Dan Zhang1, Xixi Wang1, Yang Ye1, Yu He1, Fuqiang He1, Yongqiang Tian2, Yunzi Luo3, Shufang Liang1. 1. State Key Laboratory of Biotherapy and Cancer Center, Collaborative Innovation Center for Biotherapy, West China Hospital, Sichuan University, Chengdu, 610041, China. 2. Key Laboratory of Leather Chemistry and Engineering, Ministry of Education and College of Light Industry, Textile and Food Engineering, Sichuan University, Chengdu, 610065, China. 3. Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin, 300072, China.
Abstract
Daptomycin (DAP) is a novel microbial lipopeptide antibiotic synthesized by the DAP biosynthetic gene cluster dpt of Streptomyces roseosporus (S. roseosporus). DptP gene locates upstream of dpt and confers DAP resistance to Streptomyces ambofaciens (S. ambofaciens). So far, the biological functions of dptP gene for S. roseosporus growth are still completely uncovered. We performed label-free quantification proteomic dissections with loss- and gain-of-function experiments to decipher dptP-involved functions. Deletion of dptP gene activated energy metabolism and metabolism of secondary metabolites pathways and enhanced the transcription levels and protein abundance of key members of the dpt cluster. Whereas dptP deletion inhibited transport/signal transduction and drug resistance pathways and protein abundance of cell division-relative proteins, subsequently decreased mycelia cell growth rate. S. roseosporus strain with dptP deletion was more sensitive to DAP treatment compared to the wild type. In contrast, overexpression of dptP gene decreased transcription levels of DAP biosynthetic genes and enhanced growth rate of Streptomcyes strain upon elevated culture temperature and DAP supplementation. Taken together, dptP gene contributes to Streptomcyes primary growth under elevated temperature and DAP treatment, whereas it plays negative roles on metabolism of secondary metabolites and transcription of DAP biosynthetic genes.
Daptomycin (n class="Chemical">DAP) is a novel microbial lipopeptide antibiotic synthesized by the DAP biosynthetic gene clusterdpt of Streptomyces roseosporus (S. roseosporus). DptP gene locates upstream of dpt and confers DAP resistance to Streptomyces ambofaciens (S. ambofaciens). So far, the biological functions of dptP gene for S. roseosporus growth are still completely uncovered. We performed label-free quantification proteomic dissections with loss- and gain-of-function experiments to decipher dptP-involved functions. Deletion of dptP gene activated energy metabolism and metabolism of secondary metabolites pathways and enhanced the transcription levels and protein abundance of key members of the dptcluster. Whereas dptP deletion inhibited transport/signal transduction and drug resistance pathways and protein abundance of cell division-relative proteins, subsequently decreased mycelia cell growth rate. S. roseosporus strain with dptP deletion was more sensitive to DAP treatment compared to the wild type. In contrast, overexpression of dptP gene decreased transcription levels of DAP biosynthetic genes and enhanced growth rate of Streptomcyes strain upon elevated culture temperature and DAP supplementation. Taken together, dptP gene contributes to Streptomcyes primary growth under elevated temperature and DAP treatment, whereas it plays negative roles on metabolism of secondary metabolites and transcription of DAP biosynthetic genes.
A lot of microbial natural products are significant drug candidates for treatment of bacterial infections, n class="Disease">viral infections and other diseases (Butler et al., 2014; Li et al., 2019). Streptomycetaceae family produces various druggable secondary metabolites (Xu and Wright, 2019; Zhu et al., 2011), including anti‐infection antibiotics. As reservoirs for natural products, Streptomyces strains are widely engineered to improve the yield of target products (Ke and Yoshikuni, 2019; Tao et al., 2018). Daptomycin (DAP), a bioactive lipopeptide synthesized by a non‐ribosomal peptide synthetase (NRPS) gene clusterdpt (GenBank: AY787762.1) of S. roseosporus (Fig. 1A) (Debono et al., 1987; Miao et al., 2005), has high‐efficiency antibacterial activities against Gram‐positive bacteria (Akins and Rybak, 2001; Robbel and Marahiel, 2010). The trademark of DAP drug, namely Cubicin (®) (Cubist Pharmaceuticals Inc., Lexington, MA, USA), was approved for treatment of skin and skin structure infections induced by Gram‐positive bacteria (Arbeit et al., 2004; Ye et al., 2019).
Fig. 1
Alignment comparisons of dptP‐encoding DptP protein with DedA family proteins from other species.
A. The constitution of DAP biosynthetic gene cluster dpt. The dptP gene was presented in purple.
B. The amino acid similarity comparisons of S. roseosporus DptP with the DedA family protein of S. exfoliatus. Four transmembrane (TM) domains were highlighted in red font and grey background. SE: S. exfoliates.
C. Multisequence alignment for DptP from S. roseosporus and DedA family proteins from other species by MEGA software. The conserved motifs, F/YxxxR/K and GxxxM/VxxxxF/Y, were highlighted in orange background. Highly conserved glycine (G), acidic amino acids (E), basic amino acids (R) were highlighted in purple background. The TM domains were highlighted in grey background. SR: S. roseosporus. SF: S. fradiae. SP: Streptomyces sp. YIM 130001.
D. The phylogenetic tree analysis of S. roseosporus DptP and DedA family proteins from other Streptomyces species using MEGA software. Numbers on the branches are bootstrap values obtained from neighbour‐joining method. Branch length represents the variation (genetic distance) of evolutionary branches as number. Scale bar indicates the branch length.
Alignment comparisons of dptP‐encoding n class="Chemical">DptP protein with DedA family proteins from other species.
A. The constitution of DAP biosynthetic gene n class="Species">cluster dpt. The dptP gene was presented in purple.
B. The amino acid similarity comparisons of S. roseosporus DptP with the DedA family protein of S. exfoliatus. Four transmembrane (TM) domains were highlighted in red font and grey background. SE: S. exfoliates.C. Multisequence alignment for DptP from S. roseosporus and DedA family proteins from other species by MEGA software. The conserved motifs, F/YxxxR/K and GxxxM/VxxxxF/Y, were highlighted in orange background. Highly conserved n class="Chemical">glycine (G), acidic amino acids (E), basic amino acids (R) were highlighted in purple background. The TM domains were highlighted in grey background. SR: S. roseosporus. SF: S. fradiae. SP: Streptomyces sp. YIM 130001.
D. The phylogenetic tree analysis of S. roseosporus DptP and DedA family proteins from other n class="Species">Streptomyces species using MEGA software. Numbers on the branches are bootstrap values obtained from neighbour‐joining method. Branch length represents the variation (genetic distance) of evolutionary branches as number. Scale bar indicates the branch length.
