Literature DB >> 33760199

Serum from patients with hypertension promotes endothelial dysfunction to induce trophoblast invasion through the miR‑27b‑3p/ATPase plasma membrane Ca2+ transporting 1 axis.

Libo Zhu1, Zhuqing Liu1.   

Abstract

Pregnancy‑induced hypertension is often accompanied by preeclampsia. The present study investigated whether microRNA (miR)‑27b‑3p affected the occurrence of preeclampsia by regulating the function of endothelial cells. Expressions levels of miR‑27b‑3p and ATPase plasma membrane Ca2+ transporting 1 (ATP2B1) were determined using reverse‑transcription quantitative PCR. miR‑27b‑3p targeting ATP2B1 was predicted using bioinformatics and further confirmed by dual‑luciferase reporter assays. Cell Counting Kit‑8, Transwell and Matrigel tube formation assays were performed to detect the effects of miR‑27b‑3p on proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs), respectively. Moreover, HTR8/SVneos cells were co‑cultured with HUVECs to detect the invasion of trophoblast cells, and the expression levels of vascular endothelial growth factor (VEGF), matrix metalloproteinase (MMP)‑2 and MMP‑9 of HUVECs and HTR8/SVneos were detected by western blotting. Expression levels of miR‑27b‑3p were upregulated in the serum of patients with hypertension and preeclampsia, which could target and regulate the expression of ATP2B1. The expression levels of miR‑27b‑3p were increased and those of ATP2B1 were reduced in HUVECs from hypertensive serums. Moreover, miR‑27b‑3p mimics reduced the expression level of ATP2B1, and miR‑27b‑3p inhibitor reversed the effect of hypertensive serum on ATP2B1 expression. Furthermore, patients with hypertension showed increased endothelial dysfunction, reduced trophoblastic invasion and the expressions of VEGF, MMP‑2 and MMP‑9, and miR‑27b‑3p mimics and silencing of ATP2B1 produced similar results to HUVECs. The miR‑27b‑3p inhibitor reversed the effect of hypertensive serum, and silencing of ATP2B1 inhibited the improvement of miR‑27b‑3p inhibitor to HUVECs and HTR‑8/SVneo cells in proliferation, migration and tube formation. The current findings suggested that miR‑27b‑3p promoted proliferation, migration and tube formation of HUVECs and enhanced invasion of trophoblast cells, via regulation of ATP2B1. Thus, miR‑27b‑3p could be considered as a molecular risk factor in the pathogenesis and development of preeclampsia.

Entities:  

Keywords:  microRNA‑27b‑3p; ATPase plasma membrane Ca2+ transporting 1; HUVECs; hypertension; preeclampsia

Mesh:

Substances:

Year:  2021        PMID: 33760199      PMCID: PMC7974411          DOI: 10.3892/mmr.2021.11958

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Preeclampsia is a pregnancy-specific hypertensive disorder that may lead to the death of newborns and pregnant women (1). Patients with preeclampsia are likely to have placental dysplasia, which seriously affects the health of pregnant women and fetuses. Pregnant women with chronic hypertension have a significantly higher risk of developing preeclampsia compared with healthy pregnant women. For those with a family history of preeclampsia, the incidence of chronic hypertension is further greatly increased (2). In addition, the risk of patients with preeclampsia having chronic hypertension is estimated to be higher in the future compared with now (3,4). Researchers confirmed that the ATP2B1 gene is a gene susceptible to chronic hypertension among different races (5–7). The ATP2B1 gene, located at 12q21.3, encodes the ATPase plasma membrane Ca2+ transporting 1 (ATP2B1) protein, which belongs to the P-type ion transport ATPase family of proteins and is widely expressed in mammals (8). In 2009, through use of a genome-wide association study, Levy et al (9) conducted a large cohort study on two European populations, and found a single nucleotide polymorphism locus associated with chronic hypertension; the SNPrs2681472 locus located in the ATP2B1 gene. SNPrs2681472 polymorphism of ATP2B1 gene has been previously reported to be associated with early-onset preeclampsia among Chinese pregnant women (10). The SNPrs2681472 polymorphism of ATP2B1 gene may participate in the regulation of hypertension and preeclampsia by affecting ATP2B1 gene expression levels (5). In recent years, the effects of microRNAs (miRNAs/miRs) on hypertension and preeclampsia have been widely studied. miRNAs are non-coding RNAs 21–25 nucleotides in length, and are involved in ~30% of the regulation of gene expressions in the human genomes (11). A previous study by Wang et al (12) found that compared with normal pregnant women, the expression levels of nine miRNAs, namely, miR-223, −195, −17, −18a, −218, −19b1, −379, −92a1 and miR-411, are reduced in placenta tissues of patients with severe preeclampsia compared with controls. Moreover, the expression of another seven miRNAs (miR-30a-3p, −210, −524, −518b, −18a, −17-3 and −411) are also reduced, and miR-151 and miR-193b expression levels are increased in the tissues derived from patients with preeclampsia (13). Previous studies showed that miR-125b-5p, −100-5p and −199a-5p have a low level of expression in the peripheral blood of patients with pregnancy-induced hypertension and preeclampsia (14). Compared with normal pregnant women, the levels of total miRNAs and hsa-miR-210 in peripheral blood of pregnant women with hypertensive are significantly increased. hsa-miR-210 has been seen as a suitable biomarker for indicating pregnancy-induced hypertension (15). Moreover, miR-210 is involved in the pathogenesis of preeclampsia (16). Recently, it has been found that miR-27b-3p participates in various pathological processes, including in tumor angiogenesis, lipid metabolism, inflammatory response and the oxidative stress response (17). The present study was designed to explore the relationship between hypertension and preeclampsia, and the role of miR-27b-3p. miR-27b-3p was found to be upregulated in patients with hypertension and patients with preeclampsia. The effects of miR-27b-3p on HUVECs stimulated by the serum of patients with hypertension were investigated. Moreover, the effects of miR-27b-3p on HTR-8/SVneo cells co-cultured with HUVECs cells were explored, following stimulation by the serum of patients with hypertension. These results confirmed that miR-27b-3p might be a diagnostic marker for hypertension and preeclampsia.

