Literature DB >> 33564244

In vitro Combined Inhibitory Activities of β-Lactam Antibiotics and Clavulanic Acid Against bla KPC-2-Positive Klebsiella pneumoniae.

Mingjia Peng1,2, Renru Han1,2, Yan Guo1,2, Yonggui Zheng1,2, Feifei Yang1,2, Xiaogang Xu1,2, Fupin Hu1,2.   

Abstract

BACKGROUND: The spread of KPC-producing Enterobacteriaceae has triggered a global public health concern, with KPC-2-positive strains being the most prevalent in China. We hereby studied the in vitro combined inhibitory activities of three kinds of β-lactam antibiotics and clavulanic acid at different concentrations against bla KPC-2-positive Klebsiella pneumoniae to explore the antimicrobial characteristics of these combinations and alternative therapeutic regimens for infections caused by bla KPC-2-positive K. pneumoniae strains.
MATERIALS AND METHODS: In this study, 153 clinically isolated bla KPC-2-positive K. pneumoniae strains from 19 provinces in China were collected from 2016 to 2018. Antimicrobial susceptibility testing of imipenem/clavulanic acid, meropenem/clavulanic acid, ceftazidime/clavulanic acid, and each antimicrobial agent alone was performed by broth microdilution technique according to the CLSI guidelines. The concentration ratios of β-lactam antibiotics to clavulanic acid were as follows: 1:1, 1:2, 1:4, 1:8, 1:16, 1:32. The antimicrobial susceptibility of the combinations was determined according to the breakpoints of Imipenem, meropenem, and ceftazidime established by the CLSI directives for Enterobacteriaceae.
RESULTS: The MICs of all three combinations gradually declined with increments in the proportion of clavulanic acid in the regimens, and the most significant decline in the MIC50 and MIC90 was seen in combinations at the concentration ratio of 1:1 (also 1:2 for meropenem/clavulanic acid). When the concentration of clavulanic acid was restricted to 4 mg/L, the susceptibility of more than 70% of the isolates to the regimens could be restored with imipenem MIC 2-4 mg/L, meropenem MIC 2-8 mg/L or ceftazidime MIC 8mg/L. However, the percentage decreased to 30 to 40% when the initial MIC level was higher.
CONCLUSION: The highest combined inhibitory activity of β-lactam antibiotics/clavulanic acid at low concentration ratios against bla KPC-2-positive K. pneumoniae may offer a new way to optimize the effects of these antimicrobial regimens.
© 2021 Peng et al.

Entities:  

Keywords:  Enterobacteriaceae; KPC; clavulanic acid; combined inhibitory activity; β-lactam antibiotic

Year:  2021        PMID: 33564244      PMCID: PMC7866911          DOI: 10.2147/IDR.S292612

Source DB:  PubMed          Journal:  Infect Drug Resist        ISSN: 1178-6973            Impact factor:   4.003


