Leizhen Huang1, Bianyun Cai2, Yong Huang1, Jingcheng Wang1, Ce Zhu1, Kun Shi1, Yueming Song1, Ganjun Feng1, Limin Liu1, Li Zhang3. 1. Department of Orthopedic Surgery and Orthopedic Research Institue, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China. 2. College of Medical Technology and Engineering, Henan University of Science and Technology, Luoyang, Henan 471026, China. 3. Analytical and Testing Center, Sichuan University, Chengdu, Sichuan 610065, China.
Abstract
Titanium (Ti) and its alloys have been widely used in clinics as preferred materials for bone tissue repair and replacement. However, the lack of biological activity of Ti limits its clinical applications. Surface modification of Ti with bioactive elements has always been a research hotspot. In this study, to promote the osseointegration of Ti6Al4V (Ti64) implants, calcium (Ca), oxygen (O), and phosphorus (P) codoped multifunctional micro-nanohybrid coatings were prepared on a three-dimensional (3D) printed porous Ti64 surface by microarc oxidation (MAO) and a hydrothermal method (HT). The surface morphologies, chemical compositions, and surface/cell interactions of the obtained coatings were studied. In vitro experiments indicated that all hybrid coating-modified Ti64 implants could enhance protein adsorption and MC3T3 osteoblasts' activity, adhesion, and differentiation ability. In vivo experiments showed that the hybrid coating promoted early osseointegration. By comparison, microarc oxidation-treated Ti64 (M-Ti) has the best biological activity and the strongest ability of osseointegration. It provides important theoretical significance and potential application prospects for improving the biological activity of Ti implants.
Titanium (Ti) and its alloys have been widely used in clinics as preferred materials for bone tissue repair and replacement. However, the lack of biological activity of Ti limits its clinical applications. Surface modification of Ti with bioactive elements has always been a research hotspot. In this study, to promote the osseointegration of Ti6Al4V (Ti64) implants, calcium (Ca), oxygen (O), and phosphorus (P) codoped multifunctional micro-nanohybrid coatings were prepared on a three-dimensional (3D) printed porous Ti64 surface by microarc oxidation (MAO) and a hydrothermal method (HT). The surface morphologies, chemical compositions, and surface/cell interactions of the obtained coatings were studied. In vitro experiments indicated that all hybrid coating-modified Ti64 implants could enhance protein adsorption and MC3T3 osteoblasts' activity, adhesion, and differentiation ability. In vivo experiments showed that the hybrid coating promoted early osseointegration. By comparison, microarc oxidation-treated Ti64 (M-Ti) has the best biological activity and the strongest ability of osseointegration. It provides important theoretical significance and potential application prospects for improving the biological activity of Ti implants.
<span class="Chemical">Titanium (<span class="Chemical">Ti) and its
alloys are the most widely used biomaterials
in orthopedics[1] and have exerted their
unique advantages, especially in load-bearing bone (e.g., hip joint) repair or replacement, due to the dominant merits including
superior mechanical strength, good biocompatibility, corrosion resistance,
etc.[2] However, the lack of bioactivity
as well as the much higher elastic modulus than human bone often affects
the bone–implant interface, leading to inadequate initial osseointegration
and surgical failure.[3] So far, a variety
of surface treatments have been used to improve the bioactivity of
Ti implants, some of which have displayed enhanced osseointegration
and been applied clinically.[4,5] Even so, the failurecases (loosens, shifts, and falls off) caused by the stress shielding
effect due to the high modulus of Ti implants are still common in
clinics.[6]
To effectively solve the
stress shielding effect, the pore structure
op<span class="Chemical">timization design of porous Ti is of great significance for the
mechanical properties and biological functions of customized materials.
The three-dimensional (3D) printing technique is one of the most precise
methods for preparing porous Ti alloy scaffolds according to patient-specific
requirements.[7] In addition to bone ingrowth,
another key to the strength of osseointegration is the stability of
the bone/implant interface. It is reported that the surface morphology
and chemical composition of porous scaffolds are the key factors affecting
the stability of the bone/implant interface.[8,9] Although
the 3D printing technique can well control the pore structure, the
surface performances are beyond its control, so surface modification
is still indispensable.
As known, human bone trabeculae are
mainly composed of calcium
(Ca) and phosphorus (P) and have a micro/nano multistage structure.[10] Compared with the smooth surface, on the one
hand, the micro/nano multistage structure can increase the friction
between the implant and the surrounding host bone, effectively avoid
the micromovement in the process of bone healing, and then improve
the initial stability of the implant.[11−13] On the other hand, this
structure can provide a large specific surface area and expose more
active sites for protein absorption and osteoblast spreading.[14] Studies have shown that the local osteogenic
microenvironment can be regulated by bioactive ions released from
bioactive modified bone implants under the process of physicochemical
dissolution, hydrolysis, and enzyme corrosion.[15] Ca ions have a strong affinity with phosphatidylserine
(a phospholipid membrane component), which can promote biomineralization
by accelerating the early formation of bonelike apatite, and further
enhance the adsorption of fibronectin, improve cytological behavior,
and finally promote new bone formation.[16] While P-containing groups can not only release specific signals
to induce osteogenic differentiation but also provide the calibration
site-specific adsorption of Ca ions to form calciumphosphate, the
main inorganic component of bone.[17,18] Therefore,
introducing bioactive elements of Ca and P into the porous Ti alloy
scaffold simultaneously and constructing the micro/nano multistage
structure have often been reported to mimic natural bone tissue structurally
and compositionally.[19]Some linear
surface modifica<span class="Chemical">tion methods such as plasma spraying
and ion implantation are difficult to process 3D porous matrix with
complex shape, which makes the surface modification of 3D porous metals
more challenging.[20−22] The hydrothermal technique (HT) has been successfully
used in our previous study to form a uniform Ca-doped TiP coating
with micro/nanoscaled hierarchical network topography at high temperatures
and high pressures.[4] In the past decade,
the microarc oxidation (MAO) technique, under the action of instantaneous
high temperatures and high pressures produced by arc discharge, has
often been applied to fabricate ceramic coatings with micro/nanoporous
structure mainly composed of oxides and supplemented bioactive elements
Ca and P with Ca/P ratios close to bonelike apatite by adjusting the
ratio of Ca and P salts in the electrolyte on the surface of Ti alloy.[23,24] However, both treatments can form a structure/component bionic coating
on the surface of Ti alloy, which one possesses better osteogenic
properties has not been determined.
