Literature DB >> 33679094

Taxonomic Characterizations of Soil Streptomyces cavourensis DW102 and Its Activity against Fungal Pathogens.

Gouse Basha Sheik1, Aroob Abdullah Alhumaidy2, Ali Ismail Ali Abdel Raheim1, Zeyad Abdullah Alzeyadi1, Mohammed Ibrahim AlGhonaim3.   

Abstract

BACKGROUND: Streptomyces spp. are soil bacteria that have commercial value from which numerous secondary metabolites such as antifungal compounds have been derived. There is growing concern that antifungal resistance is on the rise, and soil Streptomyces from various geographical places might produce novel antifungal molecules. The aim of this study was to characterize and identify the actinomycetes strain namely Streptomyces isolate DW102, and to evaluate its antimicrobial activity against nosocomial fungal pathogens.
MATERIALS AND METHODS: Streptomyces isolate DW102 was identified based on morphological, cultural, physiological, and biochemical properties, together with 16S rRNA sequence. Its antifungal activity was determined by agar well-diffusion assays.
RESULTS: The isolate DW102 phenotypic and molecular characterization was identified as Streptomyces cavourensis DW102 and sequencing results were deposited in GenBank under accession number MK508855. Furthermore, the fermented broth of Streptomyces isolate DW102 inhibited the growth of Aspergillus niger and Candida albicans in vitro.
CONCLUSIONS: Phenotypic, molecular, and phylogenetic analysis of DW102 identified the strain to be S. cavourensis. The antifungal assay showed that DW102 fermentation broth was active against both C. albicans and A. niger in vitro. Further studies are required to use the Streptomyces isolate DW102 as a promising source for the development of antifungal drugs. Copyright:
© 2020 Journal of Pharmacy and Bioallied Sciences.

Entities:  

Keywords:  16s rRNA; Aspergillus niger; Candida albicans; Streptomyces cavourensis; antifungal

Year:  2020        PMID: 33679094      PMCID: PMC7909053          DOI: 10.4103/jpbs.JPBS_304_20

Source DB:  PubMed          Journal:  J Pharm Bioallied Sci        ISSN: 0975-7406


INTRODUCTION

During the past few decades, fungal infections among immunosuppressed and immunocompromised patients had increased, which are of major concern in the medical field.[12] At present, the clinical efficacy of some antifungal agents that are used to treat invasive fungal infections has plateaued because of emerging drug-resistant fungi, and there is a need to biosynthesize new antifungal compounds.[3] Among the opportunistic fungal infections, aspergillosis and candidiasis are the two most frequently occurring nosocomial infections.[24,5] The virulence of Aspergillus spp. depends on the host immune response. It produces certain mycotoxins that are known to be carcinogenic,[6] and it is correlated with a high mortality rate in intensive care units (ICUs).[78] Furthermore, candidiasis and candidemia are conditions of the overgrowth of Candida spp., which represent major problem for immunocompromised and elderly people.[5]Candida spp. are the third leading cause of infections in the ICU and cause more than 90% of fungal infections in hospitals.[9] Currently, amphotericin B and azole are the antifungal agents used as first-line drugs. However, a number of species belonging to Aspergillus and Candida show resistant to these drugs which require aggressive patient management and careful identification of species.[10] Actinomycetes are a group of bacteria, which are responsible for the production of various bioactive molecules, including antifungals.[111213] Among actinomycetes, the Streptomyces spp. are mostly soil bacteria which have commercial value from which numerous secondary metabolites have been derived.[14] Moreover, the species of Streptomyces and Micromonospora are responsible for the production of 80% of antimicrobials, which are of human pharmaceutical use,[1415] and many reports in the literature have shown that the extracellular metabolites obtained from Streptomyces spp. have antifungal properties.[161718] The objectives of this study were to characterize and identify the soil Streptomyces isolate DW102 based on morphological, cultural, physiological, and biochemical properties, together with 16S rRNA sequence, and to evaluate its antimicrobial activities against selected fungal pathogens.

