Neurodevelopmental Toxicity of Polystyrene Nanoplastics in Caenorhabditis elegans and the Regulating Effect of Presenilin.

As one of the most widely used materials, plastic polymer fragments can abrasively degrade into microplastic (MP) and smaller nanoplastic (NP) particles. The present study aimed to investigate the influence of particle size on neurodevelopmental toxicity induced by polystyrene nanoplastics (PS-NPs) in Caenorhabditis elegans and to explore the underlying potential mechanism. C. elegans were exposed to different concentrations of PS-NPs with various sizes (25, 50, and 100 nm) for 72 h. Our results showed that all of these PS-NPs could dose-dependently induce an increase in reactive oxygen species production and mitochondrial damage in C. elegans, resulting in inhibition of body length, head thrashes, body bending, and dopamine (DA) contents. A weaker neurotoxicity was found in 25 nm PS-NPs compared to 50 and 100 nm PS-NPs, which might be due to preferential cellular distribution and greater polymerization capability of the smaller particles. In addition, all these PS-NPs could induce lipofuscin accumulation and apoptosis independent of particle size, suggesting that oxidative damage and mitochondrial dysfunction may not be the only way responsible for NP-induced neurotoxic effects. Furthermore, the mutant test targeting two presenilin genes (sel-12 and hop-1) showed that sel-12 and hop-1 were involved in regulation of PS-NP-induced neurodevelopmental toxicity and mitochondrial damage. In conclusion, PS-NPs could induce neurodevelopmental toxicity dependent on particle sizes mediated by mitochondrial damage and DA reduction. Enhanced expression of presenilin plays a role in PS-NP-induced oxidative stress and neurodevelopmental toxicity.

Introduction

The plastic polymer is one of the most world-widely used materials, and plastic polymer fragments can be abrasively degraded into microplastic particles (MPs, with a diameter smaller than 5 mm) and smaller nanoplastics (NPs, with a diameter smaller than 100 nm) in environments. In addition, some primary MPs originate from the production processes of preproduction pellets, synthetic textiles, cosmetics, and personal care products.[1,2] Now, MPs have been ubiquitously detected in sediments, oceans, rivers, sewages, soil, and various marine species including fish, bivalves, birds, mammals, and invertebrates,[3,4] with average concentrations ranging from ng/L to μg/L in aquatic and terrestrial environments.[5] The large specific surface area and excellent adsorption capability of MPs make them serve as good vectors for exogenous toxicants, including various metals and organic pollutants, which would further intensify their influences on the ecological environment.[6] Moreover, MPs and NPs could transfer through the food chain and eventually enter organisms through the skin, respiratory tract, and digestive tract.[2,7,8] It has been reported that plastic particles (≤0.3 μm) could reach and accumulate in the liver, spleen, and lymphatic systems of rodents.[9] A surveying on eight healthy volunteers from Europe and Asia showed that up to nine types of MPs including polypropylene and polyethylene terephthalate have been detected in human stool samples.[10] Recently, research studies have confirmed that MPs could break through the blood–brain barrier (BBB) and accumulate in the brain tissue of fish.[11−13]

Previous studies have reported adverse effects of these small plastic particles on marine organisms, invertebrates, and mammals. The central nervous system (CNS) was identified as an important target for the toxic effects of MPs.[13,14] Exposure to MPs (1–5 μm) could cause damages to the motor nerve in European seabass through inhibition of acetylcholinesterase (AChE) activity (a representative biomarker for neurotoxicity).[15] Polystyrene microplastics (PS-MPs, 100 μm) also induced significant nuclear alterations, DNA damage, and reduction of AChE activity in the gills of Mediterranean mussels (Myetilus galloprovincialis).[16] Furthermore, exposure of PS-MPs (5 and 20 μm) also significantly reduced the AChE activity in mice liver, suggesting the potential neurotoxicity in mammals.[17]