In this study, we compared
the micro/nanomorphology, elemental
component, and phase composition of <span class="Chemical">HT and MAO coatings on the surface
of 3D printed porous Ti6Al4V (Ti64) scaffolds and also investigated
the in vitro effects of HT and MAO coatings on osteoblast
adhesion, proliferation, differentiation, mineralization, and apoptosis.
Then, we explored the bone binding of the three kinds of scaffolds
in a rat skull defect model and identified the intraosseous growth
pattern and bone/implant interface characteristics of the scaffolds
treated with HT and MAO.
Results and Discussion
Physical and Chemical Characterization of
Micro/Nanocoatings
The surface properties of implant materials,
including surface morphology and chemical elements, directly affect
the biological behaviors of osteoblasts, such as adhesion, proliferation,
and differentiation, and ultimately affect the stability and success
rate of the implant.[25,26] The inspiration of this study
came from the fact that the inorganic component of natural bone trabeculae
is mainly composed of calcium (Ca) and phosphorus (P), with a micro/nano
hierarchical structure. According to the principle of bionics and in situ doping of calcium, microspheres with nanoneedles
and bioactive coatings with micro/nano hierarchical pore structures
were prepared on the surface of Ti64. Stereomicroscopy showed that
interconnected regular pores uniformly distributed in the 3D printed
Ti64 scaffold (Figure A). For the H-Ti scaffold (Figure B), the surface was evenly covered with a black coating,
and the 3D porous structure was still visible. However, the surface
of the M-Ti porous scaffold was covered with a brown coating (Figure C). The scanning
electron microscopy (SEM) images of the three groups show that the
surface of the Ti group is relatively flat, and there is no specific
nanoscale structure (Figure A-e). The surface of the H-Ti group has many microspheres
consisting of nanorods, which grow radially from the surface, and
also disperses some deposits caused by the crystallization of the
remaining elements such as P and Ca in the solution (Figure B-b–e). Through the
MAO process, the 3D printed scaffold also displays micro/nano multilevel
porous morphology and a bioactive CaP coating has formed on the surface
(Figure C-b–e).
Figure 1
(A-a)
Ti64 scaffold (Ti), (B-a) scaffold treated by the hydrothermal
method (H-Ti), and (C-a) scaffold treated by the microarc oxidation
method (M-Ti); (A-b–e; B-b–e; C-b–e) SEM surface
morphologies of Ti, H-Ti, and M-Ti. (D) Energy-dispersive spectrometry
(EDS) elemental analysis on the surfaces of three groups. (E) XPS
analysis of three groups.
(A-a)
Ti64 scaffold (Ti), (B-a) scaffold treated by the hydrothermal
method (H-Ti), and (C-a) scaffold treated by the microarc oxidation
method (M-Ti); (A-b–e; B-b–e; C-b–e) SEM surface
morphologies of Ti, H-Ti, and M-Ti. (D) Energy-dispersive spectrometry
(EDS) elemental analysis on the surfaces of three groups. (E) XPS
analysis of three groups.Compared with the surface roughness, the chemical composi<span class="Chemical">tions
of the coating play more important roles in cell adhesion. At present,
it is believed that chemical components can directly activate related
signal pathways, resulting in changes in the structure of the cell
membrane across proteins, thus increasing protein adsorption and promoting
osteoblast adhesion to the implant surface.[27] EDS analysis (Figure D) shows that the coating on the surface of the scaffold has a high
Ca/P ratio, which is similar to that of bone apatite. The chemical
compositions and states of each element in the three groups were further
studied by XPS (Figure E), and it is obvious that in comparison to the control group, both
surfaces of H-Ti and M-Ti groups are mainly composed of O, Ti, Ca,
and P elements, implying that Ca, O, and P elements have been successfully
incorporated into the surface coating.
In Vitro Cell Behavior
Cell
Adhesion
It is important to
study the adhesion and mig<span class="Species">ration of osteoblasts on the surface of
implant materials. Recent studies have shown that the appropriate
surface roughness of the implant, especially the micro/nano surface
morphology, provides good three-dimensional space for the c<span class="Gene">ells and
increases the hydrophilicity of the material surface, thereby promoting
the adhesion of osteoblasts.[28,29]
We used SEM images
to observe the adhesion and migration of MC3T3-E1 osteoblasts cultured
in three groups for 3 days (Figure A). The treated Petri dish is most suitable for cell
adhesion and is used as the control group (Figure A-a,e). The osteoblasts on different surfaces
showed completely different morphologies. In the Ti group, cells formed
a shallow monolayer dispersed only on the surface and extended a small
number of cellular pseudopodia (Figure A-b,f). In the H-Ti group, polygonal or spindle cells
increased and pseudopodia increased (Figure A-c,g). In the M-Ti group, the number of
osteoblasts increased significantly compared with the first two groups,
showing multiple connecting pseudopodia (Figure A-d,h). Previously, it has been reported
that an anodically oxidized dental implant exhibited bone/implant
interlocking after intraosseous implantation.[30] However, bone bonding on the flat surface of the MAO-treated implant
is unsatisfactory. Therefore, the micro/nano multilevel pores generated
in our studies are expected to contribute significantly to the generation
of stronger bonding strength.
