Literature DB >> 33454905

Development of 23 novel microsatellite markers of Amomum tsao-ko (Zingiberaceae) based on restriction-site-associated DNA sequencing.

Bingyue Lu1, Mengli Ma2, Wei Zhang2, Hengling Meng2, En Lei2, Tiantao Wang2, Chunyan Li2.   

Abstract

Amomum tsao-ko (Zingiberaceae) is a traditional Chinese medicine and condiment, and an important economic crop in the tropical forest of southwest China. However, few simple sequence repeat (SSR) markers are available in A. tsao-ko, which is hindering genetic research in this species. The aim of this study was to develop and characterize microsatellite markers for A. tsao-ko using restriction-site-associated DNA sequencing. A total of 115,482 microsatellites were identified using MISA software, and 13,411 SSR primer pairs were designed. 100 pairs of SSR primers were selected at random and used to evaluate polymorphisms among 4 A. tsao-ko samples. Finally, 23 pairs of SSR primers with clear bands and obvious polymorphism were selected for genetic diversity analysis of 72 A. tsao-ko accessions. The number of alleles and effective number of alleles per locus ranged from 2 to 6 and from 1.315 to 3.776, respectively. The observed heterozygosity ranged from 0.208 to 0.779, and the expected heterozygosity was from 0.239 to 0.735. The average values of the polymorphic information content were 0.454. Hardy-Weinberg equilibrium (HWE) analysis showed that 10 loci significantly deviated from HWE (P < 0.05). The pairwise FST and genetic distance values revealed low levels of genetic differentiation and high genetic similarity among six A. tsao-ko populations. These microsatellite markers developed will provide a valuable tool for further germplasm characterization, genetic diversity, and breeding studies in A. tsao-ko.

Entities:  

Keywords:  Amomum tsao-ko; Genetic diversity; Microsatellite; Zingiberaceae

Mesh:

Substances:

Year:  2021        PMID: 33454905      PMCID: PMC7811684          DOI: 10.1007/s11033-020-06127-6

Source DB:  PubMed          Journal:  Mol Biol Rep        ISSN: 0301-4851            Impact factor:   2.316


Introduction

Amomum tsao-ko, commonly known as black cardamom, is a perennial evergreen tufted herb belonging to the family Zingiberaceae. It is mainly distributed in Southwest China and Northern Vietnam, and found at altitudes ranging from 1300 to 1800 m. It is a type of economical crop that can grow in humid forests in tropical and subtropical areas [1, 2]. Yunnan province is the main A. tsao-ko-producing area in China, contributing to 95% of the nation’s output [3]. The whole plant of A. tsao-ko has a spicy smell, is edible and used medicinally. Its dried fruit is often used to treat internal resistance to cold and dampness, epigastric distension, fullness and vomiting, and malaria among other ailments [4, 5]. Recently, A. tsao-ko was one of the clinical prescriptions for patients with light, ordinary and severe cases of COVID-19 in China, demonstrating its important role in antiviral therapy [6, 7]. In food, A. tsao-ko has become a top-grade seasoning, and widely used in food processing [8]. Crop breeding effectiveness not only depends on the number of germplasm resources but also largely depends on the mastery of genetic characteristics of the diversity of these germplasm resources. Previous studies on A. tsao-ko have primarily concentrated on chemical composition analysis and pharmacological action, and there are few reports on genetic diversity [9-11]. Microsatellite markers, also called simple sequence repeat (SSR) markers, are effective in estimating genetic diversity and relationships within and among populations, and are widely used in plant genetic research. Yang et al. [12] developed 24 pairs of SSR primers by FIASCO technique for A. tsao-ko, but only nine of them were polymorphic, such limited SSR markers are not enough to conduct comprehensive genetic studies. The objectives of this study were to develop a set of novel microsatellite markers using restriction-site-associated DNA sequencing (RAD-seq) technique. These markers will provide a useful tool for A. tsao-ko genetic research.

