Hongwei Chen1, Yugang Chi2, Mengyue Chen1, Limei Zhao1. 1. Department of Gynaecology, The First People's Hospital of Chongqing Liangjiang New Area, Chongqing, 401120, People's Republic of China. 2. Department of Gynaecology and Obstetrics, Chongqing Health Center for Women and Children, Chongqing, 400021, People's Republic of China.
Abstract
PURPOSE: Long intergenic non-protein coding RNA 885 (LINC00885) has been well studied in breast cancer; however, its contribution in cervical cancer remains unclear. In this study, we aimed to determine the detailed functions of LINC00885 in cervical cancer and elucidate the underlying molecular regulation mechanism. METHODS: The expression status of LINC00885 in cervical cancer was determined using reverse transcription-quantitative polymerase chain reaction and by searching The Cancer Genome Atlas database. The detailed functions of LINC00885 in cervical cancer cells were confirmed using Cell Counting Kit 8 assay, flow cytometry analysis, Transwell cell migration and invasion assays, and tumor xenograft assay. Mechanistic experiments included bioinformatics prediction, RNA immunoprecipitation, luciferase reporter assay, and rescue experiments. RESULTS: LINC00885 was clearly overexpressed in cervical cancer, which was linked with unfavorable clinical outcomes. Functionally, LINC00885 deficiency suppressed cervical cancer cell proliferation, migration, and invasion but stimulated cell apoptosis in vitro. Furthermore, loss of LINC00885 restricted the growth of cervical cancer cells in vivo. Mechanistically, LINC00885 functioned as a competitive endogenous RNA for microRNA-432-5p (miR-432-5p) in cervical cancer. Furthermore, metastasis-associated colon cancer 1 (MACC1) was confirmed as the direct target of miR-432-5p, and LINC00885 could enhance MACC1 expression by sequestering miR-432-5p. Rescue experiments revealed that silencing of miR-432-5p or upregulation of MACC1 expression could effectively counteract the restrained aggressive properties of cervical cancer cells induced by LINC00885 deficiency. CONCLUSION: LINC00885 upregulated MACC1 expression in cervical cancer cells by sponging miR-432-5p, thereby promoting cancer progression. The LINC00885/miR-432-5p/MACC1 pathway may help in the identification of potential prognostic biomarkers and therapeutic targets in cervical cancer.
PURPOSE: Long intergenic non-protein coding RNA 885 (LINC00885) has been well studied in breast cancer; however, its contribution in cervical cancer remains unclear. In this study, we aimed to determine the detailed functions of LINC00885 in cervical cancer and elucidate the underlying molecular regulation mechanism. METHODS: The expression status of LINC00885 in cervical cancer was determined using reverse transcription-quantitative polymerase chain reaction and by searching The Cancer Genome Atlas database. The detailed functions of LINC00885 in cervical cancer cells were confirmed using Cell Counting Kit 8 assay, flow cytometry analysis, Transwell cell migration and invasion assays, and tumor xenograft assay. Mechanistic experiments included bioinformatics prediction, RNA immunoprecipitation, luciferase reporter assay, and rescue experiments. RESULTS: LINC00885 was clearly overexpressed in cervical cancer, which was linked with unfavorable clinical outcomes. Functionally, LINC00885 deficiency suppressed cervical cancer cell proliferation, migration, and invasion but stimulated cell apoptosis in vitro. Furthermore, loss of LINC00885 restricted the growth of cervical cancer cells in vivo. Mechanistically, LINC00885 functioned as a competitive endogenous RNA for microRNA-432-5p (miR-432-5p) in cervical cancer. Furthermore, metastasis-associated colon cancer 1 (MACC1) was confirmed as the direct target of miR-432-5p, and LINC00885 could enhance MACC1 expression by sequestering miR-432-5p. Rescue experiments revealed that silencing of miR-432-5p or upregulation of MACC1 expression could effectively counteract the restrained aggressive properties of cervical cancer cells induced by LINC00885 deficiency. CONCLUSION: LINC00885 upregulated MACC1 expression in cervical cancer cells by sponging miR-432-5p, thereby promoting cancer progression. The LINC00885/miR-432-5p/MACC1 pathway may help in the identification of potential prognostic biomarkers and therapeutic targets in cervical cancer.
Cervical cancer, a common gynecological malignant tumor, is the second leading cause of mortality among women globally.1 According to the Global Cancer Statistics 2018,2 approximately 569,847 novel cervical cancer cases were recorded worldwide, resulting in 311,365 deaths. Currently, effective therapeutic strategies include radical hysterectomy, pelvic lymphadenectomy, and chemoradiotherapy.3 Although significant advances in diagnostic and treatment methods over the past few decades have greatly enhanced the clinical efficacy, cervical cancer is still difficult to cure completely. The long-term survival of patients with cervical cancer remains low.4 Tumor recurrence and metastasis are considered the two critical factors restricting therapeutic efficacy and leading to poor prognosis of patients with cervical cancer.5 Moreover, delayed diagnosis also results in unsatisfactory clinical outcomes.6 In particular, a more comprehensive understanding of the molecular events underlying the pathogenesis of cervical cancer may be conducive for the development of compelling diagnostic and therapeutic techniques.Long non-coding RNAs (lncRNAs) are a category of RNA molecules with lengths of >200 bp.7 An increasing number of reports have revealed that lncRNAs are implicated in the control of various cellular homeostasis and physiological processes.8–10 In addition, they perform essential regulatory roles in nearly all aspects of cancer-associated malignant properties.11,12 Accumulating evidence has identified lncRNAs as functional regulators of cervical cancer oncogenesis and progression.13,14 Several lncRNAs are aberrantly expressed in cervical cancer and play critical roles in regulating the complex cellular behaviors by serving as tumor inhibitors or facilitators.15–17MicroRNAs (miRNAs or miRs) are short non-coding RNA transcripts that comprise 18–24 nucleotides.18 They post-transcriptionally modulate gene expression by binding to the 3′-untranslated region (UTR) of their target mRNAs, promoting mRNA degradation and/or inducing transcriptional restriction.19 The competing endogenous RNA (ceRNA) theory has been proposed as a novel classical method to regulate gene expression.20 The theory states that lncRNAs can serve as miRNA sponges and consequently abrogate the inhibitory regulatory effects of miRNAs on their target mRNAs.21 Thus, identifying novel cervical cancer-related lncRNAs and exploring their detailed functions and underlying mechanisms will be useful in the identification of potential targets for diagnosis, prevention, and therapy.Long intergenic non-protein coding RNA 885 (LINC00885) has been well researched in breast cancer.22 It is upregulated in breast cancer.22 Patients with breast cancer characterized by high LINC00885 expression have shorter overall survival than those with low LINC00885 expression.22 LINC00885 functions as a tumor promoter in breast cancer by facilitating cell proliferation, motility, and invasion, as well as colony formation. These results suggest LINC00885 may be developed as a potential prognostic biomarkers and/or therapeutic target for breast cancer. However, its involvement in cervical cancer remains unclear. In the present study, we aimed to figure out the detailed functions of LINC00885 in cervical cancer and elucidate the underlying molecular regulation mechanism.