Figure 2
(A) SEM images of the adhesion and spreading
of osteoblasts cultured
for 3 days, (B) confocal laser scanning microscopy (CLSM) of actin
(red) and nucleus (blue) on the samples cultured for 3 days, (C) live/dead
fluorescence staining of cells cultured for 3 days, and (D) cell viability
was analyzed by flow cytometry. a, e, control; b, f, Ti group; c,
g, H-Ti group; and d, h, M-Ti group. There was no significant difference
in the percentage of living and dead cells among the four groups.
(A) SEM images of the adhesion and spreading
of osteoblasts cultured
for 3 days, (B) confocal laser s<span class="Gene">canning microscopy (CLSM) of actin
(red) and nucleus (blue) on the samples cultured for 3 days, (C) live/dead
fluorescence staining of cells cultured for 3 days, and (D) cell viability
was analyzed by flow cytometry. a, e, control; b, f, Ti group; c,
g, H-Ti group; and d, h, M-Ti group. There was no significant difference
in the percentage of living and dead cells among the four groups.
In line with the SEM results, the CLSM images showed
that osteoblasts
on the two modified samples (H-Ti and M-<span class="Chemical">Ti group) exhibited more increasing
number of osteoblasts and more clearly cytoskeletons to the control
(Petri dish) and pure Ti as confirmed by actin staining (Figure B-a–d). It
was believed that the chemical components directly activate the relevant
signal pathways, resulting in changes in the structure of cell membrane
transmembrane proteins and thus increasing the adsorption of proteins
on the implant surface and promoting cell adhesion and proliferation
on the implant surface. The micro/nanocoatings of the M-Ti group and
H-Ti group were mixed with appropriate amounts of calcium, oxygen,
and phosphorus ions, which were the same as the main components of
bone apatite. The continuous release of ions changes the extracellular
pH of osteoblasts, resulting in variations in the structure of transmembrane
proteins, which is conducive to the binding of osteoblasts to plasma
proteins adsorbed on the surface of the micro/nanocoating. The multipolar
pore structure of the M-Ti group could further increase the surface
roughness, hydrophilicity, and specific surface area of the implanted
materials, which can theoretically increase the integrin-binding sites
and plasma protein absorption rate.
Cytocompatibility
The cytotoxicity
test is the most commonly used method to evaluate the biocompa<span class="Chemical">tibility
of biomaterials. There are many methods to evaluate the cytotoxicity
of biomaterials, including cell morphology, cell growth ability, cell
cycle, and apoptosis. In this study, the cytotoxicity of the Ti group,
H-Ti group, and M-Ti group was evaluated by live/dead fluorescence
staining, flow cytometry, and CCK-8 test.
After osteoblasts
were cultured for 3 days, the activity and morphology of osteoblasts
on these s<span class="Gene">caffolds were evaluated by live/dead fluorescence staining
(Figure C). Compared
with the control group, there was no significant decrease in the number
of living cells in the Ti group, H-Ti group, and M-Ti group. The results
of flow cytometry showed that there was no significant difference
in the percentage of living and dead cells among the four groups (Figure D).
Lactate
dehydrogenase (LDH) activity and protein adsorp<span class="Chemical">tion are
also important indexes to evaluate the cytotoxicity of materials.
The activity of LDH was similar among different groups (Figure A). Ca, O, and P ion coating
did not increase the level of cytotoxicity, which was consistent with
the results of flow cytometry. Protein adsorption behavior is closely
related to surface properties, especially to surface roughness. As
shown in Figure B,
the amount of proteins adsorbed on the surface gradually increased
with time by different samples. The protein absorption of both M-Ti
and H-Ti groups was significantly higher than that of the Ti group
and control group at every time point, indicating that the coating
on the modified Ti surfaces (H-Ti and M-Ti group) promoted protein
adsorption.
Figure 3
(A) Lactate dehydrogenase (LDH) activity released during the first
3 days of incubation; (B) amount of total protein adsorbed at 0.5,
1, 2, and 3 h of culture in each group; (C) cell adhesion measured
by the CCK-8 assay after 0.5, 2, and 3 h of culture; and (D) cell
proliferation measured by the CCK-8 assay after 1, 4, and 7 days of
culture. **p < 0.01 compared to control and Ti
groups, * p < 0.05 compared to the H-Ti group.
(A) Lactate dehydrogenase (LDH) activity released during the first
3 days of incuba<span class="Chemical">tion; (B) amount of total protein adsorbed at 0.5,
1, 2, and 3 h of culture in each group; (C) cell adhesion measured
by the CCK-8 assay after 0.5, 2, and 3 h of culture; and (D) cell
proliferation measured by the CCK-8 assay after 1, 4, and 7 days of
culture. **p < 0.01 compared to control and Ti
groups, * p < 0.05 compared to the H-Ti group.
The adhesion and proliferation of osteoblasts on
the surface of
the control group, <span class="Chemical">Ti, H-Ti, and M-Ti group were further evaluated
by the CCK-8 assay. As shown in Figure C, the number of adherent cells in the M-Ti group and
H-Ti group was significantly higher than that in the control group
and Ti group. Figure D shows the proliferation of osteoblasts on the surface of different
samples at various time points. In general, cell proliferation in
different groups gradually increased over time. In comparison with
the control and Ti groups, cell proliferation in the H-Ti and M-Ti
groups was significantly higher. The results indicated that the modified
surface structures and the slow release of Ca, O, and P ions from
the coatings promoted cell adhesion and proliferation. In addition,
protein adhesion and proliferation in the M-Ti group was higher than
that in the H-Ti group at different time points, showing that the
micro/nanoporous scaffold coating with MAO treatment can provide necessary
adhesion conditions and physical structure for cell growth and migration.
In short, the micro/nanotextured hierarchical biomimetic topography
with Ca, O, and P ions could enhance the adhesion and proliferation
ability of osteoblasts.
Osteogenic Activity
The modified
surface structures and the release of Ca, O, and P ions are expected
to promote the osteogenic differen<span class="Chemical">tiation of osteoblasts on the scaffold.
