note that methodological rigour is a prerequisite for publication in PloS One and therefore it is essential that comments related to these (group sizes, appropriate control groups, replication of findings) are addressed adequately.Please submit your revised manuscript by 25th November 2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Aran SinganayagamAcademic EditorPLOS ONEAdditional Editor Comments:Both reviewers raised significant issues that must be considered and addressed carefully to allow further consideration of publication. Please note that methodological rigour is a prerequisite for publication in PloS One and therefore it is essential that comments related to these (group sizes, appropriate control groups, replication of findings) are addressed adequately.Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. During our internal review, we noticed you have overlapping text with the dissertation of one of the authors published here:https://tel.archives-ouvertes.fr/tel-01916088/documentPlease clarify what type of copyright, if any, the dissertation has and who the copyright owner is. PLOS ONE cannot (re)publish material without sufficient permission from the original copyright holder to publish under a CC BY license. If the copyright is not owned by the author and is not under a under a CC BY license, please complete one of the following:Please provide proof that the owner of the content (a) has given you written permission to use it, and (b) has approved of the CC BY license being applied to their content. You may have the following form completed by the owner as proof: https://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf.Alternatively, you may electronically request permissions through from the copyright holder and send us proof of approval, as long as the approval clearly shows that the owner has approved of the CC BY license being applied to their content. Please see https://journals.plos.org/plosone/s/licenses-and-copyright for more information.3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.4. Your ethics statement must appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please also ensure that your ethics statement is included in your manuscript, as the ethics section of your online submission will not be published alongside your manuscript.5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: NoReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: NoReviewer #2: No**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: NoReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The manuscript describes use of a mouse model of chronic (12 week) CS-exposure induced lung disease directly followed by NTHi challenge.The title is confusing – ‘…..haemophilus influenzae induced exacerbations in CS-exposed mice’. Exacerbations of what…? It suggests that there is a pre-existing lung disease and NTHi infection is making this worse ie exacerbation. However as I read on there is no evidence of established (12 week CS-induced) lung disease. So I think the title needs re-thinking to better reflect the model.FLiC is given systemically (via intraperitoneal injection) – what is the rationale for this (to treat COPD exacerbation)? Have the authors tried targeted (airway) treatment?ResultsThe first statement – ‘mice chronically exposed to CS developed the major COPD features’. What is the evidence for this? Simply providing a reference to another paper as evidence that CS exposure induced COPD features (which are not defined…) is not adequate. Based on title, abstract, intro this study appears (although a bit vague eg title) about bacterial exacerbation of COPD. Figs 1b and 1c present BAL and lung bacterial load data. Note the labelling is incorrect in figure legend. The results state levels of NTHi in the blood were measured – there is no data for this. The right panel for fig 1c indicates increased levels of bacteria in lung tissue with FliC treatment?Please show individual data points for each graph -are you showing n = 4 mice for one experiment or combining three repeats to show n = 12 per treatment? If n = 4 data is analysed this is not parametric and therefore mean +/-SEM not appropriate.Fig 1D does include a PBS treated group to enable comparison of CS vs air treated mice. There is no evidence of airway (BAL) inflammation. Airway inflammation woul be considered a ‘major feature of COPD’. Why do the authors think CS exposure has not caused airway inflammation? Fig 1E – no PBS group here so cannot determine if CS exposure (alone) vs air (alone) has caused any COPD-like disease such as alveolar destruction as measured by mean linear intercept via quantitation of lung histology.The data in figure 1 is not consistent with a model of bacterial COPD exacerbation since there are essentially no disease outcomes apparent in the CS (PBS) group vs Air (PBS) group. Ie no evidence that CS exposure has caused disease. The lung disease outcomes presented are driven by NTHi. The possibility that prior CS exposure has modified susceptibility to NTHi induced lung disease. However, no statistical comparison of CS (NTHi) vs Air (NTHi) has been conducted so there is no evidence that CS exposure has modified response to NTHi.Fig 1E – there is no CS (PBS) and Air (PBS) group so cannot assess CS-induced lung disease.Fig 2 Unclear how many data points per treatment have been analysed. Please show individual data points – particularly if some groups have 3 mice so cannot determine if stats are appropriate… It is not clear to this reviewer what the key results here. Yes the different treatments are modifying cytokine expression – but the relevance of this to a specific pathway, disease mechanisms is not clear. Several sentences begin with ‘interestingly’ - interesting perhaps.. but is the relevance to bacterial COPD exacerbation, particularly given that this is not really modelling COPD exacerbation (no evidence of COPD-like disease).Fig 3. A lot of sup data or data not shown. Not clear why you are looking at immune cells in spleen when this a study of lung infection/disease. 