Materials and Methods
Patients and Tissue Samples
Fifty-four pairs of cervical cancer tissues and matched adjacent normal tissues were collected at The First People’s Hospital of Chongqing Liangjiang New Area. Patients diagnosed with other types of cancer or receiving antitumor therapies before the operation were excluded. After tissue excision, all tissues were frozen immediately and stored in liquid nitrogen. This study was approved by the Ethics and Scientific Committee of The First People’s Hospital of Chongqing Liangjiang New Area (approval ID: ESC.FPCQLJNA.2015-0114) and performed in accordance with the principles of the Declaration of Helsinki. All patients provided written informed consent.
Cell Lines
Two cervical cancer cell lines, CaSki (ATCC® CRM-CRL-1550™) and C-33A (ATCC® HTB-31™), were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI-1640 medium and minimum essential medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin–streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The culture conditions used for another two cervical cancer cell lines, SiHa (ATCC® HTB-35) and HeLa (ATCC® CCL-2; American Type Culture Collection; ATCC, Manassas, VA, USA), were the same as those used for CaSki. Ect1/E6E7 (ATCC® CRL-2614; ATCC), a normal human cervical epithelial cell line, was cultured in keratinocyte serum-free medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 0.1 ng/mL human recombinant epidermal growth factor, 0.05 mg/mL bovine pituitary extract, and 0.4 mM calcium chloride. All cells were cultured in a humid atmosphere with 5% CO2 at 37°C.
Transfection Experiments
Small interference RNAs against LINC00885 (si-LINC00885) and negative control (NC) siRNA (si-NC) were designed and synthesized by GenePharma (Shanghai, China). Regarding MACC1 upregulation experiments, the full-length sequence of MACC1 was subcloned into pcDNA3.1 plasmid (Sangon Biotech Co., Ltd.; Shanghai, China) to obtain pcDNA3.1-MACC1 plasmid. miR-432-5p mimic, NC mimic, miR-432-5p inhibitor, and NC inhibitor were purchased from RiboBio Co., Ltd (Guangzhou, China). Cells were seeded into 24-well plates, and Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was added as a transfection agent.
Total RNA was extracted using TRIzol reagent (TaKaRa; Dalian, China). Reverse transcription was performed using a miScript Reverse Transcription kit (Qiagen GmbH, Hilden, Germany), and complementary DNA (cDNA) was obtained and subjected to quantitative PCR to detect miRNA expression via a miScript SYBR Green PCR kit (Qiagen). miRNA expression was normalized to that of U6 small nuclear RNA. The temperature protocols for reverse transcription were as follows: 37°C for 60 min, 95°C for 5 min and kept at 4°C. The thermocycling conditions for quantitative PCR were as follows: 95°C for 2 min, 95°C for 10 sec, 55°C for 30 sec and 72°C for 30 sec, for 40 cycles.To determine LINC00885 and MACC1 expression, total RNA was reverse transcribed into cDNA using a PrimeScript® RT reagent Kit (TaKaRa). Thereafter, SYBR® Premix Ex Taq™ II (TaKaRa) was used for qPCR. GAPDH was used as an internal reference for LINC00885 and MACC1. The temperature protocol for reverse transcription was as follows: 37°C for 15 min and 85°C for 5 second. The amplification was performed with cycling conditions as follows: 5 min at 95°C, followed by 40 cycles of 95°C for 30 sec and 65°C for 45 sec. All data were analyzed using the 2−∆∆Cq method. All reactions were performed on Applied Biosystems 7900 real‑time PCR system (Thermo Fisher Scientific, Inc.). The primers were shown in Table 1.