The expression level of alkaline phosphatase (ALP) was used as an
early marker and alizarin red staining was used to detect extracellular
matrix (ECM) mineralization. As shown in Figure A,C, the staining of ALP in the H-Ti group
and M-Ti group was significantly higher than that in the Ti group
and control group. For alizarin red staining (Figure B,D), all samples showed mineralized nodules
(red). However, the number of mineralized nodules in the H-Ti group
and M-Ti group was significantly higher than that in the Ti group.
Furthermore, the number of mineralized nodules in M-Ti group was higher
than that in the H-Ti group. These results indicated that the micro–nanocoating
of the H-Ti group and M-Ti group can promote the mineralization of
osteoblasts. In addition, the multistage pore structure of the M-Ti
group is more conducive to the fine growth and differentiation of
osteoblasts.
Figure 4
a, Control; b, Ti group; c, H-Ti group; and d, M-Ti group.
(A)
ALP generated by cells cultured on different samples and results after
culturing for 7 days and (C) ALP relative content. (B) ECM mineralized
nodules generated by cells cultured on different samples after culturing
for 15 days and (D) ECM relative content. There are significant differences
between H-Ti and M-Ti compared with the control group and Ti group,
and there are differences between H-Ti and M-Ti groups. **p < 0.01 compared to control and Ti groups, * p < 0.05 compared to the H-Ti group.
a, Control; b, Ti group; c, H-<span class="Chemical">Ti group; and d, M-Ti group.
(A)
ALP generated by cells cultured on different samples and results after
culturing for 7 days and (C) ALP relative content. (B) ECM mineralized
nodules generated by cells cultured on different samples after culturing
for 15 days and (D) ECM relative content. There are significant differences
between H-Ti and M-Ti compared with the control group and Ti group,
and there are differences between H-Ti and M-Ti groups. **p < 0.01 compared to control and Ti groups, * p < 0.05 compared to the H-Ti group.
Protein and Gene Expression of Osteogenic
Markers
It is widely known that osteogenic differentia<span class="Chemical">tion
associates with the expression levels of proteins. Runx-2 is a specific
transcription factor, which plays an important role in osteoblast
differentiation, cytotoxicology, and osteogenic maturation.[31] OCN and OPN appear in the late stage of osteoblast
differentiation and regulate the growth of hydroxyapatite (HA) crystals.[32] Collagen type I (Col-1) protein is the main
type of collagen in bone tissue with the reticular structure, which
plays a key role in maintaining the integrity of the bone structure.
Here, the differentiation of osteoblasts on Petri dish, pure Ti, H-Ti,
and M-Ti was detected through the expression of Runx-2, Col-1, OCN,
and OPN by the western blot assay. As shown in Figure , significant upregulation of Runx-2, Col-1,
OCN, and OPN was observed for H-Ti and M-Ti groups compared with that
for control and pure Ti groups. However, there was no significant
difference between the H-Ti and M-Ti groups. The observed phenomenon
is consistent with the quantitative results of the gray values of
each protein band (Figure ). The mRNA expression of ALP, Runx-2, Col-1, BMP-2, and OCN
was assessed by real-time polymerase chain reaction (PCR) after culturing
for 1, 4, and 7 days, and the results are provided in Figure . At various time points, these
osteogenesis-related genes were significantly upregulated in the modified
samples when compared with the control and pure Ti groups. The M-Ti
group showed stronger osteogenesis enhancement compared with the H-Ti
group. These results indicated that the surface topography could influence
the osteoblast osteogenesis and the release of Ca, O, and P ions played
an indispensable role.
Figure 5
Western blot assay analysis qualitatively (A) and quantitatively
(B) on Runx-2, COL1A1, OCN, and OPN for detecting osteoblastic differentiation.
**p < 0.01 compared to control and Ti groups,
*p < 0.05 compared to the H-Ti group.
Figure 6
mRNA expression levels of ALP (A), RUNX-2 (B), COL-1 (C), BMP-2
(D), and OCN (E) in osteoblasts cultured for 1, 4, and 7 days, detected
by qRT-PCR. **p < 0.01 compared to control and
Ti groups, *p < 0.05 compared to the H-Ti group.
Western blot assay analysis qualitatively (A) and quan<span class="Chemical">titatively
(B) on Runx-2, COL1A1, OCN, and OPN for detecting osteoblastic differentiation.
**p < 0.01 compared to control and Ti groups,
*p < 0.05 compared to the H-Ti group.
mRNA expression levels of ALP (A), RUNX-2 (B), COL-1 (C), <span class="Gene">BMP-2
(D), and OCN (E) in osteoblasts cultured for 1, 4, and 7 days, detected
by qRT-PCR. **p < 0.01 compared to control and
Ti groups, *p < 0.05 compared to the H-Ti group.
In Vivo Implantation
μ-CT Analysis
To explore
the effect of HT/MAO treatment and Ca, O, and P deposition on the in vivo osseointegration of the porous Ti64 scaffold, the
scaffold was implanted into the ratcalvarial bone defect for 12 weeks;
by then, bone remodeling has already occurred. To eliminate the interference
of individual differences of different experimental animals, the cavity
of the same size was taken as the control group in the contralateral
position of the skull bone. In general, there was no infection, osteolysis,
and necrosis. As shown in Figure A, the Ti group, H-Ti group, and M-Ti group were covered
by dense white tissue, and the injury boundary disappeared. Only a
transparent membrane was formed in the contralateral blank control
group, and the injury boundary was still visible. The newly formed
bone both around the scaffold and within it was quantified by μ-CT
(Figure B,C). As shown,
both the thickness and the area of newly formed bone for H-Ti and
M-Ti groups were much larger than those for the Ti group. There was
a certain bone connection between the M-Ti scaffold and surrounding
bone tissue, the new bone tissue was significantly increased, and
the surrounding bone tissue was dense. Quantitative analysis demonstrated
that both modified implants (H-Ti and M-Ti group) have markedly increased
BV/TV (p < 0.01), Tb.N (p <
0.05), and %OI (p < 0.01) and decreased Tb.sp
(p < 0.01). Meanwhile, there was no significant
difference between H-Ti and M-Ti groups except for %OI.