3A cytokine production by spleen cells from CS-exposed mice +/- NTHi +/- FliC. Again don’t know number of data points for this data, and not statistically significant so does not add anything. 3B – why is this relevant and how does it inform on pathogenesis bacterial COPD exacerbation?Fig 4 ‘to identify the role of IL-22 in the effect of flagellin during NTHi infection…’ What effect specifically! The figure legend is confusing, lack detail and does not adequately describe the data. 4b – there is no effect on bacterial load. This is a single timepoint. Certainly a timecourse is necessary and might reveal reduced bacterial load/clearance with FliC treatment.4F data does indicate that FliC reduced bacterial load is mediated by IL-22 (again exact numbers per group need to be shown). Fig 4e does not appear that reduced bacterial load is associated with increased numbers in the lung of a particular immune cell population. You should avoid reporting data using subject language such as ‘slightly increase numbers…’ The conclusion for this data relates to protective effect of flagellin during COPD exacerbation – this is not accurate.Fig 5 for the most part FliC treatment reduced AMP expression with the exception of Defb2 gene at 24 h in CS-exposed mice.Reviewer #2: Perez-Cruz and colleagues present a study in which they test the effect of systemic flagellin treatment on the ability of mice exposed to air or smoke to clear NTHi, and the effects on associated histopathology and immune response. The topic, use of innate immune modulators in a therapeutic setting, is of interest, and certainly relevant in COPD where bacterial infections resulting in exacerbation are a significant clinical issue. While there is merit to the study overall, I found the study a little disjointed and hard to follow, the methods inadequately described and some of the conclusions drawn by the authors to be misleading. Authors should attempt to address comments should be addressed prior to publication in PLOS ONE or elsewhere.Major comments:1. Stats section lists use of Mann-Whitney for pairwise comparisons. This is inappropriate given the comparisons between 4 or 6 experimental groups in most figures. Non-parametric test like Kruskal-Wallis should be applied followed by pairwise comparisons that are corrected for multiple comparisons by some method such as Dunn’s or Bonferoni.2. Inaccuracy of abstract. The abstract claims two different modes of intervention with flagellin were trialled – “preventive and therapeutic”. This statement is misleading as the authors only applied flagellin at one time point, immediately prior to bacterial infection, so should perhaps best be described as “prophylactic”. Authors also make claims about defensinb2 peptide production that are not demonstrated in the results.3. Number of mice per group per experiment – can the authors provide exact n for each group in each figure or individual figure panels – current descriptions are a bit vague and don’t give these details at sufficient level.Further comments:4. Grammar and spelling require some attention – for example in abstract “According our preventative or therapeutic protocol, flagellin was administered intraperitoneally” - perhaps this should read “Flagellin was administered intraperitoneally in preventive or therapeutic treatment protocols.” or something similar. Other examples “Acute exacerbations invariably scarred the chronic course of COPD 9.” There are quite a lot of grammatical and spelling errors throughout the manuscript, careful copy editing required.5. Reference list needs to be carefully checked and updated – for example reference 14 is a paper published in 2016, but appears as ‘in press’ in the reference list.6. What was the status of mice purchased, were they SPF?7. Please detail briefly mention method of CS exposure in methods (whole body, nose only? Primary or secondary smoke?)8. Methods section only appears to list one time at which flagellin was administered (just prior to bacterial challenge), while the abstract refers to both preventive and therapeutic administration protocols – please make exactly clear what you mean by preventive and therapeutic administration in the method section. Therapeutic administration in mouse models refers to administration of an intervention after the insult, or after development of pathology.9. Details of the IL22 knockout mouse experiment are sparse. What strain were these mice on? Were appropriate WT controls employed? Statement in