The subunits of NRPS of DAP are encoded by three core biosynthetic genes, including n class="Chemical">dptA, dptBC and dptD. The upstream transport‐related genes dptM and dptN encode ATP‐binding and membrane spanning components of ATP‐binding cassette (ABC) transporters (R.H., 2008). DptE and dptF play roles in coupling fatty acids to N‐terminal Trp residue (Wittmann et al., 2008). The downstream regulatory genes dptR1 and dptR2 and upstream regulatory gene dptR3 are responsible for DAP biosynthesis (Wang et al., 2014; Zhang et al., 2015). The dptP gene locates upstream of the dpt gene cluster (Fig. 1A), and it is indicated to confer DAP resistance to Streptomyces ambofaciens (S. ambofaciens) (Alexander et al., 2004). Moreover, dptP‐encoding protein is predicted to block the antibacterial activity of DAP and A54145 by directly interacting with acidic DAP for its basicity (Baltz et al., 2008; Baltz et al., 2005). However, there still lacks a comprehensive understanding of dptP functions. It is unclear whether and how dptP plays roles in biological processes excepting for DAP resistance in Streptomyces strains.
Proteomics technology contributes to new antibiotic discovery and pathway elucidation (Bordoloi et al., 2016; Machado et al., 2017). Protein levels are commonly correlated with the levels of metabolites (Gubbens et al., 2014; Chen et al., 2017). Thus, proteomics techniques based on mass spectrometry (MS) facilitate discoveries of gene clusters and pathway elucidations for valuable compounds. The label‐free quantification (LFQ) is a liquid chromatography − tandem mass spectrometry (LC‐MS/MS) based quantitative proteomics approach without high cost of the reagents and incomplete labelling (Zhu et al., 2010). Additionally, LFQ is suitable for rapid identification and quantitation of specific proteins in one group (Toymentseva et al., 2020). Thus, LFQ is widely applied to compare differences between two or among several groups.In this study, we combined LFQ proteomics technology and CRISPR‐Cas9 tool to further explore n class="Chemical">dptP‐mediated multiple functions in S. roseosporus. DptP‐induced changes in proteome profiling of S. roseosporus were identified by LFQ proteomics, which demonstrated dptP‐encoding protein DptP and a series of altered strain proteins played positive roles in transport/signal transduction pathway and drug resistance, and negative roles in energy metabolism pathway and metabolism of secondary metabolites pathway. Furthermore, dptP was confirmed to contribute to growth tolerance upon elevated temperature and DAP accumulation through loss‐ and gain‐of‐function validations in S. roseosporus. Our results have supported and provided solid evidences to complement the previous conclusion obtained by Dr. Alexander (Alexander et al., 2004). We have applied LFQ proteomics in combination with CRISPR‐Cas9 technologies to dissect biochemical functions of dptP. The strategies used in this report provide references for the follow‐up study on other genes of dpt gene cluster and metabolic pathway optimization for S. roseosporus.
Results
Bioinformatics prediction of dptP‐encoding protein
The dptP‐encoding proteinn class="Chemical">DptP with 206 amino acids (aa) shares a 91.75% sequence identity with the DedA family protein of Streptomyces exfoliates (accession no. WP_030556220.1) and contains 4 transmembrane domains (Fig. 1B). DedA family proteins consist of 8 members, including YqjA, YghB, YabI, YohD, YqaA, YdjX, YdjZ and DedA (Boughner and Doerrler, 2012), typically range from 200 to 250 aa and play roles in cell division, temperature sensitivity and drug resistance (Boughner and Doerrler, 2012; Doerrler et al., 2013; Kumar and Doerrler, 2015, 2014).
Considering DptP similarity with DedA family member, we compared the aa sequences of n class="Chemical">DptP protein with several DedA family proteins from other Streptomyces strains through alignment comparison. DptP shares 32.85% and 36.84% identities to the 228‐aa YqjA of Streptomyces jeddahensis and 215‐aa YghB of Streptomyces sp. YIM 130001 separately. DptP exhibits notable features of the DedA family proteins (Doerrler et al., 2013), including several highly conserved glycine residues and two prominent conserved sequence motifs, GxxxM/VxxxxF/Y and F/YxxxR/K (Fig. 1C) . Moreover, the evolutionary relationship indicates DptP of S. roseosporus and YghB of Streptomyces sp. YIM 130001 are clustered together in the phylogenetic tree (Fig. 1D), which indicates DptP is likely to be closer related to Streptomyces YghB protein in biological functions.
.
To further investigate the roles of dptP gene, most of the sequences of n class="Chemical">dptP gene from the 25th nucleotide to 556th nucleotide were deleted from S. roseosporus genome by an effective editing tool Streptococcus pyogenes CRISPR‐Cas9 (Cobb et al., 2015; Wang et al., 2016), which resulted in a complete destruction of dptP gene and loss of its functions. Two spacers were selected to guide the CRISPR‐Cas9. The dptP‐deletion plasmid pCM2‐dptP carried a sgRNA cassette with a configuration of gapdh (EL)‐spacer 1‐T7‐ gapdh (EL)‐spacer 2‐oop and an editing template (Fig. 2A). The double‐strand break (DSB) caused by CRISPR‐Cas9 was repaired by the editing template via homology‐directed repair (HDR) (Fig. 2B). We randomly picked up 6 single colonies to validate dptP deletion via PCR. The efficiency of dptP deletion reached to 6/6 (Fig. 2C). PCR product from exconjugant 1 was subsequently sequenced, and the sequences were completely matched the upstream 248‐bp and downstream 308‐bp sequences near dptP (Fig. 2D, Fig. S1).
Fig. 2
CRISPR‐Cas9‐mediated dptP gene deletion in S. roseosporus.
A. The CRISPR‐Cas9 system includes a pSG5, acc(3)IV, Cas9, sgRNA cassette and an editing template. The sgRNA cassette includes two spacers, including spacer 1 controlled by gapdh (EL) promoter and terminated by T7 terminator and spacer 2 controlled by gapdh (EL) promoter and terminated by oop terminator.
B. Schematic of CRISPR‐Cas9‐mediated dptP gene deletion. The editing template with a 931‐bp upstream genome fragment and a 1035‐bp downstream genome fragment near dptP is used to repair the double‐strand break (DSB) cut by Cas9 via homology‐directed repair (HDR). Primers P1 and P2 are used to perform PCR to check the deletion of dptP gene. Primer P1 locates upstream 248 bp far away from the deletion region. Primer P2 locates downstream 308 bp far away from the deletion region.