Background

Being a widely-spread class A carbapenemase, KPC has been found in a number of bacterial genera (Especially Enterobacteriaceae)1–3 across many countries and regions since it was first reported in the United States of America back in 1996.4,5 In China, after the first KPC-2-producing Klebsiella pneumoniae strain was reported in 2004,6 an increasing number of KPC-positive K. pneumoniae have been identified in eastern provinces such as Beijing, Shanghai, and Jiangsu,7–10 with KPC-2 producing strains being the most prevalent.5 The extensive spread of KPC-positive bacteria was attributed to its location on plasmids and its preference for K. pneumoniae since K. pneumoniae tends to accumulate and transfer resistance determinants.11–13 KPC is notorious for its broad substrate spectrum, including penicillins, cephalosporins, carbapenems, and aztreonam.12 Although blaKPC-2-positive strains are susceptible to tigecycline and colistin in most cases, the administration of these two drugs is sometimes restricted due to safety concerns, Minimal Inhibitory Concentrations (MICs) increase during administration and high price, which is quite the ordeal for clinicians. In order to come up with optimum therapeutic regimens for blaKPC-2-positive Enterobacteriaceae, numerous research on dual β-lactam antibiotics and combinations containing tigecycline or colistin have been carried out and successfully confirmed the lower mortality rate and higher efficiency of combination regimens compared with monotherapy.14–20 Besides, β-lactam-antibiotic-based combinations were also found to have similar efficacy profiles to tigecycline-based therapies against KPC-producing Klebsiella pneumoniae with a lower mortality rate and cost, which confirms the importance and necessity of performing more research on β-lactam-antibiotic-based antimicrobial regimens.20,21 Previous research on the in vitro combined inhibitory activities of β-lactam antibiotics and clavulanic acid at different concentrations or ratios against Enterobacteriaceae isolates have revealed some dose-related inhibitory effects of clavulanic acid, but the limited testing concentrations and strain differences made the results both unclear and incomplete.22,23 In this study, we widened the testing concentration and ratio of β-lactam antibiotics/clavulanic acid to achieve more comprehensive information on the dose-related effects of β-lactam antibiotics/clavulanic acid against blaKPC-2-positive Enterobacteriaceae.

Materials and Methods

Strains

All 153 Enterobacteriaceae K. pneumoniae strains were collected from 23 hospitals in 19 Chinese provinces from 2016 to 2018. The specimen sources of the isolates were as follows: sputum 70, blood 29, urine 16, abdominal fluid 6, bile 6, cerebrospinal fluid 5, and other specimen sources 21.

Gene Identification

All strains were confirmed to be blaKPC-2-positive by polymerase chain reaction (PCR) and DNA sequencing. Other common β-Lactamases genes were also detected by PCR, including blaNDM, blaIMP, blaOXA, blaVIM, blaCTX-M Group1, blaCTX-M Group2, blaCTX-M Group9, blaFOX, blaMOX, blaCMY, blaDHA, and blaACC using primers targeting different β-Lactamases gene groups (Table 1).
Table 1

Primers Used for Amplification

Target(s)PrimersSequence (5ʹ to 3ʹ)Amplified Product (bp)Reference
NDMNDM-FGGTTTGGCGATCTGGTTTTC62136
NDM-RCGGAATGGCTCATCACGATC
VIMVIM-FGATGGTGTTTGGTCGCATA390
VIM-RCGAATGCGCAGCACCAG
OXAOXA-FGCGTGGTTAAGGATGAACAC438
OXA-RCATCAAGTTCAACCCAACCG
IMPIMP-FGGAATAGAGTGGCTTAAY*TCTC232
IMP-RGGTTTAAY*AAAACAACCACC
KPCKPC-FCGTCTAGTTCTGCTGTCTTG798
KPC-RCTTGTCATCCTTGTTAGGCG
CTX-M Group1CTXM1-FGAATTAGAGCGGCAGTCGGG58837
CTXM1-RCACAACCCAGGAAGCAGGC
CTX-M Group2CTXM2-FGATGGCGACGCTACCCC107
CTXM2-RCAAGCCGACCTCCCGAAC
CTX-M Group9CTXM9-FGTGCAACGGATGATGTTCGC475
CTXM9-RGAAACGTCTCATCGCCGATC
MOX-1,MOX-2,CMY-1,CMY-8 to CMY-11MOXM-FGCTGCTCAAGGAGCACAGGAT52038
MOXM-RCACATTGACATAGGTGTGGTGC
DHA-1,DHA-2DHAM-FAACTTTCACAGGTGTGCTGGGT405
DHAM-RCCGTACGCATACTGGCTTTGC
ACCACCM-FAACAGCCTCAGCAGCCGGTTA346
ACCM-RTTCGCCGCAATCATCCCTAGC
FOX-1 to FOX-5bFOXM-FAACATGGGGTATCAGGGAGATG190
FOXM-RCAAAGCGCGTAACCGGATTGG

Note: *Y = C or T.

Primers Used for Amplification Note: *Y = C or T.