methods is IL22-/- mice were infected or not with NTHi – does this mean no PBS control was used? What about CS exposure? Were IL22 knockout mice also male and 6-8 weeks of age? More clarity needed in methods.10. Flow cytometry method, incomplete sentence “gating strategies are.” . Can example gating strategies be shown?11. How were lung cells dissociated? Clarify in methods.12. Histology scoring – cumulative score of up to 30 doesn’t make sense looking at table 4 – max score possible is 28. Also how many high power fields were quantified per lung? Has this scoring system been published elsewhere? please reference13. Results page 11: “mice chronically exposed to CS developed the major COPD features” – what were these features and can you provide evidence of this? For example in graph 1d for PBS treated mice, there is no evidence of CS-induced increase in total BAL cell count, or neutrophil count, which seems unusual for a 12 week CS exposure and is not consistent with the induction of COPD-like features. Was histopathology score modified by CS vs ambient air alone?14. Results page 11: “This increase was consistent at 48h p.i. for the total` cell number and the neutrophil count (Additional figure 1c and not shown, p<0.01).” – do the authors mean supplemental figure 1c? Also I don’t think in the era of supplemental figures, that the authors should be referring to data not shown – please supply in supplemental figures – this comment also applies to other instances of data not shown in results.15. Results page 13 – Figure 3: “To further analyze the potential of lung immune cells to promote efficient antibacterial immune response, these cells were restimulated ex vivo with heat-killed (HK) bacteria and their cytokine profiles were assessed.” Are these experiements conducted on total lung cell suspensions, or isolated cell populations from lungs? Unclear if differences in cytokine production result from differential responses of cells in suspension or due to differential make up of lung cell suspensions tested. This data seems hard to make any meaningful interpretation from as it stands.16. Figure 3: graph axes should be better labelled so the figure is easier for the reader to interpret (e.g. pg/ml CYTOKINE X in TISSUE X)17. Figure 4A-D: schematic lists either WT or IL22-/- mice are infected, but data in panel b it is not clear if WT or knockout data are presented – both should be included in the manuscript. Again this is another incidence of ‘data not shown’. Panel C, it is not clear what mice the two graphs refer to from figure or figure legend – do they represent WT vs knockout mice? Different time points? Different tissues? Figure 4d is not labelled in the figure, and again should include both WT and knockout for comparison.18. Figure 4A-D: not clear why authors shift to a non-CS exposure setting for IL22 knockout experiments. Surely it would be more informative and fitting with the aims of this research paper to investigate WT vs IL22 KO in the setting of CS exposure and FLIC protective effects as has been done in the antibody blocking experiment?19. Figure 4F-G: The effect of anti IL22 on bacterial load is clear, yet the effects on inflammatory cells in the lungs and BAL are minimal – how do the authors reconcile this apparent discrepancy?20. Fig 5: label all graphs with air vs CS for clarity.21. Figure 5: Can authors confirm defensinb2 mRNA result with protein measurement? The authors claim in their abstract that “Flagellin treatment also amplified theproduction of the β-defensin2 anti-bacterial peptides.”. Based off the data presented this statement is misleading and should be revised. Without protein data the authors should not over-interpret this result as the data is limited.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.27 Jan 2021Additional Editor Comments:Both reviewers raised significant issues that must be considered and addressed carefully to allow further consideration of publication. Please note that methodological rigour is a prerequisite for publication in PloS One and therefore it is essential that comments related to these (group sizes, appropriate control groups, replication of findings) are addressed adequately.Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. During our internal review, we noticed you have overlapping text with the dissertation of one of the authors published here:https://tel.archives-ouvertes.fr/tel-01916088/documentPlease clarify what type of copyright, if any, the dissertation has and who the copyright owner is. PLOS ONE cannot (re)publish material without sufficient permission from the original copyright holder to publish under a CC BY license. If the copyright is not owned by the author and is not under a under a CC BY license, please complete one of the following:Please provide proof that the owner of the content (a) has given you written permission to use it, and (b) has approved of the CC BY license being applied to their content. You may have the following form completed by the owner as proof: https://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf.Alternatively, you may electronically request permissions through from the copyright holder and send us proof of approval, as long as the approval clearly shows that the owner has approved of