C. PCR evaluation for dptP gene deletion in S. roseosporus. Six single colonies (No.1‐6) were randomly chosen to evaluate dptP deletion by PCR with primers P1 and P2. DptP‐deletion strains generated 556‐bp amplicons, and WT strain generated a 1098‐bp amplicon.
D. DNA sequencing profiling of the 556‐bp PCR fragment amplified from dptP‐deletion strain. Partial upstream 248‐bp sequences and downstream 308‐bp sequences of deletion region were presented.
CRISPR‐Cas9‐mediated n class="Chemical">dptP gene deletion in S. roseosporus.
A. The CRISPR‐Cas9 system includes a pSG5, acc(3)IV, n class="Gene">Cas9, sgRNA cassette and an editing template. The sgRNA cassette includes two spacers, including spacer 1 controlled by gapdh (EL) promoter and terminated by T7 terminator and spacer 2 controlled by gapdh (EL) promoter and terminated by oop terminator.
B. Schematic of CRISPR‐Cas9‐mediated n class="Chemical">dptP gene deletion. The editing template with a 931‐bp upstream genome fragment and a 1035‐bp downstream genome fragment near dptP is used to repair the double‐strand break (DSB) cut by Cas9 via homology‐directed repair (HDR). Primers P1 and P2 are used to perform PCR to check the deletion of dptP gene. Primer P1 locates upstream 248 bp far away from the deletion region. Primer P2 locates downstream 308 bp far away from the deletion region.
C. PCR evaluation for dptP gene deletion in S. roseosporus. Six single colonies (No.1‐6) were randomly chosen to evaluate n class="Chemical">dptP deletion by PCR with primers P1 and P2. DptP‐deletion strains generated 556‐bp amplicons, and WT strain generated a 1098‐bp amplicon.
D. DNA sequencing profiling of the 556‐bp PCR fragment amplified from dptP‐deletion strain. Partial upstream 248‐bp sequences and downstream 308‐bp sequences of deletion region were presented.
DptP‐induced differential expression proteins were identified by LFQ proteomics
To have an insight into the roles of dptP gene on biosynthetic pathways, we detected the whole proteome changes under n class="Chemical">dptP deletion using LFQ proteomics strategy based on LC‐MS/MS with three technical replicates and three biological replicates (Fig. S2A). In total, 2313 proteins were identified in WT group, from which 2076 proteins were both identified in ΔdptP and WT group (Fig. S2B, Dataset S1A,B).
The wild‐type (WT) S. roseosporus and dptP‐deletion (Δn class="Chemical">dptP) S. roseosporus showed no significant difference on growth rate at 30°C, which ensured the differential expression proteins were indeed induced by dptP loss instead of strain growth difference. Among the 2076 proteins identified in both strains, 101 proteins in the ΔdptP group showed significantly increased abundance (PSIA) (with a fold difference of > + 2.0, P < 0.05), and 71 proteins showed significantly decreased abundance (PSDA) (fold difference of < −2.0, P < 0.05) (Fig. 3A, Dataset S1C,D). Additionally, 237 proteins were absent in the ΔdptP group due to dptP deletion (Dataset S1E). The multiscatter blot and the heatmap indicated a high degree of similarity among the biological replicates (Fig. S2C).
Fig. 3
Proteins with differential abundance between S. roseosporus WT and ΔdptP groups.
A. Volcano plot was generated from pairwise comparisons between WT and ΔdptP groups. Dashed lines represented the applied thresholds (ANOVA P value of < 0.05 and fold difference of > + 2.0 or < ‐ 2.0). The proteins presented in blue, red or black indicated the PSDA, PSIA or the proteins with no significant difference.
B–D. GO analysis for the PSDA, PSIA and AP due to dptP deletion. PSDA: proteins with statistically decreased abundance, PSIA: proteins with statistically increased abundance, AP: absent proteins in ΔdptP group.
Proteins with differential abundance between S. roseosporus WT and ΔdptP groups.A. Volcano plot was generated from pairwise comparisons between WT and ΔdptP groups. Dashed lines represented the applied thresholds (ANOVA P value of < 0.05 and fold difference of > + 2.0 or < ‐ 2.0). The proteins presented in blue, red or black indicated the PSDA, PSIA or the proteins with no significant difference.B–D. GO analysis for the PSDA, PSIA and AP due to dptP deletion. PSDA: proteins with statistically decreased abundance, PSIA: proteins with statistically increased abundance, AP: absent proteins in Δn class="Chemical">dptP group.
DptP‐mediated differential expression proteins are involved in primary and secondary metabolisms
To further investigate dptP‐mediated changes in biochemical molecular activities, we performed gene ontology (GO) analysis on all differentially expressed proteins (with a fold difference of < – 2.0 or > + 2.0, P < 0.05), including 101 PSIA (Dataset S1C), 71 PSDA (Dataset S1D) and 241 proteins absent in Δn class="Chemical">dptP group (Dataset S1E). The top 4 activities for the PSDA, PSIA and AP proteins are involved in catalytic, binding, transporter and transcription factor activities (Fig. 3B–D), which indicates dptP is involved in both primary and secondary metabolisms of S. roseosporus.
KEGG pathway analysis of 172 proteins with statistically altered abundance (with a fold difference of < – 2.0 or > + 2.0, P < 0.05) was carried out to assess dptP involvement in metabolism pathways. Both PSIA and PSDA were involved inn class="Chemical">carbohydrate metabolism, energy metabolism, amino acid metabolism, transport/signal transduction, genetic information processing, lipid metabolism and nucleotide metabolism (Fig. 4A,B). According to the KEGG enrichment plots, the downregulated KEGG pathways mainly included carbohydrate metabolism, amino acid metabolism, transport/signal transduction, nucleotide metabolism, lipid metabolism and drug resistance (Fig. 4C). Moreover, the Zscores was introduced to quantitatively evaluate the dptP‐involved pathways (Liu et al., 2020), and similar conclusions were obtained as the KEGG analysis. For instance, the Zscore of transport/signal transduction pathway was −7.29, which indicated a significant inhibition of this pathway due to dptP loss. On the contrary, several other pathways including energy metabolism, genetic information processing and metabolism of secondary metabolites were activated in response to dptP deletion (Fig. 4C). Notably, the Zscores of energy metabolism pathway and metabolism of secondary metabolites pathway were 5.76 and 4.89 respectively. This indicated energy metabolism and metabolism of secondary metabolites pathways seemed to be significantly activated since dptP loss. Generally, dptP plays positive roles in transport/signal transduction and drug resistance pathways, while it has negative roles in energy metabolism and metabolism of secondary metabolites pathways.