Antimicrobial Susceptibility Testing

MICs were determined by broth microdilution following the 2019 CLSI guidelines. The in vitro combined inhibitory activities of imipenem/clavulanic acid, meropenem/clavulanic acid, and ceftazidime/clavulanic acid were determined. The inhibitory activities of imipenem, meropenem, ceftazidime, and clavulanic acid were also tested. The ratios of β-lactam antibiotics to clavulanic acid were set as follows: 1:1, 1:2, 1:4, 1:8, 1:16, 1:32. The doubling dilutions of the concentrations of each β-lactam antibiotic (Alone or in combination with clavulanic acid) ranged from 0.06 to 128mg/L; the testing concentration of clavulanic acid in each combination can be calculated using the combination ratio. The concentrations of clavulanic acid ranged from 0.5 to 1024mg/L. The breakpoints of imipenem, meropenem, and ceftazidime established by the CLSI for Enterobacteriaceae were used to evaluate the combinations’ antibacterial activities: Imipenem, ≤1/≥4mg/L; meropenem, ≤1/≥4mg/L; and ceftazidime, ≤4/≥16mg/L. E. coli ATCC 25,922 and ATCC 35,218 were used for quality control.

Results

As expected, the MICs showed that most isolates were resistant to imipenem (MICs ranging from 2 to >128mg/L), meropenem (2 to >128mg/L), and ceftazidime (8 to >128mg/L). Nonetheless, 3 isolates were exclusively susceptible to imipenem, 3 to meropenem and 1 to ceftazidime, with 3 isolates susceptible to both imipenem and meropenem, and 1 isolate susceptible to all the three β-lactam antibiotics tested. For all three combinations (Imipenem/clavulanic acid, meropenem/clavulanic acid, and ceftazidime/clavulanic acid), the MICs elicited a gradual decline with increments in the proportion of clavulanic acid in the regimens (Table 2). The biggest decline in MIC50 and MIC90 was depicted in combinations at low ratios. The MIC50 of the imipenem/clavulanic acid regimen halved from 32 to 16 mg/L at the ratio of 1:1 compared to imipenem alone. Similarly, meropenem/clavulanic acid at the ratio 1:1 halved the MIC50 from 128 to 64mg/L compared to meropenem alone, and ceftazidime/clavulanic acid combination reduced the MIC50 from >128 to 32mg/L compared to ceftazidime alone. The MIC90 demonstrated the same trend; the MIC90 halved from 64 to 32mg/L with imipenem/clavulanic acid at the ratio of 1:1 compared to imipenem alone; meropenem/clavulanic acid at the ratio of 1:1 reduced the MIC90 from >128 to 128mg/L compared to meropenem alone, and ceftazidime/clavulanic acid administration reduced the MIC50 from >128 to 64mg/L compared to ceftazidime alone. Nevertheless, when the ratio was raised to 1:2, meropenem/clavulanic acid became the only combination whose MIC50 and MIC90 halved again; meanwhile the MIC50 and MIC90 of imipenem/clavulanic acid and ceftazidime/clavulanic acid remained unchanged. The data presented in Table 2 reveals the decline in the inhibitory activities of all three combinations with increments in the ratio of β-lactam antibiotics to clavulanic acid.
Table 2

The MIC Characteristics, Susceptibility and Resistance Rates of the KPC-Producing Enterobacteriaceae Strains Tested

Drug or CombinationRatioCriteriaMIC Variations(mg/L)MIC50(mg/L)MIC90(mg/L)Susceptibility Rate (%)Resistance Rate (%)
Imipenem/≤1mg/L, susceptible;≥4mg/L, resistant0.125->12832642.097.4
Imipenem-clavulanic acid1:10.125->12816325.981.0
1:20.125->12816325.977.8
1:40.125->1288169.875.2
1:80.125–12881617.671.9
1:160.125–6481622.971.2
1:320.125–324827.566.0
Meropenem/≤1mg/L, susceptible;≥4mg/L, resistant≤0.06->128128>1282.097.4
Meropenem-clavulanic acid1:1≤0.06->128641287.881.7
1:2≤0.06->128326411.881.0
1:4≤0.06–128326414.478.4
1:8≤0.06–128163216.375.8
1:16≤0.06–128163219.673.2
1:32≤0.06–12881624.270.6
Ceftazidime/≤4mg/L, susceptible;≥16mg/L, resistant4->128>128>1280.797.4
Ceftazidime-clavulanic acid1:10.5->12832647.285.0
1:20.5->12832649.277.8
1:40.5->128326415.071.2
1:80.25–128163224.868.6
1:160.25–6481628.846.4
1:320.25–3281642.515.0