Materials and methods

Patients

Normal pregnant women (n=21; age 33.5±4; body mass index 22.3±3 kg/m2; vaginal delivery), women with preeclampsia (n=21; age 34.1±5; body mass index 24.6±4 kg/m2; vaginal delivery), female patients with hypertension (n=13; 51.5±4) and female healthy volunteers (n=13; 52.5±4), who attended The Affiliated Hangzhou First People's Hospital, were included. The study was approved by The Affiliated Hangzhou First People's Hospital Ethics Committee (Hangzhou, China). All subjects were informed of the purpose and process of the study, and signed an informed consent form. The inclusion criteria of normal pregnant women are: i) Healthy subjects; ii) delivery after 37 weeks; iii) successful pregnancy without any complications, normal blood pressure and negative proteinuria. The diagnostic criteria for preeclampsia are: i) Hypertension after 20 weeks of pregnancy and ii) positive proteinuria. Systolic blood pressure (>140 mmhg) and/or diastolic blood pressure (>90 mmhg) served as diagnostic criteria for hypertension, with proteinuria ≥0.3 g/24 h. Patients with a history of diabetes, chronic kidney disease and/or heart disease were excluded. The venous blood of pregnant women was collected (3 ml) at birth and centrifuged at 12,000 × g for 8 min at 4°C. The serums were stored at −80°C.

Cell culture and treatment

HUVECs and HTR-8/SVneo cells were purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. The cells were grown in RPMI-1640 media containing 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 ng/ml streptomycin (Sigma-Aldrich; Merck KGaA) in a humid incubator at 37°C with CO2. When the density of cells (1×106 cells/ml) reached 70–80%, the cells either remained untransfected or were transfected with miR-27b-3p inhibitor control (cat. no. 4464076, Thermo Fisher Scientific, Inc.,), miR-27b-3p inhibitor (cat. no. 4464084, Thermo Fisher Scientific, Inc.,) or miR-27b-3p mimics (cat. no. 4464066, Thermo Fisher Scientific, Inc.,) using Lipofectamine® RNAiMAX (Invitrogen; Thermo Fisher Scientific, Inc.). After recovery in fresh medium for 24 h, the cells transfected with either the miR-27b-3p inhibitor control or miR-27b-3p inhibitor were cultured in the medium added with 10% serum from patients with hypertension for 24 h as Serum + control (C) cells and Serum + inhibitor (I) cells. The untransfected cells or those transfected with miR-27b-3p mimics, mimics control (MC) and inhibitor control (IC) were cultured in fresh medium for 24 h as C cells, mimic (M) cells, MC and IC cells.