Fig. 4
KEGG analyses of all differential proteins.
A,B. KEGG enrichment for PSIA and PSDA. PSDA: proteins with statistically decreased abundance, PSIA: proteins with statistically increased abundance.
C. The KEGG enrichment plots for PSIA and PSDA. On the left side, the protein IDs and their corresponding values of log2FC were displayed in order from top to bottom. On the top, the values of log2FC are greater than 2 (red), and a larger log2FC indicates a greater difference of increased abundance. On the bottom, the values of log2FC are less than −2 (blue), and a smaller log2FC means a greater difference of decreased abundance. Nine significantly enriched pathways and their Zscores were shown on right side of the figure. When Zscore was less than zero, this pathway is more likely to be inhibited. Conversely, the pathway is more likely to be activated if Zscore value above zero.
KEGG analyses of all differential proteins.A,B. KEGG enrichment for PSIA and PSDA. PSDA: proteins with statistically decreased abundance, PSIA: proteins with statistically increased abundance.C. The KEGG enrichment plots for PSIA and PSDA. On the left side, the protein IDs and their corresponding values of log2FC were displayed in order from top to bottom. On the top, the values of log2FC are greater than 2 (red), and a larger log2FC indicates a greater difference of increased abundance. On the bottom, the values of log2FC are less than −2 (blue), and a smaller log2FC means a greater difference of decreased abundance. Nine significantly enriched pathways and their Zscores were shown on right side of the figure. When Zscore was less than zero, this pathway is more likely to be inhibited. Conversely, the pathway is more likely to be activated if Zscore value above zero.We constructed a Flag‐tag‐expression plasmid pSET152‐kasOp*‐dptP to introduce into S. roseosporus for observation of gain‐of‐function of n class="Chemical">dptP overexpression. The exogenous dptP gene within the kasOp*‐dptP‐Flag cassette was controlled by a constitutive strong promoter kasOp* (Wang et al., 2013) (Fig. 5A), which was designed to overexpress the C‐terminally Flag‐tagged DptP protein. The plasmid pSET152‐kasOp*‐dptP was confirmed to successfully insert into genome of S. roseosporus by PCR evaluation and sequencing (Fig. 5B–D, Fig. S2).
Fig. 5
Overexpression of dptP gene in S. roseosporus.
A. Schematic overview of pSET152‐kasOp*‐dptP plasmid. The elements of oriT, traJ, φC31 and attP site help plasmid transfer to recipient host and integrate into host genome. The kasOp*‐dptP‐Flag cassette is composed of a constitutive strong promoter kasOp* and a dptP gene with a C‐terminal Flag tag.
B,C. The integration of kasOp*‐dptP‐Flag cassette into the genome of S.roseosporus or S.ambofaciens by PCR evaluation. The 745‐bp kasOp*‐dptP‐Flag fragment was amplified from the recombinant genome DNA of S. roseosporus or S.ambofaciens with primers P3 and P4. P3 locates in kasOp*, which is absent in WT or ∆dptP genome.
D. Sequencing data of the 745‐bp product. Partial sequences of kasOp*, dptP gene and Flag tag were shown in the sequencing map.
E,F. Evaluation of expression level of exogeneous dptP gene (E) and its encoding Flag‐tagging DptP protein (F) in S. roseosporus or S. ambofaciens by RT‐qPCR and Western blot. SR: S. roseosporus; Sa: S. ambofaciens. pSET152/SR and pSET152/Sa represent the S. roseosporus strain and S. ambofaciens strain harbouring pSET152 respectively. pSET152‐dptP/SR and pSET152‐dptP/Sa represent the S. roseosporus and S. ambofaciens harbouring pSET152‐kasOp*‐dptP respectively. *** represents P < 0.001. The anti‐Flag antibody was used to detect the Flag‐tagging DptP protein by Western blot.
G. Cell localization of DptP protein. Membrane and cytoplasm fractions were detected using Western blot with anti‐Flag antibody separately. The Flag‐tagging DptP protein in the form of a 42‐kDa dimer was detectable mainly in membrane fractions. MP: Membrane protein. CP: cytoplasm protein. The experiment was performed in triplicate.
Overexpression of dptP gene in S. roseosporus.A. Schematic overview of pSET152‐kasOp*‐dptP plasmid. The elements of oriT, traJ, φC31 and attP site help plasmid transfer to ren class="Disease">cipient host and integrate into host genome. The kasOp*‐dptP‐Flag cassette is composed of a constitutive strong promoter kasOp* and a dptP gene with a C‐terminal Flag tag.
B,C. The integration of kasOp*‐dptP‐Flag cassette into the genome of n class="Species">S.roseosporus or S.ambofaciens by PCR evaluation. The 745‐bp kasOp*‐dptP‐Flag fragment was amplified from the recombinant genome DNA of S. roseosporus or S.ambofaciens with primers P3 and P4. P3 locates in kasOp*, which is absent in WT or ∆dptP genome.
D. Sequencing data of the 745‐bp product. Partial sequences of kasOp*, dptP gene and Flag tag were shown in the sequencing map.E,F. Evaluation of expression level of exogeneous dptP gene (E) and its encoding Flag‐tagging n class="Chemical">DptP protein (F) in S. roseosporus or S. ambofaciens by RT‐qPCR and Western blot. SR: S. roseosporus; Sa: S. ambofaciens. pSET152/SR and pSET152/Sa represent the S. roseosporus strain and S. ambofaciens strain harbouring pSET152 respectively. pSET152‐dptP/SR and pSET152‐dptP/Sa represent the S. roseosporus and S. ambofaciens harbouring pSET152‐kasOp*‐dptP respectively. *** represents P < 0.001. The anti‐Flag antibody was used to detect the Flag‐tagging DptP protein by Western blot.
G. Cell localization of DptP protein. Membrane and cytoplasm fractions were detected using Western blot with anti‐Flag antibody separately. The Flag‐tagging n class="Chemical">DptP protein in the form of a 42‐kDa dimer was detectable mainly in membrane fractions. MP: Membrane protein. CP: cytoplasm protein. The experiment was performed in triplicate.