Table 1
Primers Sequences for RT-qPCR
Gene
Sequences (5ʹ→3ʹ)
LINC00885
Forward
GCAGAATGGATCTAATCTGATTCCT
Reverse
ATCATCTTTACGGAGGTAGAGAAGAG
MACC1
Forward
TTTAGACGACACAGCACATGCC
Reverse
TGGCGTTGACTTAACCAAGCC
GAPDH
Forward
AGTCAACGGATTTGGTCGTATTG
Reverse
AAACCATGTAGTTGAGGTCAATGAA
U6
Forward
CTCGCTTCGGCAGCACA
Reverse
AACGCTTCACGAATTTGCGT
hsa-miR-139-5p
Forward
TCGGCAGGUCUACAGUGCACGUG
Reverse
CACTCAACTGGTGTCGTGGA
hsa-miR-151b
Forward
TCGGCAGGUCGAGGAGCUCACAG
Reverse
CACTCAACTGGTGTCGTGGA
hsa-miR-218-5p
Forward
TCGGCAGGUUGUGCUUGAUCUA
Reverse
CACTCAACTGGTGTCGTGGA
hsa-miR-432-5p
Forward
TCGGCAGGUCUUGGAGUAGG
Reverse
CACTCAACTGGTGTCGTGGA
Primers Sequences for RT-qPCR
Cell Counting Kit 8 (CCK-8) Assay
Transfected cervical cancer cells were harvested and disaggregated into a single-cell suspension. A total of 100 μL of sample containing 2 × 103 cells was transferred into 96-well plates. After cultivation at 37°C with 5% CO2 for various periods (0, 24, 48, and 72 h), 10 μL of CCK-8 solution (Beyotime Institute of Biotechnology; Shanghai, China) was added to the samples, followed by another 2 h of cultivation at 37°C. The optical density at 450 nm was measured using a microplate spectrophotometer.
Flow Cytometry Analysis
Apoptosis of transfected cells was monitored using an Annexin V-FITC Apoptosis Detection Kit (Beyotime Biotechnology Ltd., Shanghai, China). In brief, transfected cells were collected following digestion with trypsin. After centrifugation at 1000 ×g for 5 min, the cells were resuspended in 195 μL of Annexin V-FITC binding buffer. The cells were then stained with 5 µL of Annexin V-FITC and 10 µL of propidium iodide at room temperature for 15 min without light. Finally, flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA) was used to detect early and late apoptotic cells.
Transwell Cell Migration and Invasion Assays
The 24-well Transwell® inserts (pore size, 8 μm; BD Biosciences) were used to assess the migration and invasion abilities of cells. The upper Transwell chambers coated with Matrigel (BD Biosciences) were used to detect invasion, whereas cell migration was detected without using Matrigel. Transfected cells were mixed with FBS-free basal medium to obtain single-cell suspensions. A 200-μL aliquot of cell suspension containing 1 × 105 cells was placed into the upper chambers, and the lower chambers were loaded with 600 μL of complete culture medium. After a 24-h incubation period, migrated and invaded cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Finally, five visual fields were chosen randomly to count cells under an inverted light microscope (Olympus Corporation, Tokyo, Japan).
Tumor Xenograft Assay
The animal experiments were approved by the Committee on the Use and Care of Animals of The First People’s Hospital of Chongqing Liangjiang New Area (approval ID: UCA.FPCQLJNA.2018-0915) and performed in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals. For stable knockdown of LINC00885, short hairpin RNA (shRNA) against LINC00885 (sh-LINC00885) and NC shRNA (sh-NC) was constructed by GenePharma, subcloned into the lentiviral vector, and transfected into 293T cells along with psAX2 and pMD2G vectors. After 2 days, the lentivirus supernatant was harvested and inoculated into SiHa cells. Finally, we incubated the cells with puromycin (Sigma-Aldrich; Merck KGaA) to select LINC00885 stable knockdown cells.Female BALB/c nude mice aged 4 weeks were purchased from Shanghai SLAC Laboratory Animal, co., Ltd. (Shanghai, China). SiHa cells stably overexpressing sh-LINC00885 or sh-NC were subcutaneously injected into the flank of nude mice. Tumor width and length were measured every 4 days. The following formula was employed for calculating tumor volume: 1/2 × length × width2. Mice were euthanized by cervical dislocation at 28 days after cell injection, and tumor xenografts were excised. Tumor weight was recorded.
RNA Immunoprecipitation (RIP) Assay
The EZ-Magna RIP RNA-binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) was used for RIP assay. In detail, cervical cancer cells were harvested and lysed using RIP buffer. The cell extracts were collected and incubated overnight at 4°C with magnetic bead-conjugated anti-Ago2 or anti-IgG antibodies (Millipore), and proteinase K was added to obtain the immunoprecipitation complex. The relative enrichment of LINC00885, miR-432-5p, and MACC1 in the purified immunoprecipitated RNA was detected using RT-qPCR.
Subcellular Fractionation Assay
Nuclear and cytoplasmic RNA fractions were isolated from cervical cancer cells using a Cytoplasmic & Nuclear RNA Purification kit (Norgen, Belmont, CA). Cytoplasmic and nuclear RNA was extracted and analyzed using RT-qPCR to assess relative LINC00885 distribution in cervical cancer cells. GAPDH and U6 were used as cytoplasmic and nuclear controls, respectively.
Bioinformatics Prediction and Luciferase Reporter Assay
The putative miRNAs that may be adsorbed by LINC00885 were predicted using ENCORI (). ENCORI, TargetScan (), and miRDB () were used to predict the direct target of miR-432-5p.The fragments of LINC00885 and MACC1 3′-UTR containing the miR-432-5p-binding sequences were amplified by GenePharma and inserted into pmirGLO luciferase vector (Promega Corporation, Madison, WI, USA). The obtained luciferase reporter vectors were designated as LINC00885-wild-type (wt) and MACC1-wt, respectively. A QuikChange XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) was used to obtain mutant (mut) LINC00885 and MACC1 fragments, which were also inserted into pmirGLO luciferase vector to obtain luciferase reporter vectors LINC00885-mut and MACC1-mut. The wt or mut reporter vectors in parallel with miR-432-5p mimic or NC mimic were transfected into cervical cancer cells. Luciferase activity was determined using the Dual-luciferase Reporter Assay Kit (Promega Corporation).