Figure 7
a, Ti group;
b, H-Ti group; and c, M-Ti group. (A, B) Gross observation
and μ-CT images of the bone–implant interface at 12 weeks
postimplantation. (C) Quantitative analysis of osseointegration for
μ-CT results. **p < 0.01 compared to control
and Ti groups, *p < 0.05 compared to the H-Ti
group.
a, Ti group;
b, H-<span class="Chemical">Ti group; and c, M-Ti group. (A, B) Gross observation
and μ-CT images of the bone–implant interface at 12 weeks
postimplantation. (C) Quantitative analysis of osseointegration for
μ-CT results. **p < 0.01 compared to control
and Ti groups, *p < 0.05 compared to the H-Ti
group.
Quantitative
and Qualitative Histological
Results
Figure shows the representative histologi<span class="Gene">cal images of cross-sectioned
implants in the calvarial bone defect. The pillars of the implants
are shown in black, while the mineralized trabeculae are shown in
red. New bone tissue could be seen around the implants in all three
groups. For the pure Ti group, only the peripheral area is deposited
by mineralized bones (Figure A,D). In contrast, the bone ingrowth in the H-Ti group (Figure B,E) and the M-Ti
group (Figure C,F)
is more extensive and even bridged the adjacent pillars. The result
demonstrates that Ca, O and P elements associated with the modified
surface coating change the extracellular environment and have a better
osteogenic effect. Compared with the H-Ti group, the mature trabecular
bone in the M-Ti group is more closely connected with the micro–nanocoating
on the surface of the three-dimensional scaffold. Quantitative analysis
shows that implants with the modified surface (H-Ti and M-Ti groups)
have significantly boosted histomorphometric parameters and that the
M-Ti surface demonstrated the most significant bone-healing effects.
Figure 8
Histological
observation of Ti group (A), H-Ti group (B), and M-Ti
group (C). (D–F) Magnified images of the selected region corresponding
to (A–C), respectively. Quantitative results of bone ingrowth
(G) and bone–implant contact ratio (H) of the three experimental
groups. **p < 0.01 compared to control and Ti
groups, *p < 0.05 compared to the H-Ti group.
Histological
observa<span class="Chemical">tion of Ti group (A), H-Ti group (B), and M-Ti
group (C). (D–F) Magnified images of the selected region corresponding
to (A–C), respectively. Quantitative results of bone ingrowth
(G) and bone–implant contact ratio (H) of the three experimental
groups. **p < 0.01 compared to control and Ti
groups, *p < 0.05 compared to the H-Ti group.
The osseointegration ability of the pure <span class="Chemical">titanium
scaffold without
surface modification is insufficient. Similar to previous studies,
the bone area ratio is generally 20–30%.[33−35] Previous studies
have fully demonstrated that the modified surface coating of Ti by
both MAO and the HT method could enhance bone formation and osseointegration.[5,13,36] The same phenomenon has been
also observed from our results. However, the micro/nano hierarchical
porous coating prepared by MAO seems to have better performance with
a higher bone area ratio and bone–implant contact. It might
have resulted from the multiple micropores on the MAO surface coating.
Xiu et al. has shown that numerous globular bone matrixes with a diameter
of 1–2 μm were specifically located in the micropores
on the bone–implant surface.[6] That
might provide an anchorage point between scaffolds and new formation
bone tissue through a microporus structure and further promote the
natural bone remodeling and implant osseointegration.[37−39]
Conclusions
To improve
osseointegration, we used the hydrothermal technique
and microarc oxidation technique to modify 3D printed porous Ti64
scaffolds by the incorporation of biomimetic Ca, O, and P elements
for obtaining micro/nanocoatings with different morphologies. The
modified samples (H-Ti and M-Ti groups) show moderate surface roughness,
improved biocompatibility, and enhanced osteogenesis capability. Compared
with the hydrothermal surface treatment, MAO surface treatment shows
better biocompatibility and osteogenesis capability. Besides, both in vitro and in vivo studies indicated
that the introduction of Ca, O, and P ions could significantly promote
osteoblast adhesion/proliferation and further accelerate the maturation
and mineralization of osteoblasts. Thus, the Ca-, O-, and P-doped
Ti implant with the MAO surface coating is a much better candidate
with the great potential to be used in orthopedic applications.
Materials and Methods
Materials and Methods
Preparation of Three-Dimensional (3D) Printed
Porous Ti6Al4V Alloy Scaffolds
It is reported in the previous
studies that macropores in the range of 100–400 μm can
promote the ingrowth of bone and blood vessels, and the pore size
recommended for cell ingrowth was approximately 100–300 μm.[40,41] So, we 3D printed the Ti6Al4V scaffold with a pore size of 300 μm
in the study. First, software of material/magics was used to construct
a porous titanium alloy scaffold model with a porosity of 300 μm
and a size of φ 5 mm × 5 mm. Then, we 3D printed porous
Ti6Al4V (Ti64) scaffolds using a Swedish Arcam (AL) electron beam
rapid prototyping system that lays the forming substrate flat on the
power bed; afterward, the medical Ti-6Al-4V (ELL) alloy powder with
a chemical composition of Ti89.22, Al6.88, and V3.90 (wt %) with an
average particle size of 50 μm in the powder feeding cylinder
is evenly spread on the substrate of the forming cylinder with a powder
spreading rake. Each newly laid powder layer is prescanned several
times by electron beam at a certain scanning rate, and the powder
layer is preheated to about 730 °C. Then, the preheating layer
is melted and scanned once. According to the information of the section
outline of the first layer set by the CAD model, some areas of the
powder layer are selectively sintered to form a horizontal two-dimensional
section of the part. Then, the piston of the forming cylinder drops
a certain distance, the piston of the powder supplying cylinder rises
the same distance, the powder is smoothened again by the powder spreading
rake, and the electron beam begins to scan the powder according to
the CAD information of the second layer of the part. This is repeated
layer by layer until the sample preparation is complete, followed
by ultrasonic cleaning with acetone, ethanol, and deionized water,
respectively. Of note, the raw material of Ti-6Al-4V (ELL) alloy powder
with a chemical composition of Ti89.22, Al6.88, and V3.90 (wt %) with
an average particle size of 50 μm is of medical grade. Here,
the raw materials and equipment were provided by Shenyang Institute
of Metals, Chinese Academy of Sciences.