Subsequently, the transcription analysis showed that the relative expression level of dptP gene had a 468‐fold enhancement inn class="Chemical">dptP‐overexpressing S. roseosporus (abbreviate as OP strain in the following sections) (Fig. 5E). Meanwhile, the plasmid was also transferred to S. ambofaciens ATCC 23877, a DAP‐susceptible actinomycete, to detect gain‐of‐functions of the exogenous dptP inducement (Fig. 5C). Total strain proteins were extracted to detect DptP protein using anti‐Flag antibody, which indicated the DptP protein fused with C‐terminal Flag was successfully expressed in S. roseosporus and S. ambofaciens (Fig. 5F). Moreover, we separated membrane proteins from the cytoplasm proteins in S. roseosporus according to cell membrane extraction procedures (Cheng and Li, 2014) to determine cellular localization of DptP protein. The exogenous DptP protein was mainly detected in the form of a 42‐kDa dimer in membrane fractions (Fig. 5G), which supported our prediction that DptP protein is a membrane protein.
DptP exhibits negative effects on gene transcriptional level for members of dpt gene cluster
GO analyses revealed that a series of proteins were involved in catalytic (e.g. DptD), transporter (e.g. ammonium transporter) and regulator (e.g. n class="Chemical">AdpA, DptR2) activities. Among the PSIA enriched in catalytic activity, several proteins were responsible for the DAP biosynthesis. For instance, DptD, DptE and DptG showed notable increase of 3.49, 3.91 and 4.46 times respectively (Table 1).
Table 1
Increased proteins resulted from dptP deletion in DAP biosynthetic gene cluster of S. roseosporus.
Increased proteins resulted from dptP deletion in n class="Chemical">DAP biosynthetic gene cluster of S. roseosporus.
ND, means not detected.Significant change. + represents increased fold difference.To further elaborate the proteomic data, we compared the transcriptional changes of those gene members related to DAP biosynthesis in WT, Δn class="Chemical">dptP and OP strains. Twelve genes were analysed, including biosynthetic genes (dptA, dptBC, dptD, dptE, dptF, dptG), transport‐related genes (dptM, dptN) and regulatory gene (dptR1, dptR2, dptR3). As results, the transcription levels of all biosynthetic genes, including dptA, dptBC, dptD, dptE, dptF and dptG and regulatory gene dptR2 were significantly increased due to dptP deletion (Fig. 6). On the contrary, the biosynthetic genes, dptA, dptBC, dptD, dptE and dptF, showed reduced transcription levels in response to dptP overexpression, while the transport‐related dptM exhibited a markedly increased transcription level in OP strain (Fig. 6). All these data were consistent with the above proteomic conclusions that dptP deletion led to an activation of metabolism of secondary metabolites pathway and an inhibition of transport/signal transduction pathway.
Fig. 6
Relative transcript levels of 12 gene members belonging to the dpt gene cluster. The relative transcript level of each gene was obtained after normalization against the internal reference hrdB. WT: wild‐type S. roseosporus, ΔdptP: dptP‐deletion S. roseosporus, OP: dptP‐overexpressing S. roseosporus. The experiment was performed in triplicate.
Relative transcript levels of 12 gene members belonging to the dpt gene n class="Species">cluster. The relative transcript level of each gene was obtained after normalization against the internal reference hrdB. WT: wild‐type S. roseosporus, ΔdptP: dptP‐deletion S. roseosporus, OP: dptP‐overexpressing S. roseosporus. The experiment was performed in triplicate.
DptP gene is essential for strain growth under elevated temperature
The proteome data showed that dptP deletion resulted in a significant decrease or loss of three proteins that were associated with cell division and DNA replication, including SepF1 (with a decreased level of 5.42 folds, P < 0.05), SepF3 and RecF (loss in Δn class="Chemical">dptP group) (Dataset S1D,E, Fig. 7A‐C). It is well known that DedA family protein YghB is essential for cell division at elevated temperature (Sujeet and William, 2014). Similar to the YghB within the phylogenetic tree relations (Fig. 1D), DptP was indicated to be important for strain growth.
Fig. 7
MS/MS spectra of three dptP‐deletion‐mediated differential proteins related to cell division. The blue b ion indicates the ion reading from N‐terminal to C‐terminal of each peptide. The subscript number and bottom digits of b ion labelling the peak represent the number of N‐terminal amino acids and their total molecular weight. Similarly, the red y ion indicates the ion reading from C‐terminal to N‐terminal. The subscript number and bottom digits of y ion present the number of C‐terminal amino acids and their total molecular weight. The sequences of each peptide are calculated based on the b ions and y ions and their molecular weights. The letters on the top of each figure mean the single letter codes for the amino acids identified by MS. W9FQ99 (A) is a cell division protein SepF3. W9FQN6 (B) is a DNA replication and repair protein RecF. W9G0F8 (C) is a cell division protein SepF3.
MS/MS spectra of three dptP‐deletion‐mediated differential proteins related to cell division. The blue b ion indicates the ion reading from N‐terminal to C‐terminal of each n class="Chemical">peptide. The subscript number and bottom digits of b ion labelling the peak represent the number of N‐terminal amino acids and their total molecular weight. Similarly, the red y ion indicates the ion reading from C‐terminal to N‐terminal. The subscript number and bottom digits of y ion present the number of C‐terminal amino acids and their total molecular weight. The sequences of each peptide are calculated based on the b ions and y ions and their molecular weights. The letters on the top of each figure mean the single letter codes for the amino acids identified by MS. W9FQ99 (A) is a cell division protein SepF3. W9FQN6 (B) is a DNA replication and repair protein RecF. W9G0F8 (C) is a cell division protein SepF3.
To directly analyze the effects of dptP on strain growth, we measured the growth rates of WT, Δn class="Chemical">dptP and OP strains grown at permissive 30°C and non‐permissive 37°C. When grew at 30°C, the growth rates were similar among three groups (Fig. 8A). But the growth rates among the three groups showed significant differences after cultivation for 3 days at 37°C (Fig. 8B). Compared to the WT and ΔdptP strains, the OP strain was proven to survive and grow upon the unconventional cultivation temperature at 37°C. Namely, dptP gene is required for the growth rate of S. roseosporus at elevated culture temperature.
Fig. 8
Growth rates of S. roseosporus WT, ΔdptP and OP strains under different conditions were measured by diphenylamine colorimetric method.
A,B. Growth rates of S. roseosporus WT, ΔdptP and OP at 30 or 37°C. The spores were inoculated in MYG medium to culture at 30 or 37°C for 5 days.
C,D. Growth rates of S. roseosporus WT (C) and S. ambofaciens (D) upon 0.1‐1mg/mL DAP incubation at 30°C. The absorbance at 595 nm (A595) was measured at the cultivation time of 1‐6 d.