Generally, accumulation and toxic potential of plastic debris in the organism tissues increase when plastic fragments into smaller particles such as microplastics (<1 mm) or nanoparticles (<100 nm).[18] Presently, several studies investigated the neurotoxicity of NPs in aquatic organisms. The decrease in AChE activity and induction of oxidative stress were observed after polystyrene nanoplastic (PS-NP) exposure in brine shrimp (Artemia fransiscana) and adult tilapia fish Oreochromis niloticus, indicating the neurotoxic potency of PS-NPs.[12,19] PS-NPs (50 nm) detected in the brain of adult zebrafish were reported to cause upregulation of CNS myelin basic protein and inhibition of AChE activity.[20] Moreover, Mattsson et al. reported that Daphnia magna exposed to amino (ANP)-modified NPs (53 nm) showed weight decrease, water loss, and NP accumulation in the brain tissue, resulting in a slower feeding rate and lower hunting efficiency than controls.[21]

However, the underlying potential mechanism of NP-induced neurotoxicity is poorly understood until now. There were only a few toxicological research studies which indicated that oxidative stress and subsequent DNA damage were associated with the neurotoxicity induced by NPs.[13,22,23]Caenorhabditis elegans has many excellent advantages as an in vivo model organism for neurotoxicity evaluation, including the short development cycle from egg to adult, short life span between 2 and 3 weeks, and easy handling with translucent body.[24] In addition, approximately 60–80% of worm genes have the corresponding human orthologs, such as neurodegenerative disease-related proteins amyloid precursor protein (APP) and microtubule-associated Tau protein. Furthermore, C. elegans lacks a functional BBB, making neurotoxins easy to spread in the nervous system.[25] In this study, C. elegans were exposed to different sizes of PS-NPs (25, 50, and 100 nm), and the impact of NP size on the neurotoxicity was investigated. Furthermore, the mutant nematode strains were applied to explore the potential toxicological mechanism.

Results and Discussion

Effect of PS-NPs on Growth and Locomotion Deficits in C. elegans

Various factors such as particle size, material type, exposure concentration, and exposure duration have been confirmed as the influencing factors on the neurotoxicity of MPs and NPs. Among them, particle size is assumed to be a crucial factor correlated with toxicity. However, the precise manner of particle size affecting the biological process is still unknown. The results of Mattsson et al. reported that positively charged ANP-modified PS-NPs (from 52 to 330 nm) could reduce the survival rate of Daphnia, penetrate the BBB in fish, and cause behavioral disorders dependent on size.[21] In this study, different sizes of PS-NPs (25, 50, and 100 nm) were applied to investigate the biological effect and locomotion behavior in C. elegans in terms of body length, head thrashes, and body bending. The experimental concentrations from 10 to 100 μg/L were selected in this study according to our pre-experiment. As shown in Figure A, after treatment of PS-NPs, the body length of C. elegans decreased in a dose-dependent manner. The larger particle (50 and 100 nm) seemed to have higher efficiency than 25 nm particles on inhibition of body growth, although the difference is of no statistical significance. Consistently, the locomotion behavior assays also indicated that C. elegans had obvious locomotion deficits after exposure to 50 and 100 nm PS-NPs, but not 25 nm PS-NPs (Figure B,C). In the groups of 10 and 100 μg/L 50 nm PS-NPs, the frequency of head thrashes and body bends reduced by 17.2 and 28.8, and 29.0 and 37.0% as compared to the control group, respectively. Similarly, PS-NPs of 100 nm (10 and 100 μg/L) caused reduction of head thrashes and body bends by 17.4 and 29.2, and 30.3 and 36.3%, respectively. These results suggest that the toxic severity of plastic particles with the diameter in the nanometer range (<100 nm) was inversely related to particle sizes.

Figure 1

Effect of different sizes of PS-NPs on growth and locomotion behavior of C. elegans. C. elegans were treated with 10 and 100 μg/L PS-NPs particles (25, 50, and 100 nm) for 72 h, and then, (A) body length, (B) head thrashes, and (C) body bends were measured, as described in the Materials and Methods. The control group was treated with K+ medium alone. *p < 0.05 and **p < 0.01, compared with control groups.