Note: Data of intermediate isolates was not shown in this table.

The MIC Characteristics, Susceptibility and Resistance Rates of the KPC-Producing Enterobacteriaceae Strains Tested Note: Data of intermediate isolates was not shown in this table. When the concentration of clavulanic acid was restricted to 4mg/L, the susceptibility of some strains to β-lactam antibiotics with low β-lactam antibiotic MIC levels was restored (Table 3). Imipenem/clavulanic reduced the MIC of all five isolates from imipenem MICs of 2 mg/L and 4 mg/L to no more than 1 mg/L, but the rate sharply dipped to 8/24 when the imipenem MIC value rose to 8mg/L. Meropenem/clavulanic and ceftazidime/clavulanic acid delineated similar efficacy. Meropenem/clavulanic acid reduced the MIC of ten out of the thirteen isolates from meropenem MICs of 2 mg/L, 4 mg/L, and 8 mg/L to 1 mg/L or less, and was effective for approximately 40% (9/21) of the strains with meropenem MIC of 16mg/L. Ceftazidime/clavulanic acid only revealed high efficacy to isolates with ceftazidime MIC of 8mg/L, with the MIC of all three strains reduced to no more than 4 mg/L, and limited efficacy (5/15) to strains with ceftazidime MICs of 16 mg/L.
Table 3

The β-Lactam Antibiotic MIC Values and β-Lactamase Genes of Part of the Isolates Tested (Clavulanic Acid ≤4mg/L)

CombinationMIC of β-Lactam Antibiotic(mg/L)Efficacy*Isolates Regaining SusceptibilityIsolates Failing to Regain Susceptibility
blaKPC-2 OnlyblaKPC-2 Along with Other Genes**blaKPC-2 OnlyblaKPC-2 Along with Other Genes
Imipenem/clavulanic acid21/18588
44/4
88/24
Meropenem/clavulanic acid20/111896
43/3
87/9
169/21
Ceftazidime/clavulanic acid83/33573
165/15
Total/19/39118119

Notes: *Efficacy=the number of the isolates regaining susceptibility/the total number of the isolates with β-lactam antibiotic MIC value shown in the second column. **the gene combinations include the following: blaKPC-2+blaCTX-M-Group1, blaKPC-2+blaCTX-M-Group1+ blaCTX-M-Group9, blaKPC-2+blaCTX-M-Group1+blaDHA, blaKPC-2+ blaCTX-M-Group9, blaKPC-2+ blaDHA, blaKPC-2+ blaDHA+ blaCTX-M-Group9, blaKPC-2+ blaDHA+ blaNDM.