Materials and methods

A total of 72 accessions from six cultivated populations of A. tsao-ko were collected from Yunnan Province, China (Fig. 1, Table S1). The collections covered the main producing area, with the longitudes ranging from 99°49′12″ (LC, Lancang population) to 103°31′48″ (PB, Pingbian population), latitudes ranging from 22°53′24″ (LVC, Lvchun population) to 24°17′24″ (YX, Yunxian population), and elevations spanning from 1665 to 2108 m. Each population consisted of 12 individuals, and the linear distance between individuals in the same population is not less than 50 m to decrease the possibility of sampling from the same clone.
Fig. 1

Map of A. tsao-ko samples collection sites. PB, Pingbian population; JP, Jinping population; YY, Yuanyang population; LVC, Lvchun population; YX, Yunxian population; LC, Lancang population (see Table S1 for full description of the populations)

Map of A. tsao-ko samples collection sites. PB, Pingbian population; JP, Jinping population; YY, Yuanyang population; LVC, Lvchun population; YX, Yunxian population; LC, Lancang population (see Table S1 for full description of the populations) The genomic DNA of A. tsao-ko was extracted using a cetyltrimethylamine bromide method [13], and the concentration and quality of DNA were detected by NanoDrop 2000 ultra-micro spectrophotometer. The working solutions of genomic DNA (20 ng/μL) of different samples were stored at 4 °C. Six genomic DNA samples (one sample from each population) of A. tsao-ko were mixed with the same amount, and the RAD-seq technique was used to simplify sequencing. The bidirectional sequencing of 350–650 bp recovery sequence was carried out by HiSeq 4000 sequencing platform with PE150 mode. To obtain clean reads, the adapters and sequences <50 bp and low-quality reads were removed. The clean reads were assembled using SOAPdenovo2.04 [14]. The sequencing data were deposited in the Sequence Read Archive (SRA) of NCBI database (SRA Accession: PRJNA529582). The software MISA was used to search the SSR sites of the DNA sequences obtained by sequencing [15]. The configuration parameters are as follows: the minimum repetition times of single nucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide were 10, 5, 4, 4, 4 and 4, respectively, and the sequence length between two adjacent SSR is ≥12 bp. SSR primers were designed based on the flanking sequence of SSR locus using Primer 3.0 software [16]. The parameters were set as follows: GC content 40–60%, primer length 18–27 bp, annealing temperature 50–65 °C, and amplification product length 100–300 bp. 100 pairs of SSR primers were randomly selected for synthesis and were screened by four A. tsao-ko samples. Finally, 23 pairs of SSR primers with clear bands and obvious polymorphism were selected for genetic diversity analysis of 72 A. tsao-ko accessions. The 10 μL polymerase chain reaction (PCR) system consists of 1.0 μL template DNA (20 ng/μL), 0.8 μL SSR primers (0.2 μmol/L), 0.8 μL deoxyribonucleoside triphosphates (dNTPs) (2.5 mol/L), 1.2 μL 10 × PCR buffer (including Mg2+), 0.2 μL Taq DNA polymerase (2.5 u/μL), and 6 μL ddH2O. The PCR procedure included pre-denaturation (95 °C/5 min), followed by 95 °C/30 s, 51–55 °C/30 s, 72 °C/30 s, a total of 30 cycles, and finally extended at 72 °C for 10 min to preserve at 4 °C. All of the PCR amplifications were conducted using a thermal cycler (ETC-811, Eastwin). The amplified products were separated on 8% non-denaturing polyacrylamide gel (acrylamide:bisacrylamide = 19:1), stained with 1% silver nitrate at the end of electrophoresis and photographed after the bands were clear. For each locus, the evaluation parameters including the observed number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), fixation index (F), genetic distance, and pairwise FST values were calculated by GenAlEx 6.501 program [17], which are also used for the Hardy–Weinberg equilibrium (HWE) test. Frequencies of null alleles were estimated using Micro-checker 2.2.3 [18]. The polymorphism information content (PIC) of polymorphic loci was calculated using PowerMarker V3.25 [19]. 72 accessions were assessed by multivariate principal coordinate analysis (PCoA) performed with GenAlEx 6.501. A Mantel test was performed to determine the correlation between genetic distance and geographic distance matrices using NTSYS-pc 2.11 software [20].