Based on research of the simulated biomimetic heterogeneous membrane interface, small NP particles (<200 nm) dominantly localized in the ordered phase, whereas larger particles mainly accumulated in the fluidic disordered phase, indicating that different sizes of NPs had preferential compatibility with the two-phase liposomes of the cell surface.[26] In the previous study on NPs and MPs with diameters ranging from 500 to 5.0 μm, the most significant toxic effects were found in the groups of 500 and 1000 nm MP particles. The smaller 100 nm NPs and larger 2 and 5 μm MPs had almost equivalent neurotoxicity in C. elegans, which was weaker than that of 500 and 1000 nm MP particles.[27] It was reported that monodisperse nano-PS could easily cross the biological barriers, but the agglomerate nanoparticles would be physically blocked from the cell membrane.[28] Our results also showed that PS-NPs less than 200 nm could quickly penetrate and integrate into cell membranes and consequently cause neurotoxicity. As for the weaker toxic effects of 25 nm PS in C. elegans observed in this study, we speculate that it might be because of the easier polymerizing characteristic of these smaller nanoparticles.

Dopaminergic Loss and Mitochondrial Damage Induced by Different Sizes of PS-NPs in C. elegans

NP exposure was reported to cause neurotoxicity manifested as alterations of neurotransmitter and neuronal behavior disorders.[13] As a major catecholamine neurotransmitter in the brain, dopamine (DA) participates widely in neurobiological processes. Dysregulation of the DA balance is a crucial pathogenic mechanism of Parkinson’s disease, schizophrenia, Tourette syndrome, cognitive disfunction, and so forth.[29] Recently, DA changes following exposure of MPs have been reported in bivalves and fish.[20,30] Using a human three-dimensional in vitro model of early CNS PAX6(+) precursor cells derived from the embryonic stem cell, polyethylene NPs (33 nm) were found to accumulate in dopaminergic neurons and interfere with expression of the Notch pathway genes.[31] In this study, to determine the developmental neurotoxicity (DNT) of PS-NPs, transgenic C. elegans strain BZ555 was treated with different concentrations of PS-NPs, and the DA content was examined in the fluorescently labeled dopaminergic neuron. As shown in Figure A, compared with the control groups, there was no effect on the DA content after 10 μg/L PS-NP exposure. However, under the 100 μg/L NPs treatment, DA content was downregulated by 25, 50, and 100 nm NPs with 8.2, 11.5, and 12.2% reduction, respectively (p < 0.05). The lower frequency of head thrashes and body bending (Figure B,C) and reduction of DA content (Figure A) indicated the DNT induced by PS-NPs.

Figure 2

Dopaminergic loss and mitochondrial damage induced by PS-NPs in C. elegans. C. elegans were treated with 25, 50, and 100 nm PS-NP particles (10 and 100 μg/L) for 72 h, and then, (A) DA content and (B) mitochondrial damage were examined with fluorescence detection, as described in the Materials and Methods. The control group was treated with K+ medium alone. *p < 0.05 and **p < 0.01, compared with control groups.

Mitochondrial dysfunction has been proposed as an important mechanism for substantia nigra dopaminergic neurodegeneration.[32] To characterize the mechanisms of DNT induced by PS-NPs, a transgenic PD4251 strain with the green fluorescent protein (GFP)-labeled mitochondria was applied to examine the mitochondrial damage. As shown in Figure B, the reduced fluorescence signal compared with control groups indicated mitochondrial damage induced by PS-NPs (Figure B). Consistent with DA assay, the biological effect of 25 nm PS-NPs was weaker in inducing mitochondrial damage than that of larger size PS-NPs. Quantized results showed that 10 and 100 μg/L 100 nm PS-NPs caused significant reductions of fluorescence intensity by 7.5 and 24.2%, respectively (p < 0.05). Previously, it was reported that NH (2)-labeled PS-NPs (60 nm) could induce mitochondrial damage and ATP depletion in human epithelial (BEAS-2B) cells.[33] ANP-modified PS-NP (50 and 100 nm) exposure resulted in mitochondrial disruption and release of cytochrome C in primary human alveolar macrophages, primary human alveolar type 2 epithelial cells, and the human alveolar epithelial type I-like cell (TT1).[34] These abovementioned findings suggest that mitochondrial damage might be one of the important mechanisms by which PS-NPs induced neurodevelopmental toxicity.