Western Blotting
Total protein from cultured cells was extracted using RIPA lysis buffer (Beyotime) and quantified using the BCA Protein Assay Kit (Beyotime). Protein lysates were separated using 10% SDS-PAGE and transferred onto PVDF membranes. After blocking with 5% slim milk at room temperature for 2 h, the membranes were probed overnight at 4°C with primary antibodies, including anti-MACC1 (ab226803; Abcam, Cambridge, MA, USA) and anti-GAPDH (ab128915; Abcam), and then incubated with corresponding HRP-labeled secondary antibodies (ab205718; Abcam) at room temperature for 2 h. Protein signals were visualized using Immobilon® ECL Ultra Western HRP Substrate (Millipore) and FluorChem E System (ProteinSimple, San Jose, California).
Statistical Analysis
All statistical evaluation was performed using SPSS software version 19.0 (SPSS, Chicago, IL, USA). Pearson’s correlation analysis was used for correlation analysis. Differences between two groups were compared using Student’s t-test. One-way analysis of variance followed by Tukey’s test was used to assess differences among multiple groups. All experiments were performed with three independent biological replicates. All results were expressed as mean ± standard error, and P < 0.05 was considered statistically significant.
Results
Low Expression of LINC00885 Limits the Malignant Phenotype of Cervical Cancer Cells
On searching The Cancer Genome Atlas (TCGA) database, we found that LINC00885 was significantly upregulated in cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) tissues relative to that in normal tissues (Figure 1A). To confirm it, LINC00885 expression was determined in 54 pairs of cervical cancer tissues and matched adjacent normal tissues using RT-qPCR. The expression level of LINC00885 was considerably higher in cervical cancer tissues than in adjacent normal tissues (Figure 1B). Consistently, all four cervical cancer cell lines (CaSki, C-33A, SiHa, and HeLa) showed LINC00885 overexpression compared with that in a normal human cervical epithelial cell line, Ect1/E6E7 (Figure 1C). Furthermore, a Kaplan–Meier curve indicated that the increased expression level of LINC00885 was closely associated with poorer overall survival of patients with cervical cancer (Figure 1D).
Figure 1
Downregulation of LINC00885 expression restricts the malignant properties of cervical cancer cells. (A) LINC00885 expression in cervical squamous cell carcinoma and endocervical adenocarcinoma (CSES) was analyzed by searching its expression status in The Cancer Genome Atlas database. (B) RT-qPCR was performed to determine LINC00885 expression in 54 pairs of cervical cancer tissues and matched adjacent normal tissues. (C) LINC00885 expression in cervical cancer cell lines and the normal human cervical epithelial cell line Ect1/E6E7 was determined using RT-qPCR. (D) The overall survival of patients with cervical cancer with upregulated or downregulated LINC00885 expression was analyzed using Kaplan–Meier analysis. (E) The silencing efficiency of si-LINC00885 in CaSki and SiHa cells was confirmed using RT-qPCR. (F) CCK-8 assay was performed to examine CaSki and SiHa cell proliferation after LINC00885 depletion. (G) Flow cytometry analysis was performed to detect apoptosis of LINC00885-depleted CaSki and SiHa cells. (H and I) The migration and invasion abilities of CaSki and SiHa cells after si-LINC00885 or si-NC transfection were assessed using Transwell cell migration and invasion assays, respectively. **P < 0.01.
Downregulation of LINC00885 expression restricts the malignant properties of cervical cancer cells. (A) LINC00885 expression in cervical squamous cell carcinoma and endocervical adenocarcinoma (CSES) was analyzed by searching its expression status in The Cancer Genome Atlas database. (B) RT-qPCR was performed to determine LINC00885 expression in 54 pairs of cervical cancer tissues and matched adjacent normal tissues. (C) LINC00885 expression in cervical cancer cell lines and the normal human cervical epithelial cell line Ect1/E6E7 was determined using RT-qPCR. (D) The overall survival of patients with cervical cancer with upregulated or downregulated LINC00885 expression was analyzed using Kaplan–Meier analysis. (E) The silencing efficiency of si-LINC00885 in CaSki and SiHa cells was confirmed using RT-qPCR. (F) CCK-8 assay was performed to examine CaSki and SiHa cell proliferation after LINC00885 depletion. (G) Flow cytometry analysis was performed to detect apoptosis of LINC00885-depleted CaSki and SiHa cells. (H and I) The migration and invasion abilities of CaSki and SiHa cells after si-LINC00885 or si-NC transfection were assessed using Transwell cell migration and invasion assays, respectively. **P < 0.01.Considering the relatively higher LINC00885 expression in CaSki and SiHa cells, these two cell lines were used in the subsequent experiments. To explore the regulatory functions of LINC00885, siRNAs targeting LINC00885 were transfected into cervical cancer cells to downregulate its expression. First, RT-qPCR was performed to evaluate transfection efficiency. Of the siRNAs, si-LINC00885#1 and si-LINC00885#2 showed the highest inhibition efficiency (Figure 1E); thus, these two siRNAs were used in the loss-of-function assays. The CCK-8 assay showed that downregulation of LINC00885 expression led to decreased proliferation of CaSki and SiHa cells (Figure 1F). Then, using flow cytometry analysis, low expression of LINC00885 was shown to facilitate CaSki and SiHa cell apoptosis (Figure 1G). Furthermore, the migration (Figure 1H) and invasion (Figure 1I) abilities of CaSki and SiHa cells were weakened after LINC00885 silencing. These results show that LINC00885 is a promoter of the malignant characteristics of cervical cancer.