The β-Lactam Antibiotic MIC Values and β-Lactamase Genes of Part of the Isolates Tested (Clavulanic Acid ≤4mg/L) Notes: *Efficacy=the number of the isolates regaining susceptibility/the total number of the isolates with β-lactam antibiotic MIC value shown in the second column. **the gene combinations include the following: blaKPC-2+blaCTX-M-Group1, blaKPC-2+blaCTX-M-Group1+ blaCTX-M-Group9, blaKPC-2+blaCTX-M-Group1+blaDHA, blaKPC-2+ blaCTX-M-Group9, blaKPC-2+ blaDHA, blaKPC-2+ blaDHA+ blaCTX-M-Group9, blaKPC-2+ blaDHA+ blaNDM. Moreover, PCR confirmed the existence of other β-lactamase genes in the isolates (Table 3). For meropenem/clavulanic acid, eight isolates regaining susceptibility contained more than one β-lactamase genes, while eleven isolates contained only blaKPC-2; meanwhile, six isolates failing to regain susceptibility contained at least two β-lactamase genes, while nine isolates contained only blaKPC-2. Imipenem/clavulanic acid displayed a similar trend. However, ceftazidime/clavulanic acid illustrated different characteristics than the other two groups; more isolates regaining susceptibility to ceftazidime/clavulanic acid carried two or more β-lactamase genes. For all three combinations, eleven out of twenty two isolates containing only blaKPC-2 with low MICs regained susceptibility to the combinations, while eight out of seventeen isolates carrying two or more β-lactamase genes regained susceptibility to the combinations.