Reveres-transcription-quantitative PCR (RT-qPCR) assay

Total miRNAs were separated from tissues and cells using a miRNeasy Mini kit (cat. no. 217004; Qiagen GmbH) following the manufacturer's instructions, and 1 µg of miRNAs was used to obtain cDNAs with a miScript II reverse transcription kit (cat. no. 218160; Qiagen GmbH) at 37°C for 15 min and 98°C for 5 min. In addition, total cellular RNA was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and the SMART MMLV Reverse Transcriptase (cat. no. 639523; Takara Bio, Inc.) was used to reverse-transcribe mRNAs into cDNAs at 37°C for 15 min and 98°C for 5 min. Then, the levels of miRNAs were detected using a miScript SYBR-Green PCR kit (cat. no. 218075; Qiagen GmbH) according to the manufacturer's instructions (18), and the mRNA levels were measured using SYBR Premix Ex Taq kit (cat. no. RR820A; Takara Bio, Inv.) in an ABI7300 Thermocycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). U6 served as an endogenous control of miRNA, and GAPDH was used to normalize the mRNAs. The sequences of primers used are listed in Table I. The reaction conditions were as follows: Denatured at 95°C for 10 min followed by 40 cycles at 95°C for 10 sec, at 60°C for 20 sec and at 72°C for 30 sec. Gene expression levels were calculated using 2−ΔΔCq method (19).
Table I.

Primer base sequences.

Primer nameSequence (5′-3′)
miR-27b-3pForward: CTCAACTGGCGTGGAGTCGGCAATTCAGTTGAGGCAGAACT
miR-27b-3pReverse: ACACTCCAGCTGGGTTCACAGTGGCTAAG
ATP1B2Forward: TGTGTTGGCAAGAGAGATGAAGA
ATP1B2Reverse: GGGTCACATTCAGGAACTTTACA
GAPDHForward: CACCCACTCCTCCACCTTTG
GAPDHReverse: CCACCACCCTGTTGCTGTAG
U6Forward: CTCGCTTCGGCAGCACA
U6Reverse: AACGCTTCACGAATTTGCGT

miR, microRNA.

Western blotting

Total cell proteins were extracted by RIPA buffer (cat. no. 9806; Cell Signaling Technology, Inc.), and protein concentration was measured by BCA. A total of 50 µg protein/lane was separated by 12% SDS-PAGE, and then transferred to PVDF membrane by electroporation. The membrane was blocked for 1 h using 5% skimmed milk powder dissolved in PBS at room temperature. The membranes were incubated overnight with anti-ATP1B2 (1:1,000; cat. no. ab185210; Abcam), anti-vascular endothelial growth factor (VEGF; 1:1,000 cat. no. ab53465; Abcam), anti- matrix metalloproteinase (MMP)-2 (1:1,000; cat. no. ab97779; Abcam,), anti-MMP-9 (1:1,000; cat. no. ab38898; Abcam,) and anti-GAPDH (1:2,000; cat. no. ab9485; Abcam) at 4°C. Then the membranes were washed three times with PBST including 0.05% Tween-20, incubated the HRP-conjugated rabbit anti-mouse IgG H&L antibody (1:2,000; cat. no. ab6728; Abcam) at room temperature for 1 h, and then washed three times with PBST. Finally, the membranes were visualized using ECL detection reagents (Thermo Fisher Scientific, Inc.) and then semi-quantified using ImageJ software (version 1.48; National Institutes of Health).

Dual-luciferase reporter gene assay

The HUVECs were cultured in 24-well plates and co-transfected with 200 ng/µl miR-27b-3p mimics, miR-27b-3p inhibitor or miRNA control, and 200 ng of pGL3-ATP2B1-3′UTR or pGL3-ATP2B1-mutant (mut, 5′-AUGUCUUGGUGAAUCGUCGG-3′)-3′UTR using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After transfection for 36 h, luciferase activity was measured with the dual-luciferase assay system (Promega Corporation). Luciferase activity of genes was normalized to that of the Renilla luciferase. All analyses and experiments were performed in triplicate.

Cell Counting Kit (CCK)-8 assay

The HUVECs (5×103 cells/ml) were inoculated into a 96-well plate. miRNA control, miR-27b-3p inhibitor or miR-27b-3p mimics was transfected into the cells, followed by stimulation with 10% serum from patients with hypertension or in combination with Trifluoperazine (TFP; MedChemExpress), which is an inhibitor of ATP2B1 (20). After cell culture for 48 h, 10 µl CCK-8 reagent was added into the cells and incubated together for 4 h. The absorbance value was detected at 490 nm by a microplate reader (Bio-Rad Laboratories, Inc.).