MATERIALS AND METHODS

Microorganisms and culture conditions

The strain DW102 was isolated from a soil sample of Dawadmi region, Saudi Arabia, and deposited at the Culture Collection of The Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Dawadmi, Shaqra University, Saudi Arabia.[13] The isolate was maintained on slopes containing starch-casein agar medium of the following composition (g/L): Starch 20; Casein 0.3: KNO3 2; K2HPO4 2; MgSO4·7H2O 0.05; NaCl 2; CaCO3 0.02; FeSO4·7H2O 0.01; Agar 20; Distilled water 1L. Aspergillus niger and Candida albicans used for testing antifungal activity were obtained from the Culture Collection of The Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Dawadmi, Shaqra University, Saudi Arabia.

Preparations of fermented broth from Streptomyces isolate DW102

Fermentation was carried out by submerged culture using modified method,[19] in brief; a 7-day-old culture of Streptomyces isolate DW102 was inoculated in Erlenmeyer flask (500 mL) containing starch casein broth (SCB) and incubated in 30°C at 200rpm for 7 days. Then the culture broth was centrifuged at 3000rpm for 20 min and the supernatant was filtered through Whatmann No.1 (Whatman Ltd, Swavesey, UK) to remove unwanted debris. The filtered supernatant of the fermented broth was used for determining antifungal activity in well-diffusion assays.

Antifungal activity of crude extract

Determination of antifungal activity of Streptomyces isolate DW102 was done by agar well-diffusion method.[20]Aspergillus niger inoculum is prepared by suspending the colonies of A. niger grown on potato dextrose agar slant, by covering the slant with 1 mL of sterile distilled water supplemented with 0.1% Tween 20. Then the suspension was adjusted to 3 × 106 conidia/mL, using a hemocytometer. Then it was further diluted to obtain final working inoculums 3 × 105 conidia/mL. Candida albicans inoculum was prepared by suspending colonies of C. albicans in sterile distilled water. The suspension was adjusted at 0.5 McFarland turbidity standards. Then, the inoculum size was further adjusted to 2.5×105 CFU/mL. Finally, 50 µL of both the inoculums were inoculated on separate PDA plates. Wells were bored in the center of the plates with the insertion back of the 1000 µL micropipette tip and loaded with 100 μL of fermented broth to evaluate its antifungal activity. The plates containing A. niger were incubated at 28°C for 72 h and the plates containing C. albicans were incubated at 35°C for 48 h. Then they were observed for zone of inhibition.

Identification of isolate DW102

Phenotyping

The phenotypic characteristics of the isolate DW102 were done based on the standard procedure of Bergey’s Manual of Determinative Bacteriology.[21] Cultural characteristics of pure isolates of DW102 were studied in various media (SCA [starch casein agar], ISP2 [yeast malt extract agar], ISP3 [oatmeal agar], ISP4 [inorganic salt starch agar]) after incubation at 30°C for 7–14 days. Gram staining and acid fast staining was performed. Mycelium morphology and spore chain morphology of DW102 were observed under a light microscope. After preliminary studies, the isolates were identified by biochemical analysis, that is, catalase test, coagulation of milk, nitrate reduction, gelatin liquefaction, lecithin degradation, hydrolysis of starch, and casein. Carbohydrate fermentation tests such as D-glucose, fructose, galactose, L-arabinose, cellulose, maltose, xylose, inositol, sorbitol, trehalose, and rhamnose were studied.