Discussion

The spread of carbapenemase-producing K.pneumoniae has aroused worldwide concerns. Researchers have carried out numerous studies to identify alternative therapeutic regimens since colistin and/or tigecycline-resistant strains have been reported and will probably become more popular with the frequent prescription of these antibiotics.24–26 KPC-2 has become the most prevalent class A carbapenemase amongst blaKPC-positive Enterobacteriaceae, which makes finding optimal therapeutic regimens against blaKPC-2-carriers more crucial than ever. As a member of class A carbapenemases, KPCs are inhibited by clavulanic acid and tazobactam.13 Some research on the in vitro combined inhibitory activity of β-lactam antibiotics combined with clavulanic acid at different concentrations or ratios against K.pneumoniae and Escherichia coli isolates have revealed some dose-related inhibitory effects of clavulanic acid. The 1:1 ratio was proven to be more effective than the 3:1 ratio against blaTEM-positive Escherichia coli when imipenem was combined with clavulanic acid.22 Another research also reported that a ten-fold increase in the concentration of clavulanic acid can raise the efficacy of β-lactam antibiotics/clavulanic acid combinations against K.pneumoniae and E.coli.23 Therefore, in order to obtain more comprehensive information on the dose-related effects of β-lactam antibiotics/clavulanic acid regimens, we chose to widen the testing concentration range. Furthermore, the concentration of the clavulanic acid when combined with β-lactam antibiotics was set at a maximum of 4mg/L in most in vitro antimicrobial susceptibility tests, which is close to the mean peak serum concentration when administrated at 125 mg to healthy volunteers according to the literature.27,28 We also evaluated the efficacy of all three combinations when clavulanic acid concentration was less than 4 mg/L as a reference for β-lactam-antibiotic-containing therapy against blaKPC-2-positive Enterobacteriaceae. The dose-dependent antimicrobial effect of all combinations tested was obvious from the gradually declining MIC50 and MIC90 with increments in combination ratios (Higher clavulanic acid proportions). As a classical β-lactamase inhibitor, clavulanic acid strongly binds β-lactamases and turns inactive in the process to protect β-lactam antibiotics from being hydrolyzed, which can perfectly rationalize the dose-dependent phenomenon. Notwithstanding, the biggest and steepest decline in the MIC50 and MIC90 was observed at the ratio of 1:1 in all three combinations; in meropenem/clavulanic acid the ratio of 1:2 was equally efficient. This finding implied the following: 1) There was a slight difference in terms of the most efficient ratio of β-lactam antibiotics/clavulanic acid for different β-lactam antibiotics. 2) There may be a new insight to optimize the therapeutic effects of β-lactamase/clavulanic acid. The β-lactamase/clavulanic acid in wide use now contains limited proportions of clavulanic acid and a small rise in its dose could be both sensible and helpful. Despite the fact that some case reports have indicated the higher incidence of drug-induced hepatitis, pancreatitis, and other gastrointestinal adverse effects caused by amoxicillin/clavulanic acid compared to amoxicillin monotherapy,29–31 information on the toxicity profile of clavulanic acid monotherapy or with other β-lactam antibiotics is still vacant. Studies on healthy volunteers have shown that the serum concentration of clavulanic acid is maintained above 3 mg/L for around one hour and above 2 mg/L for approximately two hours after oral ingestion of 125 mg clavulanic acid.27,28 Another one-week study on ICU patients showed that the serum concentration of clavulanic acid can be kept above 10 mg/L when administrated at a high dose with amoxicillin.32 Highly variable pharmacokinetics of clavulanic acid were reported in some research articles.33,34 Further studies on the combined inhibitory activities, pharmacokinetics, and safety of β-lactam antibiotics/clavulanic acid are essential to determine the optimal combination of β-lactam antibiotics/clavulanic acid and the best combination ratio for treatment of infections. Some research articles recommend that clinicians should take the MIC levels of carbapenems into consideration when developing treatment plans. A study in Greece found that for patients with carbapenemase-producing K. pneumoniae bloodstream infections, the mortality rate was only 19.3% when carbapenems MICs ≤8mg/L, which is much lower than the mortality rate of 35.5% when carbapenems MICs >8mg/L, if treated by carbapenem-containing combinations.20 A review including 63 studies in four continents (most studies were in the United States and Europe) suggested that for patients infected with KPC-producing Klebsiella pneumoniae with meropenem MICs lower than 16mg/L, carbapenem-containing regimens can be administrated in high-dosed, prolonged infusions under therapeutic drug monitoring (TDM), whereas the usage of carbapenems should be avoided for strains with meropenem MICs higher than 16mg/L.35 In this study, we collected 153 clinical isolates from 19 Chinese provinces and discovered that when the concentration of clavulanic acid was restricted to 4 mg/L, the susceptibility of more than 70% of the isolates with imipenem MICs ranging from 2 to 4 mg/L, meropenem MIC levels of 2–8 mg/L or ceftazidime MIC levels of 8 mg/L can be restored; Contrastingly, the percentage plummeted to 30–40% when the β-lactam MIC level of the isolates continued to increase. This suggests that more studies on β-lactam-antibiotic-containing treatment regimens against blaKPC-carrying Enterobacteriaceae should be conducted to determine if administration of combination regimens is applicable to strains with lower initial β-lactam antibiotic MICs in China compared to other regions. The results of antimicrobial susceptibility testing corroborated the escalating additive inhibitory effects of the three combinations of β-lactam antibiotics/clavulanic acid evaluated in this study, produced by increments in the proportion of clavulanic acid in the regimens. With all ratios included, ceftazidime/clavulanic acid impressively got the most significant efficacy against both K. pneumoniae and non-K. pneumoniae. A study reported a similar phenomenon stating that the MIC of cefotaxime reduced more obviously than that of imipenem when combined with the same concentration of inhibitors against KPC-2-producing Enterobacteriaceae, which was explained by the lower kcat/Km ratio of cefotaxime than imipenem according to the KPC-2 kinetic parameters.17 The kcat/Km ratio is used to evaluate the catalytic efficacy of enzymes for substrates. Furthermore, the kcat/Km ratio of ceftazidime was proven to be lower than those of both imipenem and meropenem for KPC-2.12 However, this cannot perfectly explain the results obtained in our study, because imipenem holds the highest kcat/Km ratio whereas the MICs of meropenem reduced least. Further studies need to be carried out to find more about the catalytic efficacy of KPC for β-lactam antibiotics under the protection of inhibitors. The same number of isolates carrying only blaKPC-2 succeeded or failed in restoring susceptibility to the combination regimens when the concentration of clavulanic acid was 4 mg/L or less. A similar phenomenon was observed in isolates carrying two or more β-lactamase genes. More types of β-lactamase genes and isolates should be tested to confirm whether the inhibitory activities of the combination regimens are independent of the β-lactamase genes for isolates with low β-lactam MICs. In conclusion, the most prominent efficacy of β-lactam antibiotic/clavulanic acid at low ratios towards blaKPC-2-positive Enterobacteriaceae may offer a new insight to optimize the effect of β-lactam antibiotics/clavulanic acid combination regimens. Additionally, clinicians in China should consider the possibility that β-lactam-antibiotic-containing treatment regimens against blaKPC-2-positive Enterobacteriaceae infections are feasible for strains with lower β-lactam MICs in China compared to other regions.
  37 in total

1.  Experimental application of the median-effect principle for in vitro quantification of the combined inhibitory activities of clavulanic acid and imipenem against IRT-4 beta-lactamase.

