Literature DB >> 33602271

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

Yi Zheng1,2, Youyun Zhao3,4, Yefu Wang5, Jun Rao6,7.   

Abstract

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.
METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.
RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.
CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Entities:  

Keywords:  Blood transfusion; Human herpesvirus; Multiplex real-time PCR; Pityriasis rosea

Year:  2021        PMID: 33602271      PMCID: PMC7891017          DOI: 10.1186/s12985-021-01510-6

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


  19 in total

1.  Individuals with inherited chromosomally integrated human herpes virus 6 (ciHHV-6) have functionally active HHV-6 specific T-cell immunity.

Authors:  V Strenger; S Kayser; K-E Witte; D Lassner; W Schwinger; G Jahn; C Urban; T Feuchtinger
Journal:  Clin Microbiol Infect       Date:  2015-10-23       Impact factor: 8.067

Review 2.  Interindividual Spread of Herpesviruses.

Authors:  Keith W Jarosinski
Journal:  Adv Anat Embryol Cell Biol       Date:  2017       Impact factor: 1.231

Review 3.  How Host Specific Are Herpesviruses? Lessons from Herpesviruses Infecting Wild and Endangered Mammals.

Authors:  Walid Azab; Anisha Dayaram; Alex D Greenwood; Nikolaus Osterrieder
Journal:  Annu Rev Virol       Date:  2018-07-27       Impact factor: 10.431

4.  Up close with herpesviruses.

Authors:  Ekaterina E Heldwein
Journal:  Science       Date:  2018-04-06       Impact factor: 47.728

5.  Summary of the 10th International Conference on Human Herpesviruses-6 and -7 (HHV-6A, -6B, and HHV-7).

Authors:  Anthony L Komaroff; Michael Boeckh; Eva Eliason; Tuan Phan; Benedikt B Kaufer
Journal:  J Med Virol       Date:  2018-01-04       Impact factor: 2.327

6.  Additional evidence that pityriasis rosea is associated with reactivation of human herpesvirus-6 and -7.

Authors:  Francesco Broccolo; Francesco Drago; Anna M Careddu; Chiara Foglieni; Laura Turbino; Clementina E Cocuzza; Carlo Gelmetti; Paolo Lusso; Alfredo E Rebora; Mauro S Malnati
Journal:  J Invest Dermatol       Date:  2005-06       Impact factor: 8.551

Review 7.  The revision of the European blood directives: A major challenge for transfusion medicine.

Authors:  G Folléa; K Aranko
Journal:  Transfus Clin Biol       Date:  2015-06-06       Impact factor: 1.406

8.  Transmission of human herpesvirus 8 by blood transfusion.

Authors:  Wolfgang Hladik; Sheila C Dollard; Jonathan Mermin; Ashley L Fowlkes; Robert Downing; Minal M Amin; Flora Banage; Esau Nzaro; Peter Kataaha; Timothy J Dondero; Philip E Pellett; Eve M Lackritz
Journal:  N Engl J Med       Date:  2006-09-28       Impact factor: 91.245

9.  Human herpesvirus 6 and human herpesvirus 7 infections in renal transplant recipients and healthy adults in Turkey.

Authors:  S Yalcin; T Karpuzoglu; G Suleymanlar; G Mutlu; T Mukai; T Yamamoto; Y Isegawa; K Yamanishi
Journal:  Arch Virol       Date:  1994       Impact factor: 2.574

10.  Human Herpesvirus 8 in Perinatally HIV-infected Children with Interstitial Lung Disease.

Authors:  Marcelo Comerlato Scotta; Alexandre Todorovic Fabro; Paula Renata Lima Machado; Simone Gusmão Ramos; Maria Célia Cervi; Benedito Antônio Lopes da Fonseca; Fabrizio Motta; Bento Vidal de Moura Negrini
Journal:  J Trop Pediatr       Date:  2018-10-01       Impact factor: 1.165

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.