the CC BY license being applied to their content. Please see https://journals.plos.org/plosone/s/licenses-and-copyright for more information.This archive includes the dissertation of Dr Bachirou Kone (one of our authors) PhD thesis and summarized the results presented in this article. Indeed, this research belonged to his PhD program. Moreover, the owner of this archive is the university of Lille, one of our institution. All the authors approved the copyright transfert to Plos One editor.3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.We have now included the results previously reported as data not shown in the text or as supplementary information. In some cases, we have removed these data if they are not essential to our demonstration..4. Your ethics statement must appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please also ensure that your ethics statement is included in your manuscript, as the ethics section of your online submission will not be published alongside your manuscript.This has been done in the revised version.5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.Reviewers' comments:Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: NoReviewer #2: Partly________________________________________2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: NoReviewer #2: NoWe have now extensively reviewed the methods and the results in order to clarify our results and their interpretation. Moreover, we have also modified the statistical analysis.________________________________________3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: NoReviewer #2: NoAll the data are now deposited as supplementary data.________________________________________4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: No________________________________________5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1:The manuscript describes use of a mouse model of chronic (12 week) CS-exposure induced lung disease directly followed by NTHi challenge.The title is confusing – ‘…..haemophilus influenzae induced exacerbations in CS-exposed mice’. Exacerbations of what…? It suggests that there is a pre-existing lung disease and NTHi infection is making this worse ie exacerbation. However as I read on there is no evidence of established (12 week CS-induced) lung disease. So I think the title needs re-thinking to better reflect the model. FLiC is given systemically (via intraperitoneal injection) – what is the rationale for this (to treat COPD exacerbation)? Have the authors tried targeted (airway) treatment?Although our model mimicks most of the clinical situation observed during COPD, we cannot call it as COPD. It is the reason why we used the mention “CS-exposd mice”. In order to avoid confusion, we have removed the exacerbation and changed the title as “The Toll-Like Receptor 5 agonist flagellin prevents non-typeable Haemophilus influenzae-induced lung infection in cigarette smoke-exposed mice”We have previously showed in our murine model of chronic exposure to CS that mice exhibit chronic inflammatory response associated with airway remodeling (peribronchial inflammation including metaplasia of bronchial epithelium), impaired bacterial clearance and parenchymal destruction in the lungs, further culminating in irreversible airflow limitation (ref 4). This model reproduces the most important characteristics of COPD as mentioned in this reference.The pathophysiology of COPD exacerbation episodes implicated a defect in IL-22 production and a deleterious effect of neutrophils on lung function. Moreover, local administration of FliC in the lung promotes a strong neutrophil recruitment in the airways with a moderate effect on IL-22 secretion as compared to the intraperitoneal route. For these reasons, we first tested the intraperitoneal route although we also demonstrated that local administration was also efficient on the bacterial clearance of Streptococcus pneumoniae (ref 25).ResultsThe first statement – ‘mice chronically exposed to CS developed the major COPD features’. What is the evidence for this? Simply providing a reference to another paper as evidence that CS exposure induced COPD features (which are not defined…) is not adequate. Based on title, abstract, intro this study appears (although a bit vague eg title) about bacterial exacerbation of COPD. Figs 1b and 1c present BAL and lung bacterial load data. Note the labelling is incorrect in figure legend. The results state levels of NTHi in the blood were measured – there is no data for this. The right panel for fig 1c indicates increased levels of bacteria in lung tissue with FliC treatment?We have previously validated these data by using the same protocol of 12 weeks exposure in the reference 4 (Pichavant et al. 2014). These mice developed a mild COPD phenotype including chronic inflammatory response associated with airway remodeling, impaired bacterial clearance and parenchymal destruction in the lungs, further culminating in irreversible airflow limitation. We always observed these phenotype in CS-exposed mice.We have modified the figure 1 according to your comment. As confirmed by the new statistical analysis (one way anova analysis (Kruskal Wallis test) followed by Dunn’s multiple comparison test), treatment with FliC did not significantly