Oxidative Stress and Apoptosis Induced by PS-NPs in C. elegans

Mitochondria are important organelles involved in the intracellular Ca2+ signaling pathway, ATP production, maintenance of membrane stability, and reactive oxygen species (ROS) balance. Excessive production of active oxygen in the mitochondria is responsible for various physiology disorders. In the gills, PS-MPs induced a consistent increase in SOD and glutathione-S-transferase activity, and then, AChE and lipid peroxidation (LPO) activity reduced subsequently.[35] Treatment of PS-MPs (5 and 20 μm) also triggered oxidative stress in mice liver tissue as evidenced by increased glutathione peroxidase and SOD and decreased catalase (CAT).[17] To examine the oxidative stress response in C. elegans, ROS production induced by PS-NP particles was detected with a 2′,7′-dichlorodihydrofluoresceindiacetate (DCFH-DA) assay. As shown in Figure A, exposure of 10 μg/L 25 nm PS-NPs had no obvious effect on ROS production, while 100 μg/L 25 nm PS-NPs did increase the intracellular ROS level. Compared to the control group, both 10 and 100 μg/L 50 nm PS-NP exposure resulted in a significant increase in ROS production by 10.5 and 33.3%, respectively. For 10 and 100 μg/L 100 nm PS-NPs, the level of ROS levels increased by 14.9 and 28.9%, respectively.

Figure 3

Oxidative damage and apoptosis induced by NPs in C. elegans. C. elegans were treated with 10 and 100 μg/L PS-NP particles with different sizes (25, 50, and 100 nm) for 72 h, and then, the (A) ROS level, (C) lipofuscin accumulation, and (D) apoptosis were detected, as described in the Materials and Methods. (B) Representative images of ROS production. *p < 0.05 and **p < 0.01, compared with control groups.

Increased lipofuscin and LPO are generally considered to be crucial biomarkers for cellular damages induced by oxidative stress.[36] As shown in Figure B, lower concentrations of PS-NPs (10 μg/L) had only slight effects on lipofuscin induction, and higher concentrations of (100 μg/L) PS-NPs (25, 50, and 100 nm) could significantly stimulate the lipofuscin levels (p < 0.05) by 10.3, 12.2, and 9.3%, respectively, as compared with the control group. Furthermore, the acridine orange (AO) staining results showed that 25, 50, and 100 nm PS-NPs significantly induced an average apoptosis rate of 12.4–20.7% (Figure C). The elevated ROS production, lipofuscin accumulation, and apoptosis induction indicated oxidative damages via mitochondrial dysfunction and might play a role in biological effects after NP exposure, which was consistent with the results of previous studies. In the study of Qu et al., ANP-modified PS-NPs induced apoptosis and DNA damages through oxidative stress in C. elegans.[37] The accumulation of 50 nm ANP-modified PS-NPs in lysosomes could lead to release of cathepsins into the cytosol, which ultimately propagated the mitochondrial damages and subsequent activation of apoptosis in human astrocytoma cells.[38]

Meanwhile, it was found that different sizes of PS-NPs had no differential effect in inducing lipofuscin and apoptosis, indicating that mitochondrial dysfunction and subsequent oxidative damage might not be the exclusive mechanism responsible for NP-induced neurotoxicity. According to results of literature reviewing, lysosomal destabilization and inflammation are also involved in DNT induced by NP exposure.[39,40]