LINC00885 Directly Interacts with miR-432-5p and Serves as a Sponge for miR-432-5p
To determine the subcellular distribution of LINC00885, nuclear and cytoplasmic fractions were separated, followed by RT-qPCR. The results confirmed that LINC00885 was primarily located in the cytoplasm of CaSki and SiHa cells (Figure 2A). Accordingly, LINC00885 may function as a molecular sponge for miRNAs and regulate gene expression at the posttranslational level. Bioinformatics prediction was performed to identify the target miRNAs of LINC00885. A total of 44 miRNAs were found to have complementary binding sites within the LINC00885 sequence. For further investigation, the expressions of these candidate miRNAs in cervical cancer were assessed using TCGA database. As displayed in Figure 2B, the expressions of four miRNAs were downregulated and that of five miRNAs were upregulated in cervical cancer, whereas the expressions of other miRNAs were unchanged. Hence, the four weakly expressed miRNAs, ie, miR-139-5p, miR-151b, miR-218-5p, and miR-432-5p, were selected for further verification.
Figure 2
LINC00885 functions as a sponge for miR-432-5p in cervical cancer. (A) Subcellular fractionation assay showed the localization of LINC00885 in CaSki and SiHa cells. (B) The miRNAs targeting LINC00885 were predicted using ENCORI. (C) RT-qPCR was performed to determine the expression levels of miR-139-5p, miR-151b, miR-218-5p, and miR-432-5p in CaSki and SiHa cells after LINC00885 depletion. (D) The expression levels of miR-432-5p in 54 pairs of cervical cancer tissues and matched adjacent normal tissues were determined using RT-qPCR. (E) The correlation between LINC00885 and miR-432-5p expression in the 54 pairs of cervical cancer tissues was evaluated using Pearson’s correlation analysis. (F) The predicted wild-type and mutant binding sites between LINC00885 and miR-432-5p are shown. (G) Wild-type or mutant luciferase reporter vectors were cotransfected into SiHa cells along with miR-432-5p mimic or NC mimic. Luciferase activity was detected at 48 h after transfection using dual-luciferase reporter assay. (H) RIP assay was performed using anti-Ago2 or anti-IgG antibodies; the relative enrichment of LINC00885 and miR-432-5p in immunoprecipitated RNA was determined using RT-qPCR. **P < 0.01.
LINC00885 functions as a sponge for miR-432-5p in cervical cancer. (A) Subcellular fractionation assay showed the localization of LINC00885 in CaSki and SiHa cells. (B) The miRNAs targeting LINC00885 were predicted using ENCORI. (C) RT-qPCR was performed to determine the expression levels of miR-139-5p, miR-151b, miR-218-5p, and miR-432-5p in CaSki and SiHa cells after LINC00885 depletion. (D) The expression levels of miR-432-5p in 54 pairs of cervical cancer tissues and matched adjacent normal tissues were determined using RT-qPCR. (E) The correlation between LINC00885 and miR-432-5p expression in the 54 pairs of cervical cancer tissues was evaluated using Pearson’s correlation analysis. (F) The predicted wild-type and mutant binding sites between LINC00885 and miR-432-5p are shown. (G) Wild-type or mutant luciferase reporter vectors were cotransfected into SiHa cells along with miR-432-5p mimic or NC mimic. Luciferase activity was detected at 48 h after transfection using dual-luciferase reporter assay. (H) RIP assay was performed using anti-Ago2 or anti-IgG antibodies; the relative enrichment of LINC00885 and miR-432-5p in immunoprecipitated RNA was determined using RT-qPCR. **P < 0.01.Next, RT-qPCR was performed to determine whether the expression levels of these four miRNAs were altered in cervical cancer cells after LINC00885 depletion. miR-432-5p expression was prominently upregulated in si-LINC00885-transfected CaSki and SiHa cells, whereas no noticeable difference was identified in the levels of the other three miRNAs (Figure 2C). As revealed by RT-qPCR analysis, miR-432-5p expression was downregulated in cervical cancer tissues (Figure 2D), which was inversely correlated with LINC00885 expression (Figure 2E). Figure 2F presents the wt and mut binding sites between miR-432-5p and LINC00885. Next, luciferase reporter assay was performed to demonstrate the actual interaction between miR-432-5p and LINC00885 in cervical cancer cells. The results indicated that the luciferase activity of LINC00885-wt was decreased following miR-432-5p mimic cotransfection in CaSki and SiHa cells, whereas the inhibitory actions were neutralized after the binding site was mutated (Figure 2G). Finally, RIP assay results confirmed that the anti-Ago2 antibody could specifically enrich both LINC00885 and miR-432-5p in CaSki and SiHa cells (Figure 2H). Collectively, these results suggest that LINC00885 functions as a ceRNA to sponge miR-432-5p in cervical cancer.
MACC1 is a Direct Target of miR-432-5p in Cervical Cancer
miR-432-5p mimic was transfected into CaSki and SiHa cells to overexpress miR-432-5p. RT-qPCR analysis confirmed the overexpression efficiency (Figure 3A). Upregulation of miR-432-5p expression hindered CaSki and SiHa cell proliferation (Figure 3B) and promoted cell apoptosis (Figure 3C). The suppression of cell migration (Figure 3D) and invasion (Figure 3E) following miR-432-5p upregulation in CaSki and SiHa cells was shown by Transwell cell migration and invasion assays, respectively.