Analysis of 16S rRNA sequence

Genomic deoxyribonucleic acid extraction

The Streptomyces strain DW102 was grown in 20 mL of SCB in a 100-mL conical flask at 37°C in a rotary shaker (200rpm) overnight. Aliquots of 1.5 mL of culture was transferred to Eppendorf tubes and centrifuged at 8,000rpm for 2 min. The supernatant was discarded and drained well onto a tissue paper and the pellet was re-suspended in 400 µL of TE buffer, then 32 µL of lysozyme (10 mg/mL) was added and the tube was incubated at 37°C for 30 min. Following incubation 100 µL of 0.5 M ethylenediaminetetraacetic acid (pH) 8 and 60 µL of 10% sodium dodecyl sulfate were added. To this, 1.5 µL of proteinase K (20 mg/mL) was added and the tube was incubated at 50°C (water bath) for 12 h. The tube was brought to room temperature and 250 µL of equilibrated phenol (equilibrated with Tris hydrochloride [Tris-HCl]) was add and mixed well. Then 250 µL of chloroform was added and the solution was centrifuged at 10,000rpm for 10 min and extracted twice with phenol-chloroform (1:1 ratio). The aqueous phase was extracted once again with chloroform: isoamyl alcohol (24:1 ratio), and the supernatant was collected and precipitated with 2 volume of absolute ethanol. The precipitate was centrifuged at 10,000rpm for 10 min and the supernatant was discarded. The pellet was air dried completely and washed with 70% ethanol and allowed it to dry at room temperature. After complete drying, the pellet was dissolved in 20–50 µL of sterile distilled water and stored at −20°C.

Polymerase chain reaction amplification of 16S rRNA

The 16S rRNA gene was amplified from genomic deoxyribonucleic acid (DNA) obtained from isolate DW102 using the thermal cycler Biorad T100 (Bio-Rad, Hercules, California) with universal forward primer-16S rRNA AGAGTTTGATCCTGGCTCAG and universal reverse primer-16S rRNA ATTACCGCGGCTGCTGG. The cyclic conditions were as follows: initial denaturation at 95°C for 2 min, 45 cycles of 95°C for 40s, 51°C for 30s, and 72°C for 1 min, and final extension of 7 min and hold at 4°C. The polymerase chain reaction (PCR) products were confirmed by 2% agarose gel electrophoresis[22] and purified using PureLink PCR Purification Kit (Invitrogen).

Sequencing of 16S rRNA genes

In this study, cycle sequencing (sequencing PCR) was done by using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with specific primers. After that, second purification made using BigDye XTerminator Purification Kit (Applied Biosystems), then sequencing by 3130 Genetic Analyzer (Applied Biosystems). The acquired DNA sequence was analyzed by using Sequencer software, version 4.9 (Gene Codes Corporation, Ann Arbor, Michigan), and SeqA6 (Sequencing Analysis Software, Applied Biosystems).

Phylogenetic analysis

Nucleotide sequences were compared to those in the GenBank database with the Basic Local Alignment Search Tool NCBI BLAST algorithm to identify known closely related sequences. Followed by multiple sequences alignment, which was generated for all matched sequences using MUSCLE tool,[23] Then, to determine the genetic relationship between Streptomyces cavourensis strains, a maximum-likelihood phylogenetic tree was created based on the probabilistic model[24] using MEGA 7 tool.[25]

RESULTS

Identification of Streptomyces isolate DW102

Microscopic observations and staining properties of isolate DW102 showed Gram-positive and nonacid fast filamentous branching bacteria, which is one of the important criteria for Streptomyces sp. under microscope. Mycelium’s were filamentous and branched; they have rectiflexible spore chain morphology. Maximum growth was obtained on SCA and ISP2 followed by ISP3 and ISP4 media. Cultural properties of the strain DW102 are shown in Table 1. Morphological and biochemical properties of the strain DW102 are shown in Table 2. Here, biochemical characteristics of the isolate DW102 were found to be positive for catalase test, hydrolysis of starch and casein, coagulation of milk, and nitrate reduction tests, whereas negative results were obtained for gelatin liquefaction and lecithin degradation. In our study, carbohydrate fermentation tests showed that isolate DW102 fermented D-glucose, fructose, galactose, L-arabinose, and cellulose. Our strain was able to ferment maltose and xylose moderately but negative for inositol, sorbitol, trehalose, and rhamnose. The results showed that DW102 was capable of fermenting sugar without producing gas. The Morphological and biochemical properties of isolate DW102 strongly suggested that the isolate belongs to Streptomyces sp.
Table 1