Regulation of Presenilin on Neurodevelopmental Toxicity Induced by PS-NPs

Presenilin, mainly distributed in the endoplasmic reticulum (ER) and mitochondria, is closely related to mitochondrial toxicity and mitochondrial phagocytosis.[41] In mammals, presenilin-1 (PS1) and -2 (PS2) constitute the catalytic components of the γ-secretase complex, which processes APP to produce amyloid-β.[42] It is reported that mutation of presenilin genes is associated with the onset of Alzheimer’s disease, dementia, and Parkinson’s disease.[43] In C. elegans, the presenilin genes sel-12 or/and hop-1 constitute the catalytic subunit of the γ-secretase proteolytic enzyme, mediating activation of the Notch pathway.[44]Sel-12 can induce apoptosis under oxidative stress in C. elegans through a mitochondrial pathway via abnormal calcium release from the ER.[45] Mutation of hop-1 can attenuate the survival reduction, motor deficits, and dopaminergic degeneration in C. elegans induced by rotenone or paraquat through mitochondria-associated mechanisms.[46]

Based on the abovementioned experimental results, 50 nm PS-NPs were selected for subsequent experiments of the presenilin gene. As shown in Figure A, real time-quantitative polymerase chain reaction (RT-qPCR) results revealed that 50 nm PS-NPs could significantly stimulate the expression of sel-12 and hop-1, indicating involvement of sel-12 and hop-1 in neurodevelopmental toxicity induced by PS-NPs. To clarify the role of presenilin, nematode strains AR171 (sel-12 mutant) and LA62 (hop-1 mutant) were further applied in mutant experiment. As displayed in Figure B, compared with the wild-type (WT) C. elegans, both AR171 and LA62 could partially reverse the decrease in body length induced by PS-NPs exposure. In sel-12 mutant groups, the body length of C. elegans after 100 or 1000 μg/mL NP exposure increased by 6.3 or 8.5% compared to that of WT groups, respectively. For hop-1 mutant groups, the body length of the 10, 100, or 1000 μg/mL NP groups increased by 7.6, 7.5, and 11.1%, respectively (p < 0.05, Figure B). Similarly, the inhibitory effect on movement behavior caused by the 50 nm PS-NP was alleviated by mutants of sel-12 and hop-1 (Figure C,D). In addition, the sel-12 mutant could also alleviate the increase in ROS level and lipofuscin accumulation caused by 100 and 1000 μg/mL PS-NP treatment, with 16.2 and 10.6, and 12.6 and 7.1% reduction, respectively (Figure A,B). Compared to the WT groups, the ROS production and lipofuscin concentration in hop-1 mutant groups after 100 and 1000 μg/mL PS-NP treatment reduced by 15.2 and 13.0, and 7.3 and 6.1%, respectively (Figure A,B). These results suggested that presenilin genes sel-12 and hop-1 play a regulatory role in the neurotoxicity induced by PS-NPs.

Figure 4

Regulation of sel-12 and hop-1 on neurodevelopmental toxicity induced by NPs. WT, sel-12 (AR171), and hop-1 (LA62) mutant strains were treated with 1, 10, 100, and 1000 μg/L 50 nm PS-NP particles for 72 h, and then, (A) the expressions of sel-12 and hop-1, (B) body length, (C) head thrashes, and (D) body bends were detected. *p < 0.05 and **p < 0.01, compared with control groups; #p < 0.05, compared with WT groups.

Figure 5

Regulation role of sel-12 and hop-1 on oxidative damage induced by NPs. WT, sel-12 (AR171) and hop-1 (LA62) mutant strains were treated with 1, 10, 100, and 1000 μg/L 50 nm PS-NPs particles for 72 h, and then, (A) ROS production and (B) lipofuscin concentration were detected. #p < 0.05, compared with WT groups.