Figure 3
MACC1 is a direct target of miR-432-5p in cervical cancer cells. (A) RT-qPCR analysis verified the overexpression efficiency of miR-432-5p mimic in CaSki and SiHa cells. (B and C) CCK-8 assay and flow cytometry analysis were conducted to assess cell proliferation and apoptosis, respectively, in CaSki and SiHa cells following miR-432-5p upregulation. (D and E) Transwell cell migration and invasion assays were performed to examine the cell migration and invasion abilities of miR-432-5p mimic-transfected CaSki and SiHa cells. (F) The predicted miR-432-5p binding sites within the MACC1 3′-UTR and the mutated sequence of 3′-UTR of MACC1 were revealed. (G) Luciferase reporter assay was performed to determine the luciferase activity of MACC1-wt or MACC1-mut in CaSki and SiHa cells after cotransfection of miR-432-5p mimic or NC mimic. (H and I) The mRNA and protein expression levels of MACC1 were measured after transfecting miR-432-5p mimic or NC mimic, respectively, using RT-qPCR and Western blotting analysis. (J) RT-qPCR was performed to quantify MACC1 mRNA expression levels in 54 pairs of cervical cancer tissues and matched adjacent normal tissues. (K) Pearson’s correlation analysis was used to assess the correlation between miR-432-5p and MACC1 expression in 54 pairs of cervical cancer tissues. **P < 0.01.
MACC1 is a direct target of miR-432-5p in cervical cancer cells. (A) RT-qPCR analysis verified the overexpression efficiency of miR-432-5p mimic in CaSki and SiHa cells. (B and C) CCK-8 assay and flow cytometry analysis were conducted to assess cell proliferation and apoptosis, respectively, in CaSki and SiHa cells following miR-432-5p upregulation. (D and E) Transwell cell migration and invasion assays were performed to examine the cell migration and invasion abilities of miR-432-5p mimic-transfected CaSki and SiHa cells. (F) The predicted miR-432-5p binding sites within the MACC1 3′-UTR and the mutated sequence of 3′-UTR of MACC1 were revealed. (G) Luciferase reporter assay was performed to determine the luciferase activity of MACC1-wt or MACC1-mut in CaSki and SiHa cells after cotransfection of miR-432-5p mimic or NC mimic. (H and I) The mRNA and protein expression levels of MACC1 were measured after transfecting miR-432-5p mimic or NC mimic, respectively, using RT-qPCR and Western blotting analysis. (J) RT-qPCR was performed to quantify MACC1 mRNA expression levels in 54 pairs of cervical cancer tissues and matched adjacent normal tissues. (K) Pearson’s correlation analysis was used to assess the correlation between miR-432-5p and MACC1 expression in 54 pairs of cervical cancer tissues. **P < 0.01.Bioinformatics analysis was conducted to identify the target gene of miR-432-5p. A previous study reported that MACC1 was a direct target of miR-432-5p in osteosarcoma.23 More importantly, MACC1 is overexpressed in cervical cancer and plays an oncogenic role during cancer progression.24–26 Thus, the direct interaction between miR-432-5p and MACC1 3′-UTR (Figure 3F) in cervical cancer cells was verified using the luciferase reporter assay. The results showed that miR-432-5p overexpression exerted an inhibitory effect on the luciferase activity of MACC1-wt in CaSki and SiHa cells. However, the decreased luciferase activity of MACC1-wt caused by miR-432-5p mimic could be recovered when the binding site was mutated (Figure 3G). In addition, it was observed that miR-432-5p upregulation significantly downregulated MACC1 mRNA (Figure 3H) and protein (Figure 3I) expression levels in CaSki and SiHa cells. RT-qPCR revealed that MACC1 was significantly overexpressed in cervical cancer tissues compared with that in adjacent normal tissues (Figure 3J). More importantly, MACC1 expression was inversely correlated to miR-432-5p expression in the 54 cervical cancer tissues (Figure 3K). The results of the above experiments proved that miR-432-5p was an anti-oncogenic miRNA and directly targeted MACC1 in cervical cancer.
LINC00885 Regulates MACC1 Expression in Cervical Cancer Cells by Decoying miR-432-5p
To further determine the ceRNA mechanism of LINC00885 in cervical cancer, the regulatory effects of LINC00885 on MACC1 expression were examined. LINC00885 depletion led to decreased MACC1 expression in CaSki and SiHa cells at both mRNA (Figure 4A) and protein (Figure 4B) levels. Furthermore, the regulatory effects of LINC00885 knockdown on MACC1 expression were counteracted by miR-432-5p inhibitor cotransfection (Figure 4C and D). Pearson correlation analysis proved that LINC00885 and MACC1 were positively correlated in cervical cancer tissues (Figure 4E). In addition, RIP assay revealed that LINC00885, miR-432-5p, and MACC1 were overexpressed in the immunoprecipitated products (Figure 4F), implying that the three molecules coexist in the same RNA-induced silencing complex. In summary, LINC00885 positively regulated MACC1 expression in cervical cancer by sequestering miR-432-5p.
Figure 4
LINC00885 regulates MACC1 expression in cervical cancer cells by decoying miR-432-5p. (A and B) MACC1 mRNA and protein expression levels were examined using RT-PCR and Western blotting analysis, respectively, in CaSki and SiHa cells following LINC00885 knockdown. (C and D) CaSki and SiHa cells were transfected with si-LINC00885 along with miR-432-5p inhibitor or NC inhibitor, followed by the measurement of MACC1 mRNA and protein expression levels. (E) Pearson’s correlation analysis confirmed a positive correlation between LINC00885 and MACC1 expression in the 54 cervical cancer tissues. (F) The relative enrichment of LINC00885, miR-432-5p, and MACC1 in immunoprecipitated RNA was detected using RT-qPCR. **P < 0.01.
LINC00885 regulates MACC1 expression in cervical cancer cells by decoying miR-432-5p. (A and B) MACC1 mRNA and protein expression levels were examined using RT-PCR and Western blotting analysis, respectively, in CaSki and SiHa cells following LINC00885 knockdown. (C and D) CaSki and SiHa cells were transfected with si-LINC00885 along with miR-432-5p inhibitor or NC inhibitor, followed by the measurement of MACC1 mRNA and protein expression levels. (E) Pearson’s correlation analysis confirmed a positive correlation between LINC00885 and MACC1 expression in the 54 cervical cancer tissues. (F) The relative enrichment of LINC00885, miR-432-5p, and MACC1 in immunoprecipitated RNA was detected using RT-qPCR. **P < 0.01.