E–G. Growth rates of S. roseosporus WT, ΔdptP and OP and S. ambofaciens harbouring plasmid pSET152 or pSET152‐kasOp*‐dptP upon DAP incubation at 30°C. WT + DAP, ΔdptP + DAP, and OP + DAP: the wild‐type, dptP‐deletion and dptP‐overexpression S. roseosporus were treated with 0.5 mg ml‐1 DAP respectively. pSET152/Sa + DAP and pSET152‐dptP/Sa + DAP: S. ambofaciens strains harbouring plasmid pSET152 or pSET152‐kasOp*‐dptP were treated with 0.2 mg ml‐1 DAP.
F–H. Densities of the strains upon DAP treatment for 6 days at 30°C. Density = number of C.F.U. ml‐1. The culture for each Streptomyces strain from (E) or (G) at incubation time of 6 days was diluted and streaked on M‐ISP4 plate, and grown at 30°C for 3–4 days respectively. Then, the C.F.U. presented on each plate was counted. The experiment was performed in triplicate.
Growth rates of S. roseosporus WT, ΔdptP and OP strains under different conditions were measured by n class="Chemical">diphenylamine colorimetric method.
A,B. Growth rates of S. roseosporus WT, ΔdptP and OP at 30 or 37°C. The spores were inoculated inn class="Chemical">MYG medium to culture at 30 or 37°C for 5 days.
C,D. Growth rates of S. roseosporus WT (C) and S. ambofaciens (D) upon 0.1‐1mg/mL DAP incubation at 30°C. The absorbance at 595 nm (A595) was measured at the cultivation time of 1‐6 d.E–G. Growth rates of S. roseosporus WT, ΔdptP and OP and S. ambofaciens harbouring plasmid pSET152 or pSET152‐kasOp*‐n class="Chemical">dptP upon DAP incubation at 30°C. WT + DAP, ΔdptP + DAP, and OP + DAP: the wild‐type, dptP‐deletion and dptP‐overexpression S. roseosporus were treated with 0.5 mg ml‐1 DAP respectively. pSET152/Sa + DAP and pSET152‐dptP/Sa + DAP: S. ambofaciens strains harbouring plasmid pSET152 or pSET152‐kasOp*‐dptP were treated with 0.2 mg ml‐1 DAP.
F–H. Densities of the strains upon DAP treatment for 6 days at 30°C. Density = number of C.F.U. ml‐1. The culture for each n class="Species">Streptomyces strain from (E) or (G) at incubation time of 6 days was diluted and streaked on M‐ISP4 plate, and grown at 30°C for 3–4 days respectively. Then, the C.F.U. presented on each plate was counted. The experiment was performed in triplicate.
DptP contributes to mycelia growth of Streptomyces under DAP exposure
As we mentioned in our proteomic analysis, transport/signal transduction pathway and drug resistance pathway were significantly inhibited upon dptP deletion (Fig. 4C, Dataset S1C–E). Besides, previous work has shown that YghB is required for proton‐motive‐force drug resistance inn class="Species">E. coli (Sujeet and William, 2014). Thus, we also detected the roles of dptP against DAP tolerance. Wild‐type S. roseosporus and S. ambofaciens had a growth arrest upon 0.5 and 0.2 mg ml‐1 DAP incubation at 30°C respectively (Fig. 8C‐D).
Furthermore, we compared the growth rates of the dptP‐overexpression strain, n class="Chemical">dptP‐deletion strain and their wild types under DAP treatment at 30°C. When exposure to 0.5 mg ml‐1 DAP, the growth rate of ΔdptP strain presented a prominent reduce at 30°C compared to the WT strain since the 4th day (Fig. 8E). In contrast, the growth rate of DptP‐overexpressing S. roseosporus strain (Fig. 8E) was improved since the 4th day compared to the growth rate of WT strain in MYG media containing 0.5 mg ml‐1 DAP. To further have an insight into the changes on mycelia density, we measured the mycelia densities of Streptomyces species after DAP treatment for 6 days (density = number of cell forming units (C.F.U) ml‐1). Six days later, the mycelia were diluted to 10 000 times with MYG and spread on R2YE plates. There were 1.93 × 106 C.F.U. for WT at 30°C, which were much more than those for ΔdptP and much less than those for OP (Fig. 8F). Similarly, dptP‐overexpressing S. ambofaciens showed an increased growth rate and generated more C.F.U. than S. ambofaciens WT under 0.2 mg ml‐1 DAP treatment (Fig. 8G‐H). It was indicated that dptP gene contributed to mycelia growth under DAP exposure. Our results supported the previous work reported by Alexander (Alexander et al., 2004).
Discussion
It has been observed that biosynthetic genes, regulatory genes, transport‐related genes are generally associated with DAP biosynthesis. In this study, we applied CRISPR‐n class="Gene">Cas9 and LFQ proteomics technologies with loss‐ and gain‐of‐function experiments to understand dptP functions on growth rate and metabolisms of S. roseosporus. We have confirmed that dptP gene plays positive roles on mycelia growth rate upon elevated temperature and DAP exposure. On the other hand, dptP exhibits negative roles on the transcription of gene members belonging to the dpt gene cluster.
Proteomics technology provides a promising exploitation in natural product discovery (Acharya et al., 2019), post‐translational modification (Sun et al., 2020), elucidation of biosynthetic pathway (Bordoloi et al., 2016), even illustration of molecular mechanism response to a certain treatment (Guo et al., 2019). Specially, LFQ‐based proteomic approach is simple and time saving for n class="Chemical">sample preparation and result analyses of MS identification and quantification. In this study, by LFQ proteomics approach, multiple dptP‐mediated differential expression proteins of S. roseosporus were identified to be related to catalytic activity, binding, transmembrane transporter activity and regulator activity. Furthermore, KEGG pathway analysis demonstrated DptP protein and its related differential proteins were involved in inhibiting energy metabolism and metabolism of secondary metabolites pathways and activatting carbohydrate metabolism, amino acid metabolism, transport/signal transduction, nucleotide metabolism, lipid metabolism and drug resistance pathways. Except for dptP involvement in drug resistance that was reported in previous work (Alexander et al., 2004), proteomics approach provides more insights to biochemical functions of dptP gene.