Synthesis
of Coatings
Hydrothermal (HT) Treatment
The
3D printed porous Ti64 s<span class="Gene">caffold was immersed in a mixed aqueous solution
of H2O2 and H3PO4 at a
mass ratio of 9:1, then subjected to a hydrothermal reaction in a
Teflon-lined autoclave under 220 °C for 24 h, and transferred
into 0.2 g/mL CaCl2 solutions to introduce the Ca element
in a Teflon-lined autoclave at 120 °C for 8 h.
Microarc Oxidation (MAO) Treatment
The 3D printed porous
Ti64 s<span class="Gene">caffold was used as an anode and a stainless
steel plate as a cathode. The MAO process was carried out in an aqueous
electrolyte containing 0.065 M calcium acetate monohydrate (Ca(CH3COO)2·H2O), 0.03 M sodium dihydrogen
phosphate (NaH2PO4), 0.065 M ethylenediamine
tetraethylenediamine (EDTA-2Na), and 0.5 M sodium hydroxide (NaOH).
During which, the working voltage was 350 V, the pulse frequency was
500 Hz, the duty cycle was 10%, the reaction time was 5 min, and the
bath temperature was maintained below 40 °C by cooling water.
The detailed reaction conditions are listed in Table as below.
Table 1
Reaction Conditions
Used in This Study
reactants
reaction conditions
sample
name
acronym
Ti64 powder
3D printing
porous Ti64 scaffold
Ti
mH2O2/mH3PO4 =9:1 0.2 g/mL CaCl2
220 °C, 24 h 120 °C, 8 h
two-step hydrothermally
treated Ti64 scaffold
H-Ti
0.065 M Ca(CH3COO)2·H2O, 0.03
M NaH2PO4, 0.065 M EDTA-2Na, 0.5 M
NaOH
350 V, 500 Hz, 10%, 5 min
microarc oxidation-treated Ti64 scaffold
M-Ti
Surface Characterization
The surface
morphologies of all samples were observed by field-emission scanning
electron microscopy (SEM, Eindhoven), and the surface element composi<span class="Chemical">tion
was determined by energy-dispersive X-ray spectroscopy (EDS, EPMA,
JAX-8100, Japan). The chemical states of titanium (Ti), oxygen (O),
and phosphorus (P) were analyzed by X-ray photoelectron spectroscopy
(XPS). The data were analyzed by XPS Peak Fit 4.1 software.
In Vitro Studies
Cell
Culture
Mouse osteoblast line
<span class="CellLine">MC3T3-E1 obtained from Sichuan University, China, Sichuan University
Cell Bank was used in this study. MC3T3-E1 cells were cultured in
high-glucose Dulbecco’s modified Eagle’s medium (DMEM,
HyClone) with 10% fetal bovine serum (FBS, HyClone) and 1% antimicrobial
solution of penicillin and streptomycin at 37 °C in a humidified
atmosphere of 5% CO2. The medium was changed every 3 days,
and the growth morphology of MC3T3-E1 was observed by an inverted
phase-contrast microscope when the cells reached 80–90% confluence
and then passaged. Only the third passage (P3) cell was applied in
all in vitro experiments.
Cell Attachment Assay
Ti, H-<span class="Chemical">Ti,
and M-Ti scaffolds were sterilized with a low-temperature plasma sterilizer
(hrpa-120, Haier, Qingdao, China). Before inoculating the cells, each
material was soaked in DMEM for 12 h to make it thoroughly moist.
In total, 1 × 104 P3 MC3T3-E1 cells were cocultured
with each group of samples (Ti, H-Ti, and M-Ti) in a 24-well culture
plate with 2 mL of culture medium. Three parallel samples in each
group. The cells were cultured with 5% CO2 in a humidity
incubator at 37 °C for 72 h. After that, the samples were taken
out and washed with phosphate-buffered saline (PBS) to wash away unattached
cells. The remaining cells on the samples were fixed with 2.5% glutaraldehyde,
dehydrated in a series of ethanol solutions (20, 40, 60, 80, 90, and
100%), and then gold-sputtered for SEM (scanning electron microscope
JSM-6510LV, JEOL, Japan) analysis.
Cell
Cytoskeleton Staining
The
P3 MC3T3-E1 c<span class="Gene">ells were inoculated with Ti, H-Ti, and M-Ti samples
at a density of 1 × 104 cells/well. Each group has
three parallel samples. After 72 h coculture, the remaining cells
on the samples were permeated with 0.2% Triton X-100 (Sigma-Aldrich)
for 15 min, cell nuclei were stained with 4′,6-diamidino-2-phenylindole
(DAPI), and the cytoskeletons were stained with rhodamine-conjugated
phalloidin for 20 min. Then, the cell cytoskeleton was observed by
confocal laser scanning microscopy (CLSM, Nikon, Japan). The parameters
of the laser scanning microscope are as follows: the laser is a semiconductor
solid-state laser; the output wavelength is 488, 550 nm, etc.; the Z-axis step is 1.0 μm; the scanning mode is the XYZT
scanning mode; and the scanning speed is slow. After prescanning,
the best scanning parameters were determined, the bottom of the sample
was focused, and the computer scanned continuously along the Z-axis of the sample through a microstepper motor to obtain
the fluorescence image of each layer. A high-resolution multilayer
overlay image was obtained. The collected images were processed by
Olympus software.
