| Literature DB >> 33749126 |
Yang Yu1,2,3, Meng Chen1,2,3, Shiyao Yang1,2,3, Bingyi Shao1,2,3, Liang Chen1,2,3, Lei Dou1,2,3, Jing Gao1,2,3, Deqin Yang1,2,3.
Abstract
Thanks to the advantages of easy harvesting and escape from immune rejection, autologous bone marrow-derived mesenchymal stem cells (BMSCs) are promising candidates for immunosuppressive therapy against inflammation and autoimmune diseases. However, the therapy is still challenging because the immunomodulatory properties of BMSCs are always impaired by immunopathogenesis in patients. Because of its reliable and extensive biological activities, osthole has received increased clinical attention. In this study, we found that BMSCs derived from osteoporosis donors were ineffective in cell therapy for experimental inflammatory colitis and osteoporosis. In vivo and in vitro tests showed that because of the down-regulation of Fas and FasL expression, the ability of osteoporotic BMSCs to induce T-cell apoptosis decreased. Through the application of osthole, we successfully restored the immunosuppressive ability of osteoporotic BMSCs and improved their treatment efficacy in experimental inflammatory colitis and osteoporosis. In addition, we found the immunomodulatory properties of BMSCs were enhanced after osthole pre-treatment. In this study, our data highlight a new approach of pharmacological modification (ie osthole) to improve the immune regulatory performance of BMSCs from a healthy or inflammatory microenvironment. The development of targeted strategies to enhance immunosuppressive therapy using BMSCs may be significantly improved by these findings.Entities:
Keywords: Fas/FasL; bone marrow-derived mesenchymal stem cells; immunosuppressive therapy; osthole
Year: 2021 PMID: 33749126 PMCID: PMC8107110 DOI: 10.1111/jcmm.16459
Source DB: PubMed Journal: J Cell Mol Med ISSN: 1582-1838 Impact factor: 5.310
RT‐PCR primers
| Genes | Primer sequences |
|---|---|
| β‐actin | Forward: 5’‐CTGGCACCACACCTTCTACA‐3’ |
| Reverse: 5’‐GGTACGACCAGAGGCATACA‐3’ | |
| FasL | Forward: 5’‐CTGGGTTGTACT TCGTGTATTCC‐3’ |
| Reverse: 5’‐TGTCCAGTAGTGCAGTAGTTCAA‐3’ | |
| Fas | Forward: 5’‐TGCATGACAGCATCCAAGACA‐3’ |
| Reverse:5’‐GCACAGGAGCAGCTGGACTT‐3’ |
FIGURE 1Osteoporotic BMSC‐induced T‐cell migration and apoptosis were rescued by osthole. (A) Western blot of Fas and FasL protein accumulation in BMSCs. ImageJ was used to measure the relative protein abundance. (B, C) The mRNA levels of Fas and FasL were measured with real‐time PCR. (D) T cells were cocultured with S/BMSCs, O/BMSCs and O/BMSCs pre‐treated with osthole. A fluorescence microscope was used to quantify and observe T‐cell migration. Scale bar, 100 mm. (E) MCP‐1 levels in the culture medium of S/BMSCs, O/BMSCs and O/BMSCs pre‐treated with osthole were measured with ELISA. (F) Flow cytometry was used to analyse apoptotic T cells induced by S/BMSCs, O/BMSCs and O/BMSCs pre‐treated with osthole. NS, not significant; data presented as mean = ± SD. *P <.05 and **P <.01
FIGURE 2Treatment of inflammatory colitis with BMSCs. (A) Experimental design. Mice were fed drinking water containing DSS for 10 days. On the third day, 1 × 106 S/BMSCs, O/BMSC and O/BMSCs pre‐treated with osthole were injected into the mice through the tail vein. (B) The disease index was measured on the 10th day of DSS feeding. (C) Bodyweight was recorded every day for 10 days. (D) The mortality of the mice was recorded at 10 days. (E) The colon was collected 10 days later for each group, and the length was measured. (F) The histological structure of the colon was determined using H & E staining, and the histological score was graded. The bottom image is a higher magnification of the top image. Scale bar, 200 mm. (G) Ratio of apoptotic CD3 + T cells. (H, I, J, K) ELISA analysis of serum levels of inflammation markers TNF‐α, IFN‐γ, IL‐1β and IL‐6. NS, not significant; data displayed as means ± SD. N = 5 / group. *P <.05 and **P <.01
FIGURE 3Effects of systemic infusion of S/BMSCs, O/BMSCs or O/BMSCs pre‐treated with osthole in osteoporosis mice. (A) Research design for bone mass evaluation. Femur and tibia were harvested at the time of animal sacrifice. (B) Representative micro‐CT images of the total bone mass of the femur harvested on day 28 post‐operation. (C) BMD, BV/TV, Tb.N and Tb. Sp were analysed with micro‐CT (n = 5/group). (D, E) Flow cytometry analysis of apoptotic CD3 + T cells. (F, G, H, I) ELISA analysis of the serum levels of inflammation markers TNF‐α, IFN‐γ, IL‐1β and IL‐6. NS, not significant; data are shown as means ± SD. N = 5 / group. *P <.05, **P <.01 and ***P <.001. Not significant (P >.05)
FIGURE 4Osthole increased BMSC‐induced T‐cell migration and apoptosis. (A, B, C) Western blot was used to visualize the accumulation of Fas and FasL proteins in BMSCs. ImageJ software was used to measure the relative protein abundance. The grey value of each stain was normalized to the value of β‐actin. (D, E) Real‐time PCR was used to measure the mRNA levels of Fas and FasL. (F) T cells were cocultured with BMSCs pre‐treated with osthole. Under a fluorescence microscope, T‐cell migration was counted and quantified. Scale bar, 100 mm. (G) MCP‐1 level in BMSC culture medium was measured with ELISA. (H) Flow cytometry analysis of apoptotic T cells. NS, not significant; data are shown as means ± SD. *P <.05 and **P <.01
FIGURE 5Osthole improved BMSC‐mediated immunotherapy for osteoporosis. (A) Typical micro‐CT images of the total bone mass of the femur were obtained at 28 days after surgery. BMD (B) BV/TV (C) Tb.N (D) and Tb. Sp (E) were analysed with micro‐CT. (F) Ratio of apoptotic CD3 + T cells. ELISA analysis of the serum levels of inflammation markers TNF‐α, IFN‐γ, IL‐1β and IL‐6. (G, H, I, J). Data are shown as means ± SD. N = 5 / group.*P <.05, **P <.01 and ***P <.001. NS, not significant (P >.05)