To illustrate interactions of DptP with other n class="Species">Streptomyces proteins, Co‐immunoprecipitation (Co‐IP) in combination with MS identification was applied to screen the directly or indirectly interacting proteins. We enriched total membrane proteins by ultra‐centrifuge (Cheng and Li, 2014), and enriched Flag‐tagged DptP protein using anti‐Flag antibody‐coupled beads, subsequently. The protein complex of DptP protein and its interacting proteins were identified by LC‐MS/MS. Three sugar transporters and one phosphoenolpyruvate carboxylase were identified in this assay, which was consistent with that these proteins showed decreased abundance after dptP deletion (Dataset S2A). These sugar transporters with decreased abundance may contribute to the decrease of glucose uptake and subsequently suppression of carbohydrate metabolism. Phosphoenolpyruvate carboxylase catalyses the reaction of phosphoenolpyruvic acid with carbon dioxide to produce oxaloacetic acid, and its decreased abundance is proposed to be involved in the inhibition of succinate dehydrogenase flavoprotein subunit, citrate synthase and succinate dehydrogenase iron–sulphur subunit, which are members of citric acid cycle (Dataset S2A). All these are responsible for the inhibition of carbohydrate metabolism. Additionally, the ABC transporter transmembrane subunit (W9FJ56) is a member of DAPcluster, its interaction with DptP protein seems to confer DAP resistance. Based on the potential DptP‐interacting proteins identified by MS, further biochemical assays for elaborating the mechanisms will be performed in our following studies.
Among the PSIA enriched in catalytic activity, several proteins were responsible for the DAP biosynthesis (Table 1). n class="Chemical">DptD, DptE and DptG showed notable increase of 3.49, 3.91 and 4.46 times respectively. DptD gene encodes a non‐ribosomal peptide synthetase, and dptE gene encodes an acyl‐CoA ligase. DptG encodes a MbtH domain‐containing protein which plays prominent roles on NRPS‐derived natural product biosynthesis by interacting with A domains of NRPS (Boll et al., 2011; Davidsen et al., 2013; Zolova and Garneau‐Tsodikova, 2012). These three proteins are essential for the biosynthesis of DAP. Subsequent transcription analyses showed that DptP played negative roles on transcript levels of biosynthetic genes dptD, dptE, dptF and dptG (Fig. 6, Table 1). It is consistent with the KEGG analysis (Fig. 4C). Additionally, dptP deletion raised the transcription and protein levels of regulatory genes, such as dptR2, adpA (Fig. 6, Dataset S1C). These two genes are responsible for the DAP biosynthesis (Wang et al., 2014; Mao et al., 2015). We speculated the raising transcription and protein levels of regulatory genes contributed to the activation of biosynthesis of secondary metabolites. But how dptP deletion enhanced the transcription levels and protein abundance of the regulators is not clear so far, which needs further researches to explore it.
DptP‐encoding protein shares a significant sequence identity with DedA family protein YghB. Further bioinformatic alignment showed there are several conserved motifs, such as GxxxM/VxxxxF/Y, F/YxxxR/K. These conserved motifs are related to the folding and stabilization of the proteins or higher oligomeric states (Keller and Schneider, 2013). Additionally, there are also n class="Chemical">acidic amino acids (E27 and E39) and basic amino acids (R117 and R123) within or in close to transmembrane spanning regions. These charged amino acids are important for the various proton‐dependent secondary transporters, such as NhaA, MdtM (Fluman et al., 2012; Holdsworth and Law, 2012). What’s more interesting, a recent report focusing on DedA family protein in Burkholderia thailandensis showed the membrane‐embedded charged amino acids contributed to the colistin resistance (Panta et al., 2019). Thus, we supposed that the conserved amino acids of DptP contributed to the DAP tolerance in S. roseosporus and S. ambofaciens.
Previous work has identified that DedA family proteins are essential for bacterial growth of E. coli at 42°C (Boughner and Doerrler, 2012). Qualitative proteome data identified a significant decrease in abundance of cell division or replication proteins. Further experiments identified that n class="Chemical">dptP deletion was not favourable to the strain growth at elevated temperature, which was consistent to previous work. In this study, we provided a closer insight on the mechanism that disruption or mutation of DedA family protein arrests the strain growth by decreasing the protein levels of cell division‐ or replication‐related proteins.
In conclusion, the proteomic and experimental data in this study provided better knowledge on characterization of dpt gene n class="Species">cluster. Our results also provided novel strategies to explore these unknown genes in biosynthetic gene clusters of valuable natural products. The strategy paves new avenues to study an unknown gene or gene cluster, even discover more broad‐spectrum antibiotics.
Experimental procedures
Strains and plasmids
S. roseosporus NRRL 11379 was ordered from American Type Culture Collection (ATCC). S. ambofaciens was purchased from BeNa Culture Collection Company. E. coli ET12567/pUZ8002 and plasmid pSET152 were stored in State Key Laboratory of Biotherapy, Sichuan University. E. coli DH5α was purchased from Transgen Company (CD501‐01, Transgen, China). The pCRISPomyces plasmid (pCM2) was friendly endowed by Prof. Huimin Zhao from University of Illinois, Urbana, USA.
Reagents
Restriction endonucleases including BbsI (R3539S; NEB, Beverly, MA, Un class="Chemical">SA), T4 DNA ligase (M0202S; NEB) and alkaline phosphatase calf intestinal (CIP) (M0290S; NEB) were ordered from New England Biolabs (Beverly, MA, USA). Genome DNA extract kit (D203, Tiangen, China) was purchased from Tiangen Company. WizardSV Gel and PCR Clean‐Up System (A9281; Promega, Madison, WI, USA) were ordered from Promega. Iscript cDNA synthesis kit (170‐8890; Bio‐Rad, Hercules, CA, USA) and SYBR Green PCR 2 × Mix (172‐5121; Bio‐Rad) were ordered from Bio‐Rad. Yeast extract, tryptone, NaCl, MnCl2, ZnSO4 and other reagents required for strain cultivation were purchased from Kelong (Chengdu, Sichuan, China). Soya flour was gifted from Jinan Huilong Company (Jinan, Shandong, China).
Plasmid construction
The dptP‐deletion plasmid pCRISPomyces‐n class="Chemical">dptP (pCM2‐dptP) was constructed as following procedures (Cobb et al., 2015). Two protospacers, CCACACGATCGCGAGCGTGA and TACGGAGGCCAGCGCGAATC, were selected. The last 12‐nt sequences of each protospacer plus 3‐nt PAM sequences (15 nt total) were checked by BLAST to confirm their specificities. The configuration consisting of spacer1‐sgRNAtracr‐T7 terminator‐gapdhp (EL)‐spacer2 was synthesized and inserted into pCM2 plasmid by Golden Gate. Then, the repair template containing 931‐bp upstream and 1035‐bp downstream sequences near dptP was amplified from the genome DNA and inserted into XbaI site of spacer‐containing plasmid.