Live/Dead Fluorescence
Staining
Cell prepa<span class="Species">ration and coculture with three parallel
Ti, H-Ti, and
M-Ti samples are the same as those in the cell attachment assay. According
to the manufacturer’s instructions, the cell viability was
quantified using the Live/Dead stain (L34957, Invitrogen), and the
cells were observed and photographed using a confocal laser scanning
microscope.
Flow Cytometry
In a 24-well culture
plate, three parallel <span class="Chemical">Ti, H-Ti, and M-Ti samples in each group were
cocultured with 1 × 104 P3 MC3T3-E1 cells. After 3
days, the cocultured cell suspension from the plate and scaffolds
were collected and placed in the flow detection tube. After centrifugation,
the culture medium was discarded and the cell viability was detected
by flow cytometry. In brief, after the cells were washed using cold
phosphate-buffered saline (PBS), they were resuspended in a buffer
without any visible aggregation of the cells. Then, Calcein-AM (CAM)
(5 μL) and phosphatidylinositol (PI) (5 μL) were added,
and the samples were incubated in the dark for 20 min at 37 °C.
Live cells (Calcein positive, PI negative) were detected in the fourth
quadrant (Q4), while dead cells (Calcein negative, PI positive) were
detected in the first quadrant (Q1). The cells in the second quadrant
(Q2, calcitonin positive, PI positive) represent cells with the permeable
cytoplasmic membrane, that is, permeable cells, because PI is excluded
by the cells with intact cytoplasmic membrane and enters the cells
through the damaged and permeable cytoplasmic membrane. The third
quadrant (Q3) is generally impurities or fragments in the sample.
The more the points in the fourth quadrant (Q4) and the larger the
ratio, the better the cell viability.
Lactate
Dehydrogenase (LDH) Activity Assay
Lactate dehydrogenase
(LDH) activity was used as an index of <span class="Disease">cytotoxicity.
The samples were placed in 24-well plates with three wells in each
group. In total, 1 × 104 P3 MC3T3-E1 cells were seeded
in each well. After 72 h of cell culture, the culture medium was collected
and centrifuged for the determination of LDH activity using an LDH
activity detection kit (ab102526, Abcam, U.K.). LDH activity was determined
spectrophotometrically (at 440 nm) according to the manufacturer’s
instructions
Protein Adsorption Analyses
The
protein adsorption <span class="Gene">capacity of different coatings was evaluated by
fetal bovine serum (FBS) adsorption analyses. Three parallel samples
were placed in a 24-well culture plate in each group and 2 mL of 10%
FBS/DMEM was added to each well, followed by incubation at 37 °C
for 24 h. The plate was then rinsed with PBS, and 1% sodium dodecyl
sulfate (SDS) solution was used to elute surface proteins. Protein
concentration in the eluent was measured using a bicinchoninic acid
(BCA) protein assay kit (ab102536, Abcam, U.K.).
Cell Adhesion and Proliferation Assay
In the cell adhesion
assay, the preparation and incubation of cells
are similar to those in the cell attachment assay. Three parallel
samples of each group were cocultured with the same number of cells.
After the different coculture time points of 0.5, 2, and 3 h, the
samples were transferred in a new well with additional 24 h culture
and the culture medium for examination. In the cell proliferation
assay, cell preparation and incubation are similar to those in the
LDH activity assy. Each group has three parallel samples. After different
time points of cell culture of 1, 4, and 7 days, the culture medium
was collected for detection. The adhesion and proliferation activities
of MC3T3-E1 osteoblasts were measured using a CCK-8 kit (ab228554,
Abcam, U.K.). The CCK-8 solution (20 μL) and 180 μL of
serum-free culture medium were added to each well and then incubated
for 2 h at 37 °C. Finally, the absorbance of the culture medium
was determined by a Thermo microplate analyzer at 450 nm (Thermo).
The serum-free DMEM medium was selected as the blank solution to optimize
the absorbance. The material in control group is coverslip.
Osteogenic Activity Evaluation
Three parallel Ti, H-<span class="Chemical">Ti,
and M-Ti samples in each group were cocultured
with 1 × 104 P3 MC3T3-E1 cells in a 24-well culture
plate. Cells directly cultured on the well plate was selected as the
control group. After 24 h coculture, the culture medium was changed
with osteoinduction medium: a normal culture medium containing 10
μL/mL β-glycerophosphate, 50 μg/mL ascorbic acid,
and 10 μL/mL dexamethasone. After 7 days of osteoinduction culture,
the cells only from the scaffolds were collected by a trypsin digestion
method and transferred to a new well with additional 24 h osteoinduction
culture. Cells were fixed and stained with an ALP kit (P0321M Beyotime,
Shanghai, China), and the ALP was quantitatively analyzed by p-nitro phenyl phosphate (pNPP) (BP25341 Sigma-Aldrich)
at the same time. The ALP activity was expressed as the optical density
(OD) value at 405 nm per milligram of total protein. Calcium deposition
was detected to verify the extracellular matrix mineralization ability
of different samples. After being cultured in osteoinduction culture
for 14 days, the cells only from the scaffolds were collected and
transferred to a new well with additional 24 h osteoinduction culture.
Calcium deposition assays were further performed. First, the cells
were fixed with 70% ethanol and stained with 40 mM alizarin red S
(ST1078 Beyotime, Shanghai, China) solution. Then, the staining “hole”
was eluted with 10% cetylpyridinium chloride 1104006 (Sigma-Aldrich)
solution, and OD values were measured at 590 nm for quantitative analysis.
The results of calcium deposition were normalized by total protein
content and were expressed as the OD value at 590 nm per milligram
of total protein in the cells.
Western
Blotting
The cell preparation
and incubation are the same as those for the osteogenic activity evaluation.