Cultural characteristics of Streptomyces cavourensis DW102 on different media

MediaAerial myceliumReverse side pigmentationSoluble pigmentsGrowth
SCAWhiteLight brownFaint brown+++
ISP2WhiteDark brownNIL+++
ISP3WhiteGrayNIL++
ISP4WhiteGrayNIL++
Table 2

Morphological and biochemical characteristics of Streptomyces cavourensis DW102

CharacteristicsResults
Gram stainGram-positive
Acid-fast stainNonacid fast
Nature of myceliumFilamentous, branched
Spore chain morphologyRectiflexible
Optimum temperature30°C
Optimum pH7
Catalase testPositive
Starch hydrolysisPositive
Casein hydrolysisPositive
Milk coagulationPositive
Nitrate reductionPositive
Gelatin liquefactionNegative
Lecithin degradationNegative
D-GlucosePositive
FructosePositive
GalactosePositive
MaltoseModerate
XyloseModerate
L-ArabinosePositive
CellulosePositive
InositolNegative
SorbitolNegative
TrehaloseNegative
RhamnoseNegative
Cultural characteristics of Streptomyces cavourensis DW102 on different media Morphological and biochemical characteristics of Streptomyces cavourensis DW102

Genotyping of isolate DW102

In our study, the molecular characteristic of Streptomyces strain DW102 was evaluated by PCR amplification of 16S rRNA gene. The 16S rRNA gene of Streptomyces strain DW102 was partially sequenced using universal forward primer- 16S rRNA AGAGTTTGATCCTGGCTCAG and universal reverse primer- 16S rRNA ATTACCGCGGCTGCTGG for genotypic identification of the organisms. The results of our study showed that the 16S rRNA sequencing analysis of the isolate yielded 493 base pairs with quality score (Qscore) = >50. The NCBI BLAST search analysis based on the topology of phylogenetic analysis using maximum-likelihood tree method showed that the sequence was related to several sequences of Streptomyces species. The sequence was closely related to NR112345.1 S. cavourensis strain NBRC 13026 with an identity of 100% [Figure 1].
Figure 1

Phylogenetic tree of MK508855 Streptomyces cavourensis DW102

Phylogenetic tree of MK508855 Streptomyces cavourensis DW102

Antifungal assay of Streptomyces isolate DW102

The results of agar well diffusion assays of this study has shown that the filtered supernatant of fermented broth of S. cavourensis DW102 showed good antifungal activity against A. niger and C. albicans. Filtered supernatant of fermented broth of S. cavourensis DW102 showed maximum zone of inhibitions (15 and 17 mm) against A. niger and C. albicans, respectively.

DISCUSSION

In this study, the strain DW102 which was isolated from a soil sample of Dawadmi region, Saudi Arabia was characterized and identified based on morphological, cultural, physiological, and biochemical properties, together with 16S rRNA sequence, and its antifungal activity was determined. Isolate DW102 showed Gram-positive and nonacid fast filamentous branching bacteria, which distinguish from other actinomycetales such as nocardia, actinomyces, and rhodococcus which are partially acid fast. In our study, the optimal culture temperature was 30°C, and the optimal media pH for Streptomyces strain DW102 was found to be 7 which both falls in the findings of previous work done by Sholkamy et al.[26] In our study various biochemical parameters and carbohydrate fermentation tests were used for identification of Streptomyces. Previous studies also considered Catalase test, starch hydrolysis, urea hydrolysis, nitrate reduction, gelatin hydrolyses characterizing Streptomyces.[2728] It is important to taxonomically place isolated actinomycetes based upon their genus and species levels. The 16S rRNA sequence analysis has become an important tool in bacterial identification, as it provides information about the phylogenetic placement of the species,[29] and it has been used by previous researchers for Streptomyces sp. identification.[26303132] In concordance with previous studies, phylogenetic 16s RNA helped to identify the isolate to the species level.[2831,32] In our study, the phylogenetic analysis results showed that the isolate occupies a distinct phylogenetic position within the radiation including the representatives of Streptomyces family. Hence, the morphological, cultural, biochemical, and 16S rRNA analysis of isolate DW102 strongly suggested that the isolate belongs to S. cavourensis. The gene sequence was deposited to the database of NCBI gene bank with accession number MK508855. Due to the global increase in fungal diseases especially in immunocompromised patients and the rapid development of antifungal drug resistance, finding new antifungal molecules has become a major challenge to the medical and pharmaceutical industry today.[1033] Our study has shown that the filtered supernatant of fermented broth of S. cavourensis DW102 has good antifungal activity against A. niger and C. albicans. Species of Streptomyces have been reported to produce antifungal activities against major pathogens such as C. albicans, Aspergillus spp., Fusarium spp., Penicillium spp., and Rhizophus spp.[1619,30] The inhibitory effect may be due to the activity of the secondary metabolites produced by the Streptomyces spp. on fungal hypha.[1618,1934] However, further assessment is needed to investigate the antifungal cytotoxicity, mode of action, and minimum inhibitory concentration. Also, DW102 growth optimization is needed to increase antifungal production and purification which will allow for further work on the compound.