Results and discussion

By RAD-seq, 5,269,456 (1,317,364,000 bp) raw reads were obtained, and 5,117,655 (1,185,485,454 bp) clean reads were obtained after filtering. A total of 115,482 microsatellites were identified using MISA software, and 13,411 SSR primer pairs were designed using Primer 3.0. 100 pairs of randomly selected primers were validated in four A. tsao-ko accessions, of which 95 pairs could amplify bands in the target area, 64 pairs were polymorphic (Table S2). 23 primer pairs with clear bands and obvious polymorphism were selected for further analysis (Table 1).
Table 1

Characterization of 23 microsatellite loci developed for A. tsao-ko

LocusPrimer sequences (5′–3′)Repeat motifTa (°C)Size (bp)GenBank accession number
AM1F: CGCAGAATTAACCACCAGCG(A)1655135MT495611
R: TGCCTCTCAATTGTTCAGGACA
AM4F: AGGGATAGAAGACAGCCAGGA(AAAC)555150MT525020
R: TGAGGTTTCTTCCGCACTGT
AM6F: GCCAAGAGCATATTCAGTGAGT(AAC)753137MT525021
R: ATAACCGACCCCACCTAGTG
AM7F: CGCGCTTGTTTGGTTGGTTA(AAT)1055146MT525022
R: TCCCTTGCTTGCCTGCTATT
AM8F: CGAACAAACATGCCCGTGAA(AAT)855141MT525023
R: CGACAAGGTAACGGGTTCCA
AM9F: TGGGAGATCGAGGAAGGAAGA(AATT)555135MT525024
R: GCCTGCACCGCCATTTTTAT
AM12F: AGCAAGTGACACTCTCATCT(AG)1351133MT525025
R: ACTTGAGAGATACACAATGTGTT
AM13F: GACGTAGCTGCACTGCAATG(AG)855144MT525026
R: CCGAACAAACCAACCGAACC
AM17F: TGTGGTAATCAAACGCGACG(AGAGGG)554137MT525027
R: CGTCGAAGTCTGTCATATCTGC
AM27F: GAGGGAAGCGAATCTCCGAG(ATCGAA)555151MT525028
R: GTCCTCTCCTTCTCGGCATC
AM29F: ACGTACCAGTACAAACCTCAGA(ATT)854143MT525029
R: ACGTGTTAGCGACGAAATTAGT
AM36F: ACAAGAATAAATGCCCCGAA(CTATTC)553176MT525030
R: TGTTTGTAGTGTTCGCGTGC
AM40F: TGGTACCACAAAACTCTGCCA(CCT)655154MT525031
R: TGCCTGGCCAGTAAATTAAGGA
AM41F: GGCCTCAAGGTGTTCGTGTA(CCT)855143MT525032
R: AGGAGCTCCTCAACATCATCG
AM42F: GTAATTAGCAGGCACGACGC(CCTCTG)555149MT525033
R: ATCGTTGAAGTGTGGACGCT
AM43F: ACGACTAACCGATCGCCTTC(CGA)855137MT525034
R: CGTTCTCATCTCCGGAGTCG
AM44F: CTTCCGACAAAGGGCTGAGT(CGC)1155133MT525035
R: CCACGATGGAGTTAAGGCTGA
AM45F: GAGCAAGGCAGCAGATTTCG(CGC)655143MT525036
R: CGCTTCTCCGGAGTCGTAAA
AM49F: TCGGCTTGGAGGTAGCTAGA(CT)1155151MT525037
R: AGGTAGGTAGGTGGTGCTGT
AM65F: TTCCCCGACAAAACTAGGGC(GCA)655149MT525038
R: AGCAACGAGATCAAGGGCAA
AM89F: GTCGTCGATTGACTCCGTCA(TCT)755157MT525039
R: TCCATGTTCTGCTGCGAAGT
AM94F: GATGTGCGGCGAGACAGATA(TTAA)555146MT525040
R: GGCTGAGCCTGAGAGTACAG
AM99F: AACCACTCGAACGACCCTTC(TTGCCG)555138MT525041
R: CAACGTCCAAAAGCAGAAGCA
Characterization of 23 microsatellite loci developed for A. tsao-ko A total of 90 bands were amplified by 23 SSR markers in 72 A. tsao-ko, with an average of 3.913 bands per primer pairs. The total number of alleles (Na) per loci varied from 2 (AM65) to 6 (AM49 and AM89), and the effective number of alleles (Ne) ranged from 1.315 (AM43) to 3.776 (AM89). The average Ne (2.305) was lower than the Na (3.913) thus reflecting imbalanced allelic frequencies in populations, which could imply the presence of rare or unique alleles. The observed heterozygosity (Ho) and expected heterozygosity (He) in each locus vary from 0.208 (AM43) to 0.779 (AM42) and from 0.239 (AM43) to 0.735 (AM89), respectively. All the genetic parameters were higher than those of SSR markers developed by Yang et al [12]. The PIC ranged from 0.228 (AM43) to 0.709 (AM89). The mean fixation index was 0.072, and values ranged from −0.181 (AM42) to 0.272 (AM13), indicating that there was no inbreeding depression in A. tsao-ko population. Among all the loci, 5 loci (AM4, AM12, AM13, AM40, and AM44) were exhibited heterozygote deficiency, as indicated by the positive and significant fixation index. Heterozygote deficiency could be the result of rare alleles, correlations among loci, or the sampling of closely related individuals. HWE analysis showed that 10 loci (AM4, AM6, AM8, AM12, AM13, AM42, AM43, AM44, AM45, and AM49) significantly deviated from HWE (P < 0.05), and the remaining 13 loci (AM1, AM7, AM9, AM17, AM27, AM29, AM36, AM40, AM41, AM65, AM89, AM94, and AM99) were in accordance with HWE (Table 2). Micro-checker analysis showed that null alleles frequencies were lower than 0.2 for each locus, indicating these HWE deviations may be caused by anthropic selection and short-cloning history in cultivated rather than null alleles [12, 21].
Table 2