Cell migration assay

A cell suspension of serum-free medium was prepared at 1×105 cells/ml, and inoculated into the upper chamber of a Transwell dish in 100 µl/well, while complete medium including the 10% FBS was added to the lower chamber. After incubation for 48 h at 37°C, the cells remaining in the upper chamber were wiped off using a cotton swab, and the invading cells were fixed with 4% polyformaldehyde at room temperature for 15 min and stained by crystal violet. Cell migration was calculated from five randomly selected visual fields with a light microscope at ×200 magnification (XDS-800D; Shanghai Caikon Optical Instrument Co., Ltd.). The average number of transplanted cells was counted manually in five randomly selected fields.

Tube formation assay

The bottom of the culture plate was added with 0.3 ml growth factor-reduced Matrigel and rested for 10 h at 3°C. The HUVECs were cultured on upper side of the Matrigel for 12 h, then the culture medium was discarded, and cells were cultured for 24 h in the complete culture medium with 10% FBS. The formation of tubules was observed under an inverted light microscope (XDS-800D; Shanghai Caikon Optical Instrument Co., Ltd.).

Trophoblast invasion assay

For the trophoblast invasion assays, each Transwell chamber 100 μl of growth factor-reduced Matrigel (placed in a 24-hole plate) was added in the upper chamber, and then solidified in an incubator at 37°C for 2 h. Trophoblast HTR-8/SVneo cells (5×103 cells) were seeded into the upper chamber. The transfected HUVECs (2×104 cells) under the aforementioned conditions were added into the lower chamber for 24 h at 37°C. Next, the chamber was removed, and the remaining cells in the upper chamber were wiped off using cotton swabs, while those which had invaded the lower chamber were fixed and stained by hematoxylin and eosin at room temperature for 15 min, observed under an inverted light microscope (XDS-800D; Shanghai Caikon Optical Instrument Co., Ltd.) at ×200 magnification and images were captured. Invasion was evaluated by counting the cells in five randomly selected fields. Bioinformatics TargetScan7.2 (targetscan.org) predicted that miR-27b-3p could target the 3′-UTR of ATP2B1.

Statistical analysis

The data were analyzed by GraphPad Prism 5.0 software, and shown as mean ± standard deviation with ≥3 independent experiments. Statistical significance was determined by unpaired Student's t-test or one-way ANOVA followed by Tukey's post hoc test according to the number of experimental groups analyzed. P<0.05 was used to indicate a statistically significant difference.

Results

miR-27b-3p is upregulated in serum of patients with hypertension and preeclampsia

The clinical characteristics of patients were described in Table II. Expression levels of miR-27b-3p were detected in higher concentrations in the serum of patients with hypertension compared with those in the serum of healthy females (Fig. 1A). Furthermore, miR-27b-3p expression levels were also found to be higher in the serum of patients with preeclampsia compared with those in normal pregnant women (Fig. 1B).
Table II.

Clinical characteristics.

VariableNormal pregnant women, n=21Preeclampsia, n=21Hypertension, n=13Healthy volunteers, n=13
Maternal age, years33.5±434.1±5
Age, years51.5±452.5±4
Gestational age, weeks37.5±1.636.8±2.3
Body mass index, kg/m222.3±324.6±422.6±3.821.1±2
Mode of deliveryVaginalVaginal
Baby birth weight, kg3.2±0.332.9±0.49
Figure 1.

miR-27b-3p is upregulated in patients with hypertension and patients with PE, and miR-27b-3p targets ATP2B1. The level of miR-27b-3p was measured in (A) patients with hypertension and (B) patients with PE using RT-qPCR. (C) A predicted target site for miR-27b-3p was identified in the 3′-UTR of ATP2B1. (D) Luciferase activity was determined using a dual-luciferase reporter assay kit. (E) After HUVECs treated with the serum from patients with hypertension, the level of miR-27b-3p was detected using RT-qPCR. (F) After HUVECs were treated with the serum of patients with hypertension, the expression of ATP2B1 was detected using western blotting. ^^P<0.01 vs. normal, **P<0.01 vs. control. ATP2B1, ATPase plasma membrane Ca2+ transporting 1; HTN, hypertension; miR, microRNA; mut, mutant; PE, preeclampsia; RT-qPCR, reverse transcription-quantitative PCR; UTR, untranslated region; wt, wild-type; HUVECs, human umbilical vein endothelial cells.