CONCLUSION

Here we report that the Streptomyces isolate DW102 isolated from the soil sample of Dawadmi region was identified as S. cavourensis based on the morphological, cultural, biochemical, and 16S rRNA analysis. Moreover, BLAST search analysis showed that the sequence was closely related to NR112345.1 S. cavourensis strain NBRC 13026 with an identity of 100%. The strain was deposited to GenBank under the accession number MK508855. The DW102 antifungal assay showed that it was active against both C. albicans and A. niger in vitro. Further studies are required to use Streptomyces isolate DW102 as a promising source for the development of antifungal drugs.

Financial support and sponsorship

Deanship of Scientific Research at Shaqra University, Saudi Arabia (D180402/G01/N009).

Conflicts of interest

There are no conflicts of interest.
  23 in total

Review 1.  How many antibiotics are produced by the genus Streptomyces?

Authors:  M G Watve; R Tickoo; M M Jog; B D Bhole
Journal:  Arch Microbiol       Date:  2001-11       Impact factor: 2.552

2.  MUSCLE: multiple sequence alignment with high accuracy and high throughput.

Authors:  Robert C Edgar
Journal:  Nucleic Acids Res       Date:  2004-03-19       Impact factor: 16.971

Review 3.  The antifungal pipeline: a reality check.

Authors:  John R Perfect
Journal:  Nat Rev Drug Discov       Date:  2017-05-12       Impact factor: 84.694

4.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

5.  Isolation, characterization and antifungal activity of Streptomyces sampsonii GS 1322.

Authors:  Praveen Kumar Jain; P C Jain
Journal:  Indian J Exp Biol       Date:  2007-02       Impact factor: 0.818

6.  Evolutionary trees from DNA sequences: a maximum likelihood approach.

Authors:  J Felsenstein
Journal:  J Mol Evol       Date:  1981       Impact factor: 2.395

Review 7.  Invasive aspergillosis in the intensive care unit.

Authors:  George Dimopoulos; Frantezeska Frantzeskaki; Garyfallia Poulakou; Apostolos Armaganidis
Journal:  Ann N Y Acad Sci       Date:  2012-12       Impact factor: 5.691

8.  Secular trends in the epidemiology of nosocomial fungal infections in the United States, 1980-1990. National Nosocomial Infections Surveillance System.

Authors:  C Beck-Sagué; W R Jarvis
Journal:  J Infect Dis       Date:  1993-05       Impact factor: 5.226

9.  Emerging fungal infections in immunocompromised patients.

Authors:  Chian-Yong Low; Coleman Rotstein
Journal:  F1000 Med Rep       Date:  2011-07-01

10.  Anti-microbiological activities of bio-synthesized silver Nano-stars by Saccharopolyspora hirsuta.

Authors:  Essam N Sholkamy; Maged S Ahamd; Manal M Yasser; Noor Eslam
Journal:  Saudi J Biol Sci       Date:  2018-02-27       Impact factor: 4.219

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.