The miR-432-5p/MACC1 Axis is Critical for the Tumor-Promoting Roles of LINC00885 in Cervical Cancer
As LINC00885 was shown to promote the progression of cervical cancer, a series of rescue experiments were performed to determine whether the miR-432-5p/MACC1 axis mediated the pro-oncogenic activities of LINC00885. RT-qPCR was used to analyze the inhibition efficiency of miR-432-5p inhibitor (Figure 5A). CaSki and SiHa cell proliferation was hindered by LINC00885 silencing, whereas this tendency was rescued by miR-432-5p inhibitor cotransfection (Figure 5B). Flow cytometry analysis demonstrated that miR-432-5p downregulation could counteract the si-LINC00885-mediated promotive effect on CaSki and SiHa cell apoptosis (Figure 5C). The migration and invasion (Figure 5D) abilities impaired by LINC00885 deficiency were reversed by miR-432-5p inhibition.
Figure 5
Inhibition of miR-432-5p abolished the anti-oncogenic effects of si-LINC00885 in cervical cancer cells. (A) RT-qPCR was performed to determine miR-432-5p expression in CaSki and SiHa cells after transfection with miR-432-5p inhibitor or NC inhibitor. (B and C) CCK-8 assay and flow cytometry analysis were performed to detect CaSki and SiHa cell proliferation and apoptosis, respectively, after the cells were cotransfected with si-LINC00885 and miR-432-5p inhibitor or NC inhibitor. (D) The migration and invasion abilities of the aforementioned cells were examined using Transwell migration and invasion assays, respectively. *P < 0.05 and **P < 0.01.
Inhibition of miR-432-5p abolished the anti-oncogenic effects of si-LINC00885 in cervical cancer cells. (A) RT-qPCR was performed to determine miR-432-5p expression in CaSki and SiHa cells after transfection with miR-432-5p inhibitor or NC inhibitor. (B and C) CCK-8 assay and flow cytometry analysis were performed to detect CaSki and SiHa cell proliferation and apoptosis, respectively, after the cells were cotransfected with si-LINC00885 and miR-432-5p inhibitor or NC inhibitor. (D) The migration and invasion abilities of the aforementioned cells were examined using Transwell migration and invasion assays, respectively. *P < 0.05 and **P < 0.01.The pcDNA3.1-MACC1 plasmid was used in rescue experiments, and its overexpression efficiency was verified via Western blotting (Figure 6A). As expected, MACC1 overexpression counteracted the effects of LINC00885 deficiency on CaSki and SiHa cell proliferation (Figure 6B) and apoptosis (Figure 6C). Similarly, restoration of MACC1 expression abolished the anti-migration and anti-invasion (Figure 6D) effects of si-LINC00885 in CaSki and SiHa cells. Thus, the LINC00885/miR-432-5p/MACC1 axis has cancer-promoting roles in cervical cancer.
Figure 6
MACC1 overexpression counteracts the effects of LINC00885 knockdown on cervical cancer cells. (A) The overexpression efficiency of pcDNA3.1-MACC1 plasmid in CaSki and SiHa cells was confirmed by Western blotting. (B–D) LINC00885-silenced CaSki and SiHa cells were transfected with pcDNA3.1-MACC1 or pcDNA3.1 plasmid. Cell proliferation, apoptosis, migration, and invasion were investigated using CCK-8 assay, flow cytometry analysis, Transwell migration assay, and Transwell invasion assay, respectively. **P < 0.01.
MACC1 overexpression counteracts the effects of LINC00885 knockdown on cervical cancer cells. (A) The overexpression efficiency of pcDNA3.1-MACC1 plasmid in CaSki and SiHa cells was confirmed by Western blotting. (B–D) LINC00885-silenced CaSki and SiHa cells were transfected with pcDNA3.1-MACC1 or pcDNA3.1 plasmid. Cell proliferation, apoptosis, migration, and invasion were investigated using CCK-8 assay, flow cytometry analysis, Transwell migration assay, and Transwell invasion assay, respectively. **P < 0.01.
LINC00885 Deficiency Inhibits Growth of Cervical Cancer in vivo
After identifying the important functions of LINC00885 in cervical cancer tumorigenesis in vivo, the tumor xenograft assay was used to explore the role of LINC00885 in tumor growth in vivo. Reduced tumor volume (Figure 7A) and weight (Figure 7B) were observed in sh-LINC00885-transfected tumor xenografts. Furthermore, the growth rate of tumor xenografts was slower in the sh-LINC00885 group than in the sh-NC group (Figure 7C). Moreover, sh-LINC00885-transfected tumor xenografts showed downregulated LINC00885 expression (Figure 7D) and increased miR-432-5p expression (Figure 7E). Western blotting analysis confirmed that LINC00885 deficiency led to downregulated MACC1 protein expression (Figure 7F). Collectively, LINC00885 deficiency inhibited the growth of cervical cancer in vivo.
Figure 7
LINC00885 downregulation inhibits tumor growth in vivo. (A) Tumor xenografts derived from mice in sh-LINC00885 and sh-NC groups are shown. (B) At the end of the in vivo experiment, mice were euthanized and tumor xenografts were excised and weighted. (C) Tumor volume was monitored after SiHa cells overexpressing sh-LINC00885 or sh-NC were injected subcutaneously into nude mice. The data were used to plot the growth curve. (D and E) LINC00885 and miR-432-5p expressions in tumor xenografts derived from sh-LINC00885 and sh-NC groups were determined using RT-qPCR. (F) Western blotting was used to determine MACC1 protein expression in tumor xenografts. **P < 0.01.