increased the bacterial load in lung tissue.Please show individual data points for each graph -are you showing n = 4 mice for one experiment or combining three repeats to show n = 12 per treatment? If n = 4 data is analysed this is not parametric and therefore mean +/-SEM not appropriate.Fig 1D does include a PBS treated group to enable comparison of CS vs air treated mice. There is no evidence of airway (BAL) inflammation. Airway inflammation woul be considered a ‘major feature of COPD’. Why do the authors think CS exposure has not caused airway inflammation? Fig 1E – no PBS group here so cannot determine if CS exposure (alone) vs air (alone) has caused any COPD-like disease such as alveolar destruction as measured by mean linear intercept via quantitation of lung histology.The data in figure 1 is not consistent with a model of bacterial COPD exacerbation since there are essentially no disease outcomes apparent in the CS (PBS) group vs Air (PBS) group. Ie no evidence that CS exposure has caused disease. The lung disease outcomes presented are driven by NTHi. The possibility that prior CS exposure has modified susceptibility to NTHi induced lung disease. However, no statistical comparison of CS (NTHi) vs Air (NTHi) has been conducted so there is no evidence that CS exposure has modified response to NTHi.Fig 1E – there is no CS (PBS) and Air (PBS) group so cannot assess CS-induced lung disease.The figures have been modified in order to include data points. This is not the topic of our article to demonstrate that CS induced features mimicking COPD and we have previously reported these data with the same experimental model with and without NTHi infection (ref 4 and 14). We also confirmed in the figure 1 that CS increased the bacterial load in CS-exposed mice and the inflammatory cell recruitment as previously reported (ref 14). We have added the data as requested.Fig 2 Unclear how many data points per treatment have been analysed. Please show individual data points – particularly if some groups have 3 mice so cannot determine if stats are appropriate… It is not clear to this reviewer what the key results here. Yes the different treatments are modifying cytokine expression – but the relevance of this to a specific pathway, disease mechanisms is not clear. Several sentences begin with ‘interestingly’ - interesting perhaps.. but is the relevance to bacterial COPD exacerbation, particularly given that this is not really modelling COPD exacerbation (no evidence of COPD-like disease)We have now included the figures including each experimental points representing one mice. As mentioned in the introduction the Th1 and Th17 cytokines are both implicated in the COPD physiopathology and in the anti-bacterial response (including NTHi). This explains the fact that we have analyzed their production and of cytokines controlling their secretion such as IL-12p70, IL-1β, IL-6 and IL-23.Fig 3. A lot of sup data or data not shown. Not clear why you are looking at immune cells in spleen when this a study of lung infection/disease. 3A cytokine production by spleen cells from CS-exposed mice +/- NTHi +/- FliC. Again don’t know number of data points for this data, and not statistically significant so does not add anything. 3B – why is this relevant and how does it inform on pathogenesis bacterial COPD exacerbation?Since the mice are treated by intraperitoneal route, we can hypothesize that this treatment first affect the immune response within the spleen. After this, we suspect that the modulation of the splenic immune response might have some impact within the lung through the recirculation of immune mediators or cells. The aim was not to elucidate the pathogenesis of COPD exacerbation, we have previously done this in the references 13 and 14, but to determine how flagellin might prevent these episodes. We can hypothesize that flagellin acts by inducing the circulation of Th1 and/or Th17 cells or mediators.Fig 4 ‘to identify the role of IL-22 in the effect of flagellin during NTHi infection…’ What effect specifically! The figure legend is confusing, lack detail and does not adequately describe the data. 4b – there is no effect on bacterial load. This is a single timepoint. Certainly a timecourse is necessary and might reveal reduced bacterial load/clearance with FliC treatment.4F data does indicate that FliC reduced bacterial load is mediated by IL-22 (again exact numbers per group need to be shown). Fig 4e does not appear that reduced bacterial load is associated with increased numbers in the lung of a particular immune cell population. You should avoid reporting data using subject language such as ‘slightly increase numbers…’ The conclusion for this data relates to protective effect of flagellin during COPD exacerbation – this is not accurate.Our data suggest that flagellin mostly prevent the NTHi-induced exacerbation of COPD by promoting the bacterial clearance and by decreasing the lung inflammatory reaction. So our aim in the figure 4 is to determine the role of IL-22 on both parameters. We have chosen this time points since we have previously showed that flagellin had a significant effect at day 2 and to efficiently addressed the impact on lung alterations and inflammation. We have modified the figure according to your