Yi Zheng1,2, Youyun Zhao3,4, Yefu Wang5, Jun Rao6,7. 1. Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China. 2. Hubei Academy of Traditional Medicine, Wuhan, 430074, Hubei, China. 3. Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China. zhaoyy206@163.com. 4. Hubei Academy of Traditional Medicine, Wuhan, 430074, Hubei, China. zhaoyy206@163.com. 5. The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430072, Hubei, China. 6. Department of Clinical Laboratory, Hubei Provincial Hospital of Traditional Chinese Medicine, Wuhan, 430061, Hubei, China. RaoJun090922@163.com. 7. Hubei Academy of Traditional Medicine, Wuhan, 430074, Hubei, China. RaoJun090922@163.com.
Abstract
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis roseapatients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis roseapatients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Entities:
Keywords:
Blood transfusion; Human herpesvirus; Multiplex real-time PCR; Pityriasis rosea
Authors: V Strenger; S Kayser; K-E Witte; D Lassner; W Schwinger; G Jahn; C Urban; T Feuchtinger Journal: Clin Microbiol Infect Date: 2015-10-23 Impact factor: 8.067
Authors: Francesco Broccolo; Francesco Drago; Anna M Careddu; Chiara Foglieni; Laura Turbino; Clementina E Cocuzza; Carlo Gelmetti; Paolo Lusso; Alfredo E Rebora; Mauro S Malnati Journal: J Invest Dermatol Date: 2005-06 Impact factor: 8.551
Authors: Wolfgang Hladik; Sheila C Dollard; Jonathan Mermin; Ashley L Fowlkes; Robert Downing; Minal M Amin; Flora Banage; Esau Nzaro; Peter Kataaha; Timothy J Dondero; Philip E Pellett; Eve M Lackritz Journal: N Engl J Med Date: 2006-09-28 Impact factor: 91.245
Authors: S Yalcin; T Karpuzoglu; G Suleymanlar; G Mutlu; T Mukai; T Yamamoto; Y Isegawa; K Yamanishi Journal: Arch Virol Date: 1994 Impact factor: 2.574