Genetic variation of the 23 polymorphic microsatellite loci in 72 accessions of A. tsao-ko

LocusNaNeHoHePICFFNAHWE
AM142.4440.5140.5910.5160.1300.0730.233ns
AM432.4610.4790.5940.5330.193*0.1290.046*
AM632.0560.5140.5140.395−0.0010.0130.000***
AM741.8770.4720.4670.413−0.0110.0390.961ns
AM831.6500.3660.3940.3590.070−0.0220.006**
AM952.5550.5710.6090.5800.0610.0380.972ns
AM1241.4030.2110.2870.3020.265*0.1390.000***
AM1332.0620.3750.5150.4540.272*−0.0330.000***
AM1741.8640.4930.4630.399−0.0640.1540.202ns
AM2732.2230.6060.5500.479−0.101−0.0510.401ns
AM2941.7040.3940.4130.3870.0450.0410.860ns
AM3641.7060.4310.4140.387−0.0400.1240.220ns
AM4042.7410.4860.6350.5710.235*0.0600.153ns
AM4151.8100.4030.4470.4150.100−0.0960.916ns
AM4242.9390.7790.6600.655−0.1810.0800.000***
AM4341.3150.2080.2390.2280.1290.1070.010*
AM4442.5980.4860.6150.5430.210*0.0080.001**
AM4552.3770.5560.5790.5150.0410.0790.001**
AM4961.9420.4140.4850.4600.1460.0680.000***
AM6521.5910.3240.3710.3230.128−0.0220.281ns
AM8963.7760.7710.7350.709−0.0490.0580.673ns
AM9431.5840.3330.3690.3280.096−0.0090.342ns
AM9932.2670.5690.5590.492−0.019−0.0250.979ns
Mean3.9132.3050.4680.5000.4540.072