requests and the related comments within the result sections has been clarified.Fig 5 for the most part FliC treatment reduced AMP expression with the exception of Defb2 gene at 24 h in CS-exposed mice.thWe agree with the comment of the reviewer. Our explanation for this effect is that treatment with flagellin accelerates the bacterial clearance within the lung and by this way, decreases the bacteria-induced AMP production. In this article, we also show that this treatment reduces the recruitment of effector cells such as macrophages and neutrophils. This might be the reflect of the same mechanism as mentioned in the discussion.Reviewer #2:Perez-Cruz and colleagues present a study in which they test the effect of systemic flagellin treatment on the ability of mice exposed to air or smoke to clear NTHi, and the effects on associated histopathology and immune response. The topic, use of innate immune modulators in a therapeutic setting, is of interest, and certainly relevant in COPD where bacterial infections resulting in exacerbation are a significant clinical issue. While there is merit to the study overall, I found the study a little disjointed and hard to follow, the methods inadequately described and some of the conclusions drawn by the authors to be misleading. Authors should attempt to address comments should be addressed prior to publication in PLOS ONE or elsewhere.We would like to thank the reviewer for his/her positive comments.Major comments:1. Stats section lists use of Mann-Whitney for pairwise comparisons. This is inappropriate given the comparisons between 4 or 6 experimental groups in most figures. Non-parametric test like Kruskal-Wallis should be applied followed by pairwise comparisons that are corrected for multiple comparisons by some method such as Dunn’s or Bonferoni.We have now re-analyzed our data by using one way ANOVA analysis (Kruskal Wallis test) followed by Dunn’s multiple comparison test. Our results section has been changed according to these analysis.2. Inaccuracy of abstract. The abstract claims two different modes of intervention with flagellin were trialled – “preventive and therapeutic”. This statement is misleading as the authors only applied flagellin at one time point, immediately prior to bacterial infection, so should perhaps best be described as “prophylactic”. Authors also make claims about defensinb2 peptide production that are not demonstrated in the results.We have now modified the abstract according to your comments and we have measured the concentrations of defensin-β2. These data showed that the concentrations of Defensin-β2 were higher in BALF from Air- and CS-exposed miceinfected with NTHi as compared to controls. However, treatment with FliC did not upregulated these levels both in the BAL and the lung protein extract. We have modified the result section and the figure 4 in order to include these data as well as our interpretation of these results. Accordingly, we have removed the mention that upregulation of defb2 mRNA can mediate the effect of flagellin. However, we cannot excluded that flagellin upregulates the expression of others AMP. We have also changed preventive for prophylactic.3. Number of mice per group per experiment – can the authors provide exact n for each group in each figure or individual figure panels – current descriptions are a bit vague and don’t give these details at sufficient level.As required by the reviewer 1, we have now added the individual points in each figure and the number of mice and/or of experiments was clarified.Further comments:4. Grammar and spelling require some attention – for example in abstract “According our preventative or therapeutic protocol, flagellin was administered intraperitoneally” - perhaps this should read “Flagellin was administered intraperitoneally in preventive or therapeutic treatment protocols.” or something similar. Other examples “Acute exacerbations invariably scarred the chronic course of COPD 9.” There are quite a lot of grammatical and spelling errors throughout the manuscript, careful copy editing required.Our manuscript has been carefully edited by an expert in English.5. Reference list needs to be carefully checked and updated – for example reference 14 is a paper published in 2016, but appears as ‘in press’ in the reference list.We have modified this reference and controlled the other ones.6. What was the status of mice purchased, were they SPF?All the mice used for our experiments are SPF. The mice were acclimated in our house facility during at least one week before to start our experimental protocol.7. Please detail briefly mention method of CS exposure in methods (whole body, nose only? Primary or secondary smoke?)The mice were exposed to primary cigarette smoke in a whole body chamber. We are using the Inexpose system from EMKA (Paris- France). This has been included in the methods section.8. Methods section only appears to list one time at which flagellin was administered (just prior to bacterial challenge), while the abstract refers to both preventive and therapeutic administration protocols – please make exactly clear what you mean by preventive and therapeutic administration in the method section. Therapeutic administration in mouse models refers to administration of an