After 7 days of osteoinduction culture, the cells only from the scaffolds
were collected by the trypsin digestion method. The cells purely cultured
in a well plate were collected as the control group. Then, the collected
cells and a cell lysis buffer were used for protein extraction. The
protein concentration was determined, and then, the protein samples
were heated, denatured, and analyzed by SDS-polyacrylamide gel electrophoresis
(SDS-PAGE). Proteins on poly(vinylidene fluoride) (PVDF) membranes
were separated by standard methods. The membrane was then sealed with
5% skimmed milk powder for 2 h and incubated overnight with mouse
anti-COL1A1 (ab34710, 1:1000; Abcam, U.K.), rabbit anti-RUNX-2 (ab76956,
1:1000; Abcam, U.K.), rabbit anti-OCN (ab93876, 1:500; Abcam, U.K.),
rabbit anti-OPN (ab8448, 1:1000; Abcam, U.K.), and GAPDH (ab263962,
Abcam, U.K.) at 4 °C. After washing with Tris buffer, proteins
on PVDF membranes were incubated with a secondary antibody at room
temperature for 2 h. Determination of the protein content was done
by enhanced chemiluminescence.
qRT-PCR
The cell preparation and
incubation are the same as those for the osteogenic activity evaluation.
The surface cells of the sample were collected using the TRIzol kit
to extract the total RNA from each group. Three parallel samples were
set up in each group, and nine samples from three culture plates were
collected at the set time to obtain sufficient RNA. Using the Revert
Aid TM First Strand cDNA Synthesis kit, mRNA was reverse-transcribed
into cDNA, at 25 °C 10 min, 42 °C 50 min, and 85 °C
5 min, and the target genes were amplified by PCR; the information
of PCR primers is given in Table . The conditions of fluorescence quantitative PCR amplification
are as follows: 94 °C 4 min, 94 °C 20 s, 60 °C 30 s,
72 °C 30 s, cycle 35 times, and signal detection at 72 °C.
The relative content of expressed mRNA was expressed by the ratio
of the target gene to internal reference GAPHD.
Table 2
Primers Used for qRT-PCR
gene
foward primer sequence (5′–3′)
reverse primer sequence (5′–3′)
ALP
AACGTGGCCAAGAACATCATCA
TGTCCATCTCCAGCCGTGTC
OCN
GGTGCAGACCTAGCAGACACCA
AGGTAGCGCCGGAGTCTATTCA
Col-1
GCCTCCCAGAACATCACCTA
GCAGGGACTTCTTGAGGTTG
BMP-2
CAACACCGTGCTCAGCTTCC
TTCCCACTCATTTCTGAAAGTTCC
RUNX-2
CCATAACGGTCTTCACAAATCCT
TCTGTCTGTGCCTTCTTGGTTC
GAPDH
GATGCTGGTG CTGAGTATGRCG
GGATCTTCATGAGGTAGTCA
In Vivo Animal Study
Construction
of Calvarias Defect Models
All animal opeSpecies">rations were approved
by the Animal Research Committee
of West China Medi<span class="Gene">cal College of Sichuan University. A total of 36
male Sprague–Dawley rats (12 weeks old, weighing 350–400g)
were selected. After the rats were anesthetized with isoflurane, a
sagittal incision of 1.5–2.0 cm was made on the scalp. Electric
ring drill (NouvagAG; Goldach, Switzerland) was used to create two
full-thickness Φ 5 mm diameter defects (NouvagAG; Goldach, Swiss)
on each side of the skull. Then, sterilized Ti, H-Ti, and M-Ti scaffolds
with a diameter of 5 mm and a thickness of 2 mm were implanted in
18 cases in each group. Soft tissue reduction and suture with 4-0
silk thread were performed to achieve one-stage closure. Each rat
received an intraperitoneal injection of antibiotics after the operation.
Micro-CT Evaluation (μ-CT)
The
implanted skulls were taken out at 12 weeks after the ope<span class="Species">ration
and s<span class="Gene">canned with a high-resolution μ-CT scanner (Sanco Medical
μ-CT50). The scanning resolution was 18 μm. The collected
images were reconstructed by software, and the three-dimensional model
was reconstructed by the CT Vol program (Sky Scan Company). The bone
volume per total sample volume (BV/TV), mean trabecular number (Tb.N),
percentage of bone contact with implants (% Oi), mean trabecular separation
(Tb.Sp) were calculated to determine the osteogenic characteristics
of the implanted samples.
Histological Analysis
The implants
and surrounding tissues were collected at 12 weeks after the operation.
The samples were fixed with 4% paraformaldehyde, dehydrated by gradient
ethanol, and embedded in poly(methyl methacrylate). The embedded samples
were sliced with a diamond tissue slicer (SAT-001 Chengdu Aolijin),
stained with methylene blue–acid fuchsin, and sealed with resin.
The bone area ratio was defined as the percentage of mature bone within
the whole tissue region (a ring region extending 250 μm from
the implant surface). The bone-to-implant contact was defined as the
percentage of the linear fraction of mineralized bone in direct contact
with the implant interface based on the analysis using NIS-Elements
F2.20 image software (Media Cybernetics).
Statistical
Analysis
The data are
expressed as the mean ± standard devia<span class="Chemical">tion (SD) from three independent
experiments. The data were analyzed using <span class="Chemical">SPSS 16.0 software (SPSS).
One-way analysis of variance (ANOVA) followed by a Student–Newman–Keuls
posthoc test was used to determine the level of significance. Values
of p < 0.05 and 0.01 were considered to be significant
and highly significant, respectively.
Authors: Franziska Clauder; Anne Sophie Czerniak; Sabrina Friebe; Stefan G Mayr; Dierk Scheinert; Annette G Beck-Sickinger Journal: Bioconjug Chem Date: 2019-09-30 Impact factor: 4.774
Authors: Xinxin Zhang; You Lv; Shan Fu; Yule Wu; Xueqin Lu; Lei Yang; Hongfang Liu; Zehua Dong Journal: Mater Sci Eng C Mater Biol Appl Date: 2020-08-04 Impact factor: 7.328