ATP2B1 is a target gene of miR-27b-3p

ATP2B1 was a hypertensive-susceptible gene, and its expression was downregulated in preeclampsia women (21). Moreover, downregulation of ATP2B1 could increase blood pressure. TargetScan predicted that miR-27b-3p could target the 3′-UTR of ATP2B1 (Fig. 1C). Subsequently, luciferase reporter assays were performed, and demonstrated that the miR-27b-3p mimic reduced luciferase activity in the ATP2B1 wild-type (wt) group, and that miR-27b-3p inhibitor increased luciferase activity in the ATP2B1 wt group compared with the control and mut groups. These results demonstrated that miR-27b-3p targeted ATP2B1 to reduce its expression (Fig. 1D).

Expression levels of ATP2B1 and miR-27b-3p are differentially regulated in HUVECs stimulated with the serum of patients with hypertension

A previous study demonstrated that hypertension can induce dysfunction of HUVECs (22). In the present study, miR-27b-3p and ATP2B1 were predicted to be involved in the regulation of HUVECs biological functions. Subsequent results indicated that the miR-27b-3p expression levels were increased and those of ATP2B1 were reduced when HUVECs were stimulated with the serum of patients with hypertensive (Fig. 1E and F). The expression of miR-27b-3p decreased after miR-27b-3p inhibitor transfection, and increased after miR-27b-3p mimics transfection (Fig. 2A and B). Furthermore, the protein and mRNA expression levels of ATP2B1 were downregulated in HUVECs transfected with miR-27b-3p mimics, which was consistent with the results that HUVECs were stimulated by the serum of patients with hypertension (Fig. 2C and D). In addition, adding the serum of patients with hypertension after the transfection of the miR-27b-3p inhibitor into HUVECs restored the down-regulation of ATP2B1 caused by the hypertensive serum stimulation alone (Fig. 2C and D). The present results therefore revealed that the serum of patents with hypertension reduced the expression of ATP2B1 in HUVECs.
Figure 2.

The expression of ATP2B1 was reduced in HUVEC cells following treatment with the serum of patients with hypertension, and miR-27b-3p regulated the expression of ATP2B1. The transfection efficiency of (A) miR-27b-3p inhibitor or (B) mimics were detected using RT-qPCR. After HUVECs were treated with the serum of patients with hypertension and/or miR-27b-3p inhibitor or mimics, the protein and mRNA expressions of ATP2B1 were detected using (C) western blotting and (D) RT-qPCR. ††P<0.01 vs. MC, ##P<0.01 vs. IC; **P<0.01 vs. C, ^^P<0.01 vs. Serum+C. ATP2B1, ATPase plasma membrane Ca2+ transporting 1; C, control; M, mimic; miR, microRNA; I, inhibitor; MC, mimic control; IC, inhibitor control; RT-qPCR, reverse transcription-quantitative PCR; HUVECs, human umbilical vein endothelial cells.

Effect of miR-27b-3p on angiogenesis of HUVECs in vitro

The dysfunction of endothelial cells could cause blockage of angiogenesis, which was the main cause of preeclampsia (23). The effects of miR-27b-3p on endothelial angiogenesis were examined in vitro, and it was observed that serum from hypertensive patients inhibited the proliferation of endothelial cells. Furthermore, such an effect was reversed by the transfection of an miR-27b-3p inhibitor into HUVECs, but the subsequent addition of an ATP2B1 inhibitor, TFP, alongside the miR-27b-3p inhibitor served to inhibit the proliferation of endothelial cells again (Fig. 3A). This demonstrated that miR-27b-3p mimics or TFP treatment of HUVECs inhibited the cell proliferation, and similar effects were observed on cell migration and tubular formation (Fig. 3B and C). Moreover, miR-27b-3p mimics and inhibiting ATP2B1 decreased the expressions of VEGF, MMP-9 and MMP-2 in HUVECs. miR-27b-3p inhibitor increased the expressions of VEGF, MMP-9 and MMP-2, while inhibition of ATP2B1 could reverse the aforementioned effects on HUVECs (Fig. 3D). These results indicated that miR-27b-3p inhibited endothelial cell angiogenesis through targeting ATP2B1.
Figure 3.

miR-27b-3p inhibited the process of angiogenesis of HUVECs. The experimental groups were as follows: i) HUVECs were transfected with C miRNA; ii) HUVECs transfected with C were stimulated by the serum of patients with hypertension; iii) HUVEC cells were transfected with miR-27b-3p I, followed by stimulation with the serum of patients with hypertension; iv) HUVECs were transfected with miR-27b-3p I, followed by stimulation with the serum of patients with hypertension and TFP; v) HUVECs transfected with miR-27b-3p M; vi) HUVECs transfected with C miRNA and treated with TFP (A) HUVECs viability was determined by CCK-8. (B) Cell migration was detected by Transwell assay. (C) Endothelial cell tube formation was determined on a layer of growth factor-reduced Matrigel. (D) The expressions of VEGF, MMP-9 and MMP-2 were detected by western blot analysis. **P<0.01 vs. C, ##P<0.01 vs. Serum+C, ^^P<0.01 vs. Serum+miR-27b-3p I. C, control; CCK-8, Cell Counting Kit-8; I, inhibitor; M, mimic; TFP, trifluoperazine; MMP, matrix metalloprotenase; VEGF, vascular endothelial growth factor; HUVECs, human umbilical vein endothelial cells.