intervention after the insult, or after development of pathology.We have now indicated in the material and methods the specificities of both protocols (last paragraph of Miceinfection and flagellin administration).9. Details of the IL22 knockout mouse experiment are sparse. What strain were these mice on? Were appropriate WT controls employed? Statement in methods is IL22-/- mice were infected or not with NTHi – does this mean no PBS control was used? What about CS exposure? Were IL22 knockout mice also male and 6-8 weeks of age? More clarity needed in methods.WT and IL-22-/- mice have a C57BL/6J genetic background. Both are acclimated to our animal facility for at least one week before to start the protocols. In IL-22-/- mice, we used male mice and not-infectedmice received PBS. These KO mice were not exposed to CS since it has been reported that a defect in IL-22 impaired the development of lung disease in CS-exposed mice (Starkey MR et al, ERJ. 2019). We have precised in the revised version of our manuscript the origin of our KO mice and the conditions of the mice housing.10. Flow cytometry method, incomplete sentence “gating strategies are.” . Can example gating strategies be shown?Our gating strategy has been previously reported in the reference 14 from Sharan R. et al. We have added the reference in the section “flow cytometry”.11. How were lung cells dissociated? Clarify in methods.Lungs were perfused with PBS and right lobe of lung was treated with collagenase (Sigma-Aldrich). The leucocyte-enriched fraction was collected using a Percoll gradient (GE Healthcare) before flow cytometry staining and culture. This has been added in the « Sample collection and processing » section.12. Histology scoring – cumulative score of up to 30 doesn’t make sense looking at table 4 – max score possible is 28. Also how many high power fields were quantified per lung? Has this scoring system been published elsewhere? please referenceIndeed, we have made a mistake in this table. We have defined two parameters in order to measure the vasculitis, either endothelium necrosis or the presence of inflammatory cell recruitment around the blood vessel and one is missing in the first version of our article. We have modified the table in the revised version and the total of the score is in fact of 30. We have analyzed at least 5 high power fields and this scoring has been recently published (ref 25).13. Results page 11: “mice chronically exposed to CS developed the major COPD features” – what were these features and can you provide evidence of this? For example in graph 1d for PBS treated mice, there is no evidence of CS-induced increase in total BAL cell count, or neutrophil count, which seems unusual for a 12 week CS exposure and is not consistent with the induction of COPD-like features. Was histopathology score modified by CS vs ambient air alone?In order to complete the histologic analysis in our article, we have now measured the mean linear intercept (MLI) in lung sections of our mice (Sup table X). Mice exposed to CS exhibit a significantly higher histologic score and MLI as compared to mice exposed to air as previously reported (ref pichavant). Regarding the number of BAL total and neutrophil counts in control Air- and CS-exposed mice, the lack of difference is probably related to the fact that mice were no more exposed to CS during the infection protocol since they were transferred in a A2 animal facility for this. The sacrifices were performed 4-5 days (day 1 or 2 after infection) after the last exposure to CS.14. Results page 11: “This increase was consistent at 48h p.i. for the total` cell number and the neutrophil count (Additional figure 1c and not shown, p<0.01).” – do the authors mean supplemental figure 1c? Also I don’t think in the era of supplemental figures, that the authors should be referring to data not shown – please supply in supplemental figures – this comment also applies to other instances of data not shown in results.In the revised version of our manuscript, we have removed the data not shown and we have added the most important ones in the text and the supplementary figures. The cell number at 48h p.i. are indeed reported in the figure 1c.15. Results page 13 – Figure 3: “To further analyze the potential of lung immune cells to promote efficient antibacterial immune response, these cells were restimulated ex vivo with heat-killed (HK) bacteria and their cytokine profiles were assessed.” Are these experiements conducted on total lung cell suspensions, or isolated cell populations from lungs? Unclear if differences in cytokine production result from differential responses of cells in suspension or due to differential make up of lung cell suspensions tested. This data seems hard to make any meaningful interpretation from as it stands.In vitro cell activation was performed on total lung cell suspension. We cannot correlated the variation in cytokine production with significant modulation in percentages of leucocytes, T cell populations and not conventional T cells. Nevertheless, we cannot exclude this link and we have added a comment in the discussion concerning this potential link.16. Figure 3: graph axes should be better labelled so the figure is easier for the reader to interpret (e.g. pg/ml CYTOKINE