Authors:  Albert Sotto; Vincent Foulongne; Danielle Sirot; Roger Labia; Jacques Jourdan
Journal:  Int J Antimicrob Agents       Date:  2002-01       Impact factor: 5.283

2.  Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR.

Authors:  F Javier Pérez-Pérez; Nancy D Hanson
Journal:  J Clin Microbiol       Date:  2002-06       Impact factor: 5.948

Review 3.  Carbapenemase-producing Klebsiella pneumoniae: (when) might we still consider treating with carbapenems?

Authors:  G L Daikos; A Markogiannakis
Journal:  Clin Microbiol Infect       Date:  2011-06-02       Impact factor: 8.067

4.  Plasmid-mediated KPC-2 in a Klebsiella pneumoniae isolate from China.

Authors:  Ze-Qing Wei; Xiao-Xing Du; Yun-Song Yu; Ping Shen; Ya-Gang Chen; Lan-Juan Li
Journal:  Antimicrob Agents Chemother       Date:  2006-12-04       Impact factor: 5.191

5.  Synergistic activity and effectiveness of a double-carbapenem regimen in pandrug-resistant Klebsiella pneumoniae bloodstream infections.

Authors:  Alessandra Oliva; Alessandra D'Abramo; Claudia D'Agostino; Marco Iannetta; Maria T Mascellino; Carmela Gallinelli; Claudio M Mastroianni; Vincenzo Vullo
Journal:  J Antimicrob Chemother       Date:  2014-02-11       Impact factor: 5.790

Review 6.  The management of multidrug-resistant Enterobacteriaceae.

Authors:  Matteo Bassetti; Maddalena Peghin; Davide Pecori
Journal:  Curr Opin Infect Dis       Date:  2016-12       Impact factor: 4.915

Review 7.  Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases.

Authors:  L Silvia Munoz-Price; Laurent Poirel; Robert A Bonomo; Mitchell J Schwaber; George L Daikos; Martin Cormican; Giuseppe Cornaglia; Javier Garau; Marek Gniadkowski; Mary K Hayden; Karthikeyan Kumarasamy; David M Livermore; Juan J Maya; Patrice Nordmann; Jean B Patel; David L Paterson; Johann Pitout; Maria Virginia Villegas; Hui Wang; Neil Woodford; John P Quinn
Journal:  Lancet Infect Dis       Date:  2013-09       Impact factor: 25.071

Review 8.  Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding.

Authors:  Liang Chen; Barun Mathema; Kalyan D Chavda; Frank R DeLeo; Robert A Bonomo; Barry N Kreiswirth
Journal:  Trends Microbiol       Date:  2014-10-07       Impact factor: 17.079

9.  Emergence and establishment of KPC-2-producing ST11 Klebsiella pneumoniae in a general hospital in Shanghai, China.

Authors:  Jingxian Liu; Jing Yu; Feng Chen; Jiajia Yu; Patricia Simner; Pranita Tamma; Ying Liu; Lisong Shen
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2017-12-27       Impact factor: 3.267

10.  Tracking Carbapenem-Producing Klebsiella pneumoniae Outbreak in an Intensive Care Unit by Whole Genome Sequencing.

Authors:  Chen Chen; Yi Zhang; Sheng-Lei Yu; Yang Zhou; Si-Yu Yang; Jia-Lin Jin; Shu Chen; Peng Cui; Jing Wu; Ning Jiang; Wen-Hong Zhang
Journal:  Front Cell Infect Microbiol       Date:  2019-08-08       Impact factor: 5.293

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.