miR-27b-3p promotes trophoblast invasion in a co-culture system of endothelial cells and trophoblast cells

Endothelial cells have an important role in the invasion of trophoblast cells, which possess a critical function in maintaining normal pregnancy, and any disturbance between these two cells will induce the occurrence of preeclampsia (24). In the present study, the invasion of trophoblast cells was detected by a co-culture system of endothelial cells and trophoblast cells. The data revealed that the invasion of co-cultured trophoblast HTR-8/SVneo cells was inhibited when HUVECs were treated with the serum from patients with hypertension, miR-27b-3p mimics or TFP; however, the aforementioned effects of the hypertensive serum were reversed by an miR-27b-3p inhibitor. In addition, the invasion of trophoblast HTR-8/SVneo cells was again inhibited by the addition of TFP (Fig. 4A). In addition, miR-27b-3p mimics and inhibition of ATP2B1 decreased the expression of VEGF, MMP-9 and MMP-2 in a co-culture of HTR-8/SVneo and HUVEC cells. miR-27b-3p inhibitor could increase the expressions of VEGF, MMP-9 and MMP-2, and ATP2B1 inhibition was found to reverse the effect in a co-culture of HTR-8/SVneo and HUVEC cells hypertension model (Fig. 4B). These results demonstrated that endothelial miR-27b-3p inhibited the invasion of trophoblast HTR-8/SVneo cells through targeting ATP2B1.
Figure 4.

miR-27b-3p inhibited endothelial cell tube formation and trophoblast invasion by suppressing the expression of ATP2B1. The HUVEC experimental groups were as follows: Transfected with i) C miRNA; ii) C miRNA and stimulated by serum from patients with hypertension; iii) miR-27b-3p I, and stimulated with serum from patients with hypertension; iv) miR-27b-3p I, followed by stimulation with serum from patients with hypertension and TFP; v) miR-27b-3p M and vi) C miRNA and treated with TFP. (A) HUVECs were co-cultured with trophoblastic HTR-8/SVneo cells in Transwell plates for 5 h. HTR-8/SVneo cells invasion was detected and analyzed using ImageJ software. (B) After HTR-8/SVneo cells were isolated, the expression levels of VEGF, MMP-9 and MMP-2 were detected using western blotting. **P< 0.01 vs. C, ##P<0.01 vs. Serum+C, ^^P<0.01 vs. Serum+miR-27b-3p I. miR, microRNA; ATP2B1, ATPase plasma membrane Ca2+ transporting 1; TFP, trifluoperazine; C, control; I, inhibitor; M, mimic; MMP, matrix metalloproteinase; VEGF, vascular endothelial growth factor; HUVECs, human umbilical vein endothelial cells.