Na, number of alleles; Ne, effective number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; PIC, polymorphism information content; F, fixation index, *significance value from 95% confidence interval; FNA, frequency of null alleles; HWE deviation from Hardy–Weinberg equilibrium (ns, no significant, *p < 0.05, **p < 0.01, ***p < 0.001)

Genetic variation of the 23 polymorphic microsatellite loci in 72 accessions of A. tsao-ko Na, number of alleles; Ne, effective number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; PIC, polymorphism information content; F, fixation index, *significance value from 95% confidence interval; FNA, frequency of null alleles; HWE deviation from Hardy–Weinberg equilibrium (ns, no significant, *p < 0.05, **p < 0.01, ***p < 0.001) In this study, PCoA analysis did not clearly separate the populations, and the germplasm from different populations were mixed with each other (Fig. 2). Consistent to this result, the Mantel test revealed that there was no significant correlation between geographic and genetic distance (r = 0.076, p = 0.579), which suggested no significant geographic restriction to gene flow among the populations. The pairwise FST values ranged from 0.029 (LVC and LC) to 0.074 (YY and LC), with an average of 0.047. The genetic distance varied from 0.056 (JP and YX) to 0.146 (YY and LC) with an average of 0.072 (Table 3). These results showed a relatively low degree of genetic differentiation and high genetic similarity among these populations. A. tsao-ko is a small group of species that is geographically restricted to southern China (Yunnan), northern Laos and Vietnam at altitudes ranging from 1300 to 1800 m, where it thrives in well-drained, moist, organic-matter-rich soil in shade or partial shade [4, 22]. Narrow distribution areas and special habitats lead to the high genetic similarity between A. tsao-ko populations, similar results were also observed in Dendrocalamus membranaceus [23], Thuja sutchuenensis [24] and Stemona parviflora [25]. Furthermore, a high level of gene flow (Nm = 5.425) was detected among A. tsao-ko populations based on random amplified polymorphic DNA (RAPD) markers in our previous study [8]. Such gene flow was enough to resist the genetic differentiation caused by genetic drift. In conclusion, we developed and characterized 23 novel microsatellite markers in A. tsao-ko. The set of markers significantly increases the availability of polymorphic molecular markers for the species, and will provide a valuable resource for genetic diversity, core collection construction, genetic mapping and marker-assisted selection breeding in A. tsao-ko.
Fig. 2

Principal coordinate analysis based on the genotyping of 72 accessions of A. tsao-ko with 23 microsatellite loci

Table 3

Pairwise of FST (above diagonal) and genetic distance (below diagonal) for six A. tsao-ko populations

PopulationJPPBLVCYYLCYX
JP0.0520.0340.0340.0520.032
PB0.0950.0470.0640.0570.059
LVC0.0580.0960.0430.0290.033
YY0.0590.1410.0810.0740.056
LC0.0930.1220.0600.1460.046
YX0.0560.1120.0570.1110.084
Principal coordinate analysis based on the genotyping of 72 accessions of A. tsao-ko with 23 microsatellite loci Pairwise of FST (above diagonal) and genetic distance (below diagonal) for six A. tsao-ko populations Below is the link to the electronic supplementary material. Supplementary material 1 (DOCX 35 kb)
  10 in total

1.  PowerMarker: an integrated analysis environment for genetic marker analysis.

Authors:  Kejun Liu; Spencer V Muse
Journal:  Bioinformatics       Date:  2005-02-10       Impact factor: 6.937

2.  Pyranoflavanones and Pyranochalcones from the Fruits of Amomum tsao-ko.

Authors:  Jun Gu Kim; Hari Jang; Thi Phuong Linh Le; Hye Ryoung Hong; Mi Kyeong Lee; Jin Tae Hong; Dongho Lee; Bang Yeon Hwang
Journal:  J Nat Prod       Date:  2019-06-25       Impact factor: 4.050

3.  Isolation and characterization of microsatellite markers for Amomum tsaoko (Zingiberaceae), an economically important plant in China.