X in TISSUE X)We have now modified the labelling of the figures in order to facilitate their reading.17. Figure 4A-D: schematic lists either WT or IL22-/- mice are infected, but data in panel b it is not clear if WT or knockout data are presented – both should be included in the manuscript. Again this is another incidence of ‘data not shown’. Panel C, it is not clear what mice the two graphs refer to from figure or figure legend – do they represent WT vs knockout mice? Different time points? Different tissues? Figure 4d is not labelled in the figure, and again should include both WT and knockout for comparison.The legend of this figure and the comment in the result section has been modified in order to improve the reading of these graphs. As mentioned above, the data not shown has been removed and the data were reported in the text.18. Figure 4A-D: not clear why authors shift to a non-CS exposure setting for IL22 knockout experiments. Surely it would be more informative and fitting with the aims of this research paper to investigate WT vs IL22 KO in the setting of CS exposure and FLIC protective effects as has been done in the antibody blocking experiment?The defect in IL-22 can also modify the response to CS as previously reported by Starkey et al (ref 17) . In this context, it will be difficult to compare the effect of infection by NTHi in CS-exposed WT and IL-22-/- mice if they exhibit a different response to CS and more specifically, different immune responses.19. Figure 4F-G: The effect of anti IL22 on bacterial load is clear, yet the effects on inflammatory cells in the lungs and BAL are minimal – how do the authors reconcile this apparent discrepancy?We suspect that IL-22 had no direct effect on the recruitment of inflammatory cells in contrast to its impact on bacterial clearance. In this model, the bacterial clearance was not related to the number of leucocytes. The priming of these cells is also essential in order to improve their ability to clear bacteria.20. Fig 5: label all graphs with air vs CS for clarity.The figure has been modified according to your comment.21. Figure 5: Can authors confirm defensinb2 mRNA result with protein measurement? The authors claim in their abstract that “Flagellin treatment also amplified theproduction of the β-defensin2 anti-bacterial peptides.”. Based off the data presented this statement is misleading and should be revised. Without protein data the authors should not over-interpret this result as the data is limited.The measurement of defensing-b2 by ELISA showed that the concentrations were higher in BALF from Air- and CS-exposed miceinfected with NTHi as compared to controls. However, treatment with FliC did not upregulated these levels both in the BAL and the lung protein extract. We have modified the result section and the figure 4 in order to include these data as well as our interpretation of these results. Accordingly, we have removed the mention that upregulation of defb2 mRNA can mediate the effect of flagellin.________________________________________6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoSubmitted filename: PLOS ONE comments.docxClick here for additional data file.26 Feb 2021The Toll-Like Receptor 5 agonist flagellin prevents Non-typeable Haemophilus influenzae-induced infection in cigarette smoke-exposed mice.PONE-D-20-19459R1Dear Dr. Gosset,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Aran SinganayagamAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2: No**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #2: The authors have addressed my comments, although there remain numerous spelling and grammatical errors in the text.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: No18 Mar 2021PONE-D-20-19459R1The Toll-Like Receptor 5 agonist flagellin prevents Non-typeable Haemophilus influenzae-induced infection in cigarette smoke-exposed mice.Dear Dr. Gosset:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Aran SinganayagamAcademic EditorPLOS ONE
Authors: Lucas Liaudet; Amitabha Deb; Pal Pacher; Jon G. Mabley; Kanneganti G. K. Murthy; Andrew L. Salzman; Csaba Szabo Journal: Drug News Perspect Date: 2002-09
Authors: Abraham B Roos; Sanjay Sethi; Jake Nikota; Catherine T Wrona; Michael G Dorrington; Caroline Sandén; Carla M T Bauer; Pamela Shen; Dawn Bowdish; Christopher S Stevenson; Jonas S Erjefält; Martin R Stampfli Journal: Am J Respir Crit Care Med Date: 2015-08-15 Impact factor: 21.405
Authors: Katia De Filippo; Daniel R Neill; Meg Mathies; Mathieu Bangert; Eileen McNeill; Aras Kadioglu; Nancy Hogg Journal: FASEB J Date: 2014-04-28 Impact factor: 5.191
Authors: Annalisa Lembo; Mark Pelletier; Ravi Iyer; Michele Timko; Jan C Dudda; T Eoin West; Christopher B Wilson; Adeline M Hajjar; Shawn J Skerrett Journal: J Immunol Date: 2008-06-01 Impact factor: 5.422
Authors: L Van Maele; D Fougeron; L Janot; A Didierlaurent; D Cayet; J Tabareau; M Rumbo; S Corvo-Chamaillard; S Boulenouar; S Jeffs; L Vande Walle; M Lamkanfi; Y Lemoine; F Erard; D Hot; T Hussell; B Ryffel; A G Benecke; J-C Sirard Journal: Mucosal Immunol Date: 2013-09-25 Impact factor: 7.313
Authors: Vyoma K Patel; Keshav R Paudel; Shakti D Shukla; Gang Liu; Brian G Oliver; Philip M Hansbro; Kamal Dua Journal: EXCLI J Date: 2022-02-25 Impact factor: 4.022