Discussion

Preeclampsia, which is one of the most important complications during pregnancy, seriously threatens the health of mothers and infants (25,26). Studies have showed that endothelial dysfunction and placental trophoblast invasion play important roles in the pathogenesis of preeclampsia (27,28). Preeclampsia is often accompanied by hypertension, and vascular endothelial cell dysfunction is closely related to hypertension (29,30). As miRNAs are highly-expressed under hypertension, they may have clinical value in early diagnosis of hypertension and prognosis of complications (31,32). Detection of the expression levels of miRNAs in peripheral blood mononuclear cells of healthy individuals and those with hypertension showed that the expressions of miR-1, miR-21, −208b and −499 were increased, and the expressions of miR-26b and −133a were reduced in patients with hypertension (33). Migration and vascularization of the three types of endothelial cells are regulated by miR-505/FGF18 (34). miR-27b-3p is a multifunctional miRNA molecule that plays an important role in numerous physiological and pathological processes (35–37), and is closely related to cell proliferation, invasion, migration and apoptosis (38–40). The current study found that miR-27b-3p expression was elevated in the serum of patients with hypertension and preeclampsia. The ATP2B1 gene is known to be a risk gene for hypertension (41), and hypertension is a risk factor for preeclampsia (42). The risk of preeclampsia in patients with chronic hypertension is known to be increased after the incidence of pregnancy (43). ATP2B1 acts as a sodium/calcium exchanger to transport intracellular Ca2+ to the outside of the cells, thereby maintaining a low intracellular Ca2+ concentration in the resting state, which then affects the function of endothelial cells and angiogenesis (44,45). Higher nitric oxide production and endothelial nitric oxide synthase activity, which are related with reduced ATP2B1 activity, could induce endothelial cell injury (46). The present results showed that ATP2B1 was targeted by miR-27b-3p and low-expression levels in HUVECs were stimulated by hypertensive patients' serum, which could help to reduce cell migration and invasion. Preeclampsia a disease that occurs during pregnancy, with superficial placenta implantation and uterine spiral artery remodeling disorder as its main pathological mechanisms (25,47). This process is an orderly activity, where active trophoblast cells and endothelial cells form a linkage through cell proliferation, invasion and tube formation (48,49). Angiogenesis plays an important role in tissue repair and organ growth. Imbalance in angiogenesis will easily lead to the occurrence and development of several diseases, including preeclampsia (50). VEGF is a highly specific mitogen that promotes vascular endothelial cell division, and is closely related to angiogenesis (51). The high expression of VEGF can promote vascular endothelial cell division and the expression of MMP to increase the infiltration and promotion of cell migration and invasion and angiogenesis of endothelial cells (52,53). Moreover, degradation of extracellular matrix by MMPs is known to be a rate-limiting step for trophoblast invasion (54). miR-378 has been shown to bind to VEGF and promote angiogenesis (55). Abnormal expression of miR-10b and −200c can regulate the expression of soluble Fma-like tyrosine kinase-1, and induce vascular endothelial injury and vascular remodeling disorder (56). Wang et al (12) found that the expression of miR-16 in decidua-derived mesenchymal stem cells (dMSCs) of patients with severe preeclampsia is significantly increased. miR-16 was negatively correlated with cyclin E1 and VEGF-A in dMSCs from severe preeclampsia. Furthermore, miR-16 is known to regulate the migration and tube formation of endothelial cells (12). A recent study has shown that miR-27b suppressed endothelial cell proliferation and migration by targeting Smad7 in Kawasaki disease (57). In the present study, a miR-27b-3p inhibitor was shown to ameliorate the impairment of endothelial cells known to be induced by hypertensive serum, angiogenesis and trophoblast invasion, all of which are characteristics of preeclampsia (58). Moreover, miR-27b-3p inhibited the process of angiogenesis of HUVECs and invasion of trophoblasts with ATP2B1 inhibition, and also inhibited the expression of VEGF, MMP-9 and MMP-2 in HUVECs. Furthermore, similar changes to VEGF, MMP-9 and MMP-2 expression were observed when testing the HTR-8/SVneo trophoblast cells. The results indicated that serum from patients with hypertension promoted endothelial dysfunction to induce trophoblast invasion through the miR-27b-3p/ATP2B1 axis. The limitation of the present study is that the main signaling pathways need further study (such as Akt signaling). Furthermore, in vivo experiments would be beneficial in order to clarify the effects of miR-27b-3p/ATP2B1 on preeclampsia in a natural setting and determine if miRNA expression could be successfully used as a biomarker. Taken together, expression of miR-27b-3p was upregulated in patients with hypertension and patients with preeclampsia. Downregulation of miR-27b-3p could inhibit the dysfunction of endothelial cells induced by the serum of patients with hypertension and promote the invasion of trophoblast cells through upregulating ATP2B1, thus inhibiting the development of preeclampsia. In addition, the present data revealed that miR-27b-3p might be a novel predictive risk factor of endothelial dysfunction and hypertension. The current findings may improve our understanding of the pathogenesis of preeclampsia.
  57 in total

1.  Pathophysiology of hypertension during preeclampsia linking placental ischemia with endothelial dysfunction.

Authors:  J P Granger; B T Alexander; M T Llinas; W A Bennett; R A Khalil
Journal:  Hypertension       Date:  2001-09       Impact factor: 10.190

Review 2.  Preeclampsia as a female-specific risk factor for chronic hypertension.

Authors:  José T Drost; Angela H E M Maas; Jim van Eyck; Yvonne T van der Schouw
Journal:  Maturitas       Date:  2010-09-15       Impact factor: 4.342

Review 3.  Placental origins of preeclampsia: challenging the current hypothesis.