Conclusions

Different sizes (25, 50, and 100 nm) of PS-NPs were used in the present study to treat C. elegans, aiming to investigate the impact of particle size on PS-NP-induced neurodevelopmental toxicity. Measurement of body length, head thrashes, and body bending showed that PS-NPs exerted significant neurodevelopmental toxic effects in C. elegans in a dose-dependent manner. The severity of neurotoxicity was inversely related to particle sizes, which may be because of preferential cellular distribution and better polymerizing characteristic of smaller nanoparticles (25 nm). Similarly, PS-NPs dose-dependently induced ROS production, mitochondrial damage, and DA reduction in C. elegans, which was also influenced by particle sizes. In addition, PS-NP-induced lipofuscin accumulation and apoptosis were independent of particle size, suggesting the existence of other toxicological mechanisms besides the mitochondrial pathway. Furthermore, results of the mutant test showed that enhanced expression of sel-12 and hop-1 were involved in regulation of PS-NP-induced oxidative stress, mitochondrial damage, and neurodevelopmental toxicity in C. elegans.

Materials and Methods

Chemicals and Reagents

PS-NP beads (5% w/v) of three different sizes with good monodispersity were purchased from Janus New Materials Co. (Nanjing, China). AO and DCFH-DA were purchased from Beyotime Biotechnology (Shanghai, China). TRIzol reagents were obtained from Invitrogen (CA, USA). A Fast Quant RT kit was obtained from Tian Gen (Beijing, China). The SYBR Green PCR kit was purchased from Roche (Basel, Switzerland). All other reagents of analytical grade used in this study were purchased from Sigma (MO, USA).

Maintenance and Synchronization of C. elegans

All strains of C. elegans listed in Table were purchased from the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, MN, USA) and maintained in the standard nematode growth medium (NGM containing: NaCl 50 mM, peptone 2.5 g/L, agar 17 g/L, potassium phosphate 25 mM, CaCl2 1 mM, MgSO4 1 mM, and cholesterol 1.5 g/L). Nematodes were cultured on NGM agar plates seeded with Escherichia coliOP50 at 20 °C. For synchronization, gravid adult nematodes were treated with Clorox solution (5% NaOCl/1 M NaOH = 2:1, v/v) for 10 min, and then, the nematode suspensions were centrifuged at 2200 rpm for 2 min. The collected embryos were maintained on new NGM agar plates with E. coliOP50 at 20 °C.

Table 1

C. elegans Strains Used in This Studya

strain name	genotype description
WT	Bristol wild type
BZ555	transgenic GFP in DA neurons
PD4251	transgenic mitochondrial GFP
AR171	sel-12 mutant
LA62	hop-1 mutant

Note: GFP refers to green fluorescent proteins and DA refers to dopamine.

Exposure Test with PS-NP Particles

According to the results of our preliminary experiments, the stock solution (1 mg/mL) of PS-NP particles was diluted using K+ medium (NaCl 50 mM, KCl 32 mM, MgSO4 3 mM, CaCl2 3 mM, and cholesterol 1.5 g/L) into different working concentrations of 1, 10, 100, and 1000 μg/L. Nematodes at the L1 larvae period were exposed to PS-NP particles for 72 h. The control group was treated with K+ medium alone. Each experimental group included three parallels. After PS-NP exposure, nematodes were washed three times with K medium (NaCl 50 mM and KCl 32 mM) to prepare samples for toxicity evaluation.

Measurement of Growth and Locomotion Behaviors

Synchronized WT or transgenic nematodes at the L1 larval stage were exposed to PS-NPs at 20 °C for 72 h. After exposure, nematodes were immobilized by heat, and the body length of nematodes was measured with a microscope (Olympus BX51, Japan) and analyzed with ImageJ software.[47]

Head thrash and body bending were utilized as evaluating parameters for locomotion behaviors of nematodes. A head thrash is defined as one swing of nematode body, and a body bending refers to crawling of one wavelength.[48] After PS-NP exposure, C. elegans was transferred to the surface of fresh NGM, and the frequency of head thrash and body bending within 20 s were counted under a microscope (Olympus BX51, Japan). For each treatment group, at least 20 nematodes were randomly picked and examined from three independent experiments.