LINC00885 downregulation inhibits tumor growth in vivo. (A) Tumor xenografts derived from mice in sh-LINC00885 and sh-NC groups are shown. (B) At the end of the in vivo experiment, mice were euthanized and tumor xenografts were excised and weighted. (C) Tumor volume was monitored after SiHa cells overexpressing sh-LINC00885 or sh-NC were injected subcutaneously into nude mice. The data were used to plot the growth curve. (D and E) LINC00885 and miR-432-5p expressions in tumor xenografts derived from sh-LINC00885 and sh-NC groups were determined using RT-qPCR. (F) Western blotting was used to determine MACC1 protein expression in tumor xenografts. **P < 0.01.
Discussion
Recently, lncRNAs have attracted the attention of more and more researchers.8,27,28 An increasing number of studies have reported that lncRNAs are dysregulated and are essential regulators and tumor facilitators in cervical cancer.29 Hence, identifying the lncRNAs involved in cervical cancer and exploring their detailed roles will be beneficial for developing effective targets to guide cancer diagnosis, prevention, and treatment. Thus far, although few lncRNAs have been studied comprehensively, many lncRNAs are unknown and are worth exploring. Herein, we attempted to investigate the specific regulatory functions of LINC00885 in cervical cancer. Our results proved that a novel oncogenic lncRNA, LINC00885, plays a role in cervical cancer.LINC00885 has been well studied in breast cancer.22 However, information regarding its expression status and regulatory functions in cervical cancer remains undefined. In this study, LINC00885 expression was shown to be considerably increased in cervical cancer based on TCGA data and our sample cohort. Clinically, LINC00885 overexpression was closely associated with unfavorable prognosis in patients with cervical cancer. Functional experiments corroborated that LINC00885 deficiency hindered cervical cancer cell proliferation, migration, and invasion but stimulated apoptosis in vitro. Furthermore, interference of LINC00885 expression restricted the growth of cervical cancer cells in vivo. All these observations suggest that LINC00885 may be an effective target for cervical cancer diagnosis, prognosis and therapy.The mechanisms underlying the oncogenic role of LINC00885 in cervical cancer are unknown and warrant further study. The ceRNA theory is a crucial concept that states that lncRNAs harbor miRNA-response elements and serve as miRNA sponges to upregulate the expression of downstream mRNAs, provided that lncRNA is primarily distributed in the cytoplasm.30,31 Herein, a subcellular fractionation assay was used to examine the localization of LINC00885 in cervical cancer cells. Encouragingly, the data indicated that LINC00885 was a cytoplasmic lncRNA in cervical cancer cells, which provided evidence for the ceRNA theory. Accordingly, we assume that LINC00885 contributes to cervical cancer malignancy through the ceRNA mechanism.Next, a series of mechanistic experiments affirmed our hypothesis. First, bioinformatics analysis indicated that miR-432-5p might bind to LINC00885. Further experiments showed that LINC00885 could directly interact with miR-432-5p as a molecular sponge in cervical cancer cells. Furthermore, MACC1 was confirmed to be a downstream target of miR-432-5p. MACC1 expression was positively regulated by LINC00885, which occurred through sequestering miR-432-5p. RIP assay results showed that LINC00885, miR-432-5p, and MACC1 coexisted in the same RNA-induced silencing complex. These results demonstrated the existence of the LINC00885/miR-432-5p/MACC1 ceRNA pathway in cervical cancer.miR-432-5p is a well-documented miRNA that is differentially expressed in multiple human cancer types.32–34 It is weakly expressed in cervical cancer, which is linked with adverse clinical features.35 miR-432-5p lowers the cell proliferative, migratory, and invasive abilities, thereby contributing to tumorigenesis.35 In agreement, our study verified the anti-oncogenic roles of miR-432-5p in cervical cancer. Exploration of the downstream target of miR-432-5p is required for understanding its roles in cervical cancer, and identifying new therapeutic target for the management of patients with this disease. Combined bioinformatics analysis and mechanistic experiments showed that miR-432-5p directly targeted MACC1 and negatively regulated its expression in cervical cancer cells. Our study further revealed the association of the tumor-promoting functions of LINC00885 with the miR-432-5p/MACC1 axis in cervical cancer. Rescue experiments confirmed that silencing of miR-432-5p or upregulation of MACC1 expression effectively counteracted the restrained aggressive properties of cervical cancer cells caused by LINC00885 deficiency, suggesting that the LINC00885/miR-432-5p/MACC1 ceRNA pathway plays a role in cervical cancer.
Conclusion
Overall, our research revealed that LINC00885 expression was upregulated in cervical cancer and was associated with unfavorable clinical outcomes. LINC00885 promoted the oncogenicity of cervical cancer by affecting many malignant characteristics. Our mechanistic experiments revealed for the first time that LINC00885 functions as a ceRNA to sponge miR-432-5p, thereby enhancing expression of its downstream protein MACC1. The LINC00885/miR-432-5p/MACC1 pathway plays an indispensable role in the oncogenicity of cervical cancer, which may offer a novel insight into the pathogenesis of cervical cancer and support the development of potential prognostic biomarkers and therapeutic targets.
Authors: Eduardo Gil Perez-Bacho; Fredy Omar Beltrán-Anaya; Elena Arechaga-Ocampo; Daniel Hernández-Sotelo; Olga Lilia Garibay-Cerdenares; Berenice Illades-Aguiar; Luz Del Carmen Alarcón-Romero; Oscar Del Moral-Hernández Journal: Viruses Date: 2022-05-05 Impact factor: 5.818