Authors:  Y-W Yang; Z-Y Yang; M-R Yan; Z-G Qian; K-Y Guan
Journal:  Genet Mol Res       Date:  2014-10-08

4.  Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.).

Authors:  T Thiel; W Michalek; R K Varshney; A Graner
Journal:  Theor Appl Genet       Date:  2002-09-14       Impact factor: 5.699

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

7.  Genetic diversity and differentiation of Dendrocalamus membranaceus (Poaceae: Bambusoideae), a declining bamboo species in Yunnan, China, as based on Inter-Simple Sequence Repeat (ISSR) Analysis.

Authors:  Han-Qi Yang; Man-Yun An; Zhi-Jia Gu; Bo Tian
Journal:  Int J Mol Sci       Date:  2012-04-10       Impact factor: 6.208

8.  A rapid advice guideline for the diagnosis and treatment of 2019 novel coronavirus (2019-nCoV) infected pneumonia (standard version).

Authors:  Ying-Hui Jin; Lin Cai; Zhen-Shun Cheng; Hong Cheng; Tong Deng; Yi-Pin Fan; Cheng Fang; Di Huang; Lu-Qi Huang; Qiao Huang; Yong Han; Bo Hu; Fen Hu; Bing-Hui Li; Yi-Rong Li; Ke Liang; Li-Kai Lin; Li-Sha Luo; Jing Ma; Lin-Lu Ma; Zhi-Yong Peng; Yun-Bao Pan; Zhen-Yu Pan; Xue-Qun Ren; Hui-Min Sun; Ying Wang; Yun-Yun Wang; Hong Weng; Chao-Jie Wei; Dong-Fang Wu; Jian Xia; Yong Xiong; Hai-Bo Xu; Xiao-Mei Yao; Yu-Feng Yuan; Tai-Sheng Ye; Xiao-Chun Zhang; Ying-Wen Zhang; Yin-Gao Zhang; Hua-Min Zhang; Yan Zhao; Ming-Juan Zhao; Hao Zi; Xian-Tao Zeng; Yong-Yan Wang; Xing-Huan Wang
Journal:  Mil Med Res       Date:  2020-02-06

9.  SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler.

Authors:  Ruibang Luo; Binghang Liu; Yinlong Xie; Zhenyu Li; Weihua Huang; Jianying Yuan; Guangzhu He; Yanxiang Chen; Qi Pan; Yunjie Liu; Jingbo Tang; Gengxiong Wu; Hao Zhang; Yujian Shi; Yong Liu; Chang Yu; Bo Wang; Yao Lu; Changlei Han; David W Cheung; Siu-Ming Yiu; Shaoliang Peng; Zhu Xiaoqian; Guangming Liu; Xiangke Liao; Yingrui Li; Huanming Yang; Jian Wang; Tak-Wah Lam; Jun Wang
Journal:  Gigascience       Date:  2012-12-27       Impact factor: 6.524

10.  Genetic diversity of the critically endangered Thuja sutchuenensis revealed by ISSR markers and the implications for conservation.

Authors:  Jianfeng Liu; Shengqing Shi; Ermei Chang; Wenjuan Yang; Zeping Jiang
Journal:  Int J Mol Sci       Date:  2013-07-16       Impact factor: 5.923

  10 in total
  2 in total

1.  Assessment of genetic diversity in Amomum tsao-ko Crevost & Lemarié, an important medicine food homologous crop from Southwest China using SRAP and ISSR markers.

Authors:  Mengli Ma; Tiantao Wang; Bingyue Lu
Journal:  Genet Resour Crop Evol       Date:  2021-05-20       Impact factor: 1.876

2.  De novo transcriptome assembly, gene annotation, and EST-SSR marker development of an important medicinal and edible crop, Amomum tsaoko (Zingiberaceae).

Authors:  Mengli Ma; Hengling Meng; En Lei; Tiantao Wang; Wei Zhang; Bingyue Lu
Journal:  BMC Plant Biol       Date:  2022-09-29       Impact factor: 5.260

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.