Authors:  Berthold Huppertz
Journal:  Hypertension       Date:  2008-02-07       Impact factor: 10.190

4.  Applications of Metabolomics in the Study and Management of Preeclampsia; A Review of the Literature.

Authors:  Rachel S Kelly; Rachel T Giorgio; Bo L Chawes; Natalia I Palacios; Kathryn J Gray; Hoooman Mirzakhani; Ann Wu; Kevin Blighe; Scott T Weiss; Jessica Lasky-Su
Journal:  Metabolomics       Date:  2017-06-12       Impact factor: 4.290

5.  MicroRNA-505 identified from patients with essential hypertension impairs endothelial cell migration and tube formation.

Authors:  Qinbo Yang; Chenglin Jia; Peiwei Wang; Minqi Xiong; Jingang Cui; Li Li; Wenjian Wang; Qingyu Wu; Yu Chen; Teng Zhang
Journal:  Int J Cardiol       Date:  2014-10-08       Impact factor: 4.164

6.  People with the major alleles of ATP2B1 rs17249754 increases the risk of hypertension in high ratio of sodium and potassium, and low calcium intakes.

Authors:  J W Daily; B C Kim; M Liu; S Park
Journal:  J Hum Hypertens       Date:  2017-09-21       Impact factor: 3.012

7.  Up-regulation of CD81 inhibits cytotrophoblast invasion and mediates maternal endothelial cell dysfunction in preeclampsia.

Authors:  Li Shen; Zhenyu Diao; Hai-Xiang Sun; Gui-Jun Yan; Zhiqun Wang; Ruo-Tian Li; Yimin Dai; Jingmei Wang; Jie Li; Hailing Ding; Guangfeng Zhao; Mingming Zheng; Pingping Xue; Mo Liu; Yan Zhou; Yali Hu
Journal:  Proc Natl Acad Sci U S A       Date:  2017-02-06       Impact factor: 11.205

8.  Regulation and localization of vascular endothelial growth factor within the mammary glands during the transition from late gestation to lactation.

Authors:  M K VanKlompenberg; R Manjarín; C E Donovan; J F Trott; R C Hovey
Journal:  Domest Anim Endocrinol       Date:  2015-09-25       Impact factor: 2.290

9.  Identification of hypertension-susceptibility genes and pathways by a systemic multiple candidate gene approach: the millennium genome project for hypertension.

Authors:  Katsuhiko Kohara; Yasuharu Tabara; Jun Nakura; Yutaka Imai; Takayoshi Ohkubo; Akira Hata; Masayoshi Soma; Tomohiro Nakayama; Satoshi Umemura; Nobuhito Hirawa; Hirotsugu Ueshima; Yoshikuni Kita; Toshio Ogihara; Tomohiro Katsuya; Norio Takahashi; Katsushi Tokunaga; Tetsuro Miki
Journal:  Hypertens Res       Date:  2008-02       Impact factor: 3.872

10.  Differential expression of hypertension-associated microRNAs in the plasma of patients with white coat hypertension.

Authors:  Mahir Cengiz; Omer Faruk Karatas; Erkan Koparir; Serap Yavuzer; Chayar Ali; Hakan Yavuzer; Emre Kirat; Yesari Karter; Mustafa Ozen
Journal:  Medicine (Baltimore)       Date:  2015-04       Impact factor: 1.889

View more
  3 in total

Review 1.  Preeclamptic Women Have Disrupted Placental microRNA Expression at the Time of Preeclampsia Diagnosis: Meta-Analysis.

Authors:  Andja Cirkovic; Dejana Stanisavljevic; Jelena Milin-Lazovic; Nina Rajovic; Vedrana Pavlovic; Ognjen Milicevic; Marko Savic; Jelena Kostic Peric; Natasa Aleksic; Nikola Milic; Tamara Stanisavljevic; Zeljko Mikovic; Vesna Garovic; Natasa Milic
Journal:  Front Bioeng Biotechnol       Date:  2021-12-24

2.  Circulating miR-27b as a Biomarker of the Development and Progression of Carotid Artery Stenosis.

Authors:  Tingting Lu; Xin Li; Chunxi Long; Wenyuan Ji; Linjun Jiang; Jianquan Tian
Journal:  Clin Appl Thromb Hemost       Date:  2021 Jan-Dec       Impact factor: 2.389

3.  High miR-200a-3p expression has high diagnostic values for hypertensive disorders complicating pregnancy and predicts adverse pregnancy outcomes.

Authors:  Xin He; Danni Ding
Journal:  BMC Pregnancy Childbirth       Date:  2022-06-15       Impact factor: 3.105

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.