Detection of DA Content

The DA neurons of C. elegans BZ555 strain (dat-1:GFP) were labeled with a GFP, and the fluorescence intensity refers to the DA content in nematodes.[49] In brief, the BZ555 strain was exposed to PS-NPs for 72 h, then transferred to agar-padded (2%) slides, and anesthetized with levamisole solution (60 μm). The fluorescent images of immobilized nematodes were photographed with a microscope (Olympus BX51, Japan) and analyzed with ImageJ software.[50] At least 20 nematodes were randomly picked and examined for each concentration treatment.

Observation on Mitochondria-Associated Membranes

The GFP reporter C. elegans strain PD4251 strain contains both nuclear gfp-lacZ and mitochondrial gfp,[51] and interference of GFP signals in the cytoplasm reflects the alterations of mitochondria-associated membranes. In this study, the PD4251 strain was treated with different sizes of PS-NPs for 72 h and then transferred to agar-padded (2%) slides. Anesthesia, GFP fluorescence observation, and fluorescent intensity analysis were conducted as described above.

Oxidative Stress and Lipofuscin Analysis

Active oxygen radicals in C. elegans oxidize the nonfluorescent DCFH to fluorescent DCF, which can be used to determine the content of ROS. After treatment of PS-NPs for 72 h, nematodes were incubated with 10 μm of DCFH-DA diluted with K medium in the dark for 2 h. Then, nematodes were anesthetized with 60 μm of levamisole solution, and the fluorescence intensity was measured using the multifunctional microplate reader with an excitation wavelength at 488 nm and emission filter at 510 nm.[52−54]

Lipofuscin accumulation is used as a biomarker for cellular damage induced by oxidative stress.[36] For lipofuscin assessment, nematodes were exposed to PS-NPs for 72 h and washed three times with K medium. Then, nematodes were transferred to agar-padded (2%) slides and treated with 60 μm of levamisole solution. Images of immobilized nematodes were photographed with a microscope (Olympus BX51, Japan) and analyzed with ImageJ software.[50] At least 20 nematodes were randomly picked and examined for each concentration treatment.

AO Staining Analysis

The permeable dye AO can penetrate the live cell membranes and stain cell nuclei with uniform green fluorescence. For apoptotic cells, AO stains nuclei with dense and bright green dots because of the presence of apoptotic bodies. To detect the apoptosis of nematodes, nematodes exposed to PS-NPs for 72 h were incubated with AO (2 μg/mL) in K+ medium for 2 h in the dark. Then, nematodes were anesthetized with levamisole solution (60 μm), photographed with a microscope (Olympus BX51, Japan), and analyzed with ImageJ software.[50]

Real Time-Quantitative Polymerase Chain Reaction

After exposure, nematodes were washed three times with K medium, and then, TRIzol reagents were applied to extract total RNA. The quality and concentration of RNA were measured with a NanoDrop ND-2000 spectrophotometer (Agilent technology, US). RNA with a 1.8–2.0 value of OD260/OD280 was used to reversely transcribe cDNA according to the protocol of the Fast Quant cDNA kit. Subsequently, target genes were amplified with the StepOnePlus RT-qPCR kit.[54] The PCR primers shown in Table were synthesized and purchased from Generay (Shanghai, China). The expressions of target genes were quantified using the ΔΔC method and normalized to internal reference actin. For every gene, three replicates were set up for each treatment condition group.

Table 2

Primer Sequences for RT-qPCR

gene name	primer	primer sequence (5′–3′)
sel-12	forward	AGACAGTATCGTTGAGAAGG
	reverse	AAGACCAGAGCCATTAGTG
hop-1	forward	GCCAGAACAACAAGAACAAT
	reverse	GTCAGAACAGCAACAATATCC
actin	forward	GGCATCACACCTTCTACA
	reverse	TGACACCATCTCCAGAGT

Statistical Analysis

Data were expressed in the form of arithmetic mean ± standard deviation (mean ± SD) and analyzed using SPSS (13.0) software. Experimental image data were analyzed using ImageJ software. The data results among groups were compared by one-way ANOVA with the Post Hoc test. A p value less than 0.05 was considered to be statistically significant.