The dptP‐overexpression plasmid pSET152‐kasOp*‐n class="Chemical">dptP carried a kasOp*‐dptP‐Flag cassette, including a kasOp* promoter and a dptP gene fused with a C‐terminal Flag tag. DptP gene was amplified from the genome of WT, and kasOp* promoter was amplified from template plasmid pkasOp (Wang et al., 2013). We constructed the plasmid by introducing kasOp*‐dptP‐Flag cassette into the BamHI and XbaI sites of pSET152 plasmid (Bierman et al., 1992) via one step assembly (C114; vazyme, Nanjing, Jiangshu, China). All primers and plasmids were summarized in Dataset S3A,B.
Strain cultivation
E. coli strains were cultured in Luria–Bertani (LB) medium at 37°C. S. roseosporus NRRL 11379 and S. ambofaciens ATCC 23877 were cultivated in MYG media (10 g l‐1 malt extract, 4 g l‐1 n class="Species">yeast extract and 4 g l‐1 glucose) at 30°C. Streptomyces spores were harvested from MS solid medium (20 g l‐1 soya flour, 20 g l‐1
d‐mannitol, 20 g l‐1 agar) to count or inoculate. Plasmid DNA was transferred from ET12567/pUZ8002 to Streptomyces strain on M‐ISP4 media (1 g l‐1 yeast extract, 2 g l‐1 tryptone, 5 g l‐1 soluble starch, 5 g l‐1 D‐mannitol, 5 g l‐1 soyal flour, 1 g l‐1 NaCl, 0.1% salt mix, 2 g l‐1 (NH4)2SO4, 1 g l‐1 K2HPO3, 2 g l‐1 CaCO3, 20 g l‐1 agar, pH 7.0) following the reported procedures (Kieser et al., 2000). Random six exconjugants were separately picked and streaked on R2YE plates supplemented with 25 μg ml‐1 apramycin and 25 μg ml‐1 nalidixic acid. After 7 days, the genome DNA of each exconjugant was harvested to perform PCR evaluation. The recombinant plasmids pCM2‐dptP or pSET152‐kasOp*‐dptP were respectively transferred from E. coli ET12567/pUZ8002 into S. roseosporus strain to obtain the dptP‐deletion (ΔdptP) or dptP‐overexpression (OP) strain. Growth rate was quantified by a simplified diphenylamine colorimetric method (Zhao et al., 2013). In this assay, DNA was hydrolysed into various components when exposed to the hot acidic conditions. Next, one of the components, deoxyriboses, were oxidized into 5‐hydroxy‐4 oxopentanals, which were then dimerized and condensed with diphenylamine to form the final products with typical absorbance at 595 nm.
To detect strain growth tolerance to DAP treatment, 1 × 107 spores of S. roseosporus or S. ambofaciens were inoculated inn class="Chemical">MYG containing DAP with a final concentration of 0‐2 mg ml‐1. The growth rate was measured at 1–6 day. The experiment was performed three independent biological replicates.
Experimental design and statistical rationale
All Streptomyces strains used for transcription and protein analyses were cultivated in 30°C for 48 h. For measurement of growth rate and n class="Chemical">DAP tolerance, three independent experiments were performed, and the results based on Student's t‐tests were shown as mean values (± standard deviation, SD). For LFQ proteomics analyses, three biological replicates and three technical replicates were performed for both WT and ΔdptP groups. In total, 18 raw data files were generated. WT group was set as control group. Proteins that were identified in more than two out of three technical replicates in at least one group were used for comparison. Student’s t‐tests (pairwise comparisons) were performed for comparisons between WT and ΔdptP groups, statistical analyses of abundance differences based on a cut‐off of P < 0.05 on the post‐imputated dataset, P < 0.05 were considered statistically significant.
LC‐ MS/MS identification
The WT and ΔdptP strain mycelia were cultured in 50 ml n class="Chemical">MYG at 30°C for 48 h. Mycelia pellets were collected to extract proteins using extraction buffer (50 mM Tris–HCl (pH 8.0), 0.2 mM ethylene diaminetetraaceticacid, 100 mM NaCl, and 1% (v/v) Triton X‐100, 1% deoxycholate, 0.1% SDS).
Protein digestion was conducted according the FASP approach protocol (Wisniewski et al., 2009). A total of 200 μg proteins were treated with a final concentration of 50 mM dithiothreitol and then incubated at 50°C for 30 min. The proteins were diluted to 200 μl UA buffer (8 M n class="Chemical">urea in 50 mM Tris–HCl pH 8.1), and subsequently loaded to Amicon Ultra‐15 Centrifugal Filters Ultracel‐10 K (Merck Millipore, Ireland) which were pre‐treated with 100 mM NaOH. 200 μl UA buffer was used to wash the proteins. Next, the proteins were treated with 100 μl 50 mM iodoacetamide diluted in UA buffer and incubated at 37°C in the dark. After that, 200 μl 50 mM ammonium bicarbonate was used to wash the proteins for two times. Next, proteins were digested with 2 μg sequencing‐grade trypsin at 37°C for 16‐18 h. Desalting was processed using C18‐SD extraction disc (2215, 3M, MN).
The desalted n class="Chemical">peptide mixtures were analysed by LC‐MS/MS on an easy nano‐LC1000 HPLC system (Thermo Scientific, San Jose, CA) and a Q‐Exactive mass spectrometer (Thermo Scientific, San Jose, CA). Peptides were loaded onto a trap column (Thermo Scientific Acclaim PepMap 100, 100 μm × 2 cm, nanoViper C18) from automatic with a mobile phase A, 0.1 % formic acid, and a mobile phase B, 0.1% acidic mixture (84% acetic acid, 16% acetonitrile). Samples were separated by a nano‐analytical column (Thermo scientific EASY column, 10 cm, 75 μm, 3 μm, C18‐A2) at a flow rate of 300 nl min‐1. Survey scan ranges 300–1800 m
/z at a resolution of 70 000. Isolation window was acquired at a resolution of 17 500 with an isolation window of 1.6 m
/z. The MS/MS scans were performed at a resolution of 17 500. The target value for the full MS scan was 1 × 106 with a maximum injection time of 20 ms, and that for the MS/MS scan was 1 × 105 with a maximum injection time of 100 ms.
For MS/MS detection, the mass to charge ratio (m/z) of the peptide fragment was detected. The fragmentation of n class="Chemical">peptide segments in mass spectrometry has a certain regularity. The parent ion of peptide is dissociated by high energy collision dissociation (HCD) or collision‐induced dissociation (CID). The peptide chain breaks off at C‐N bond (HCD) or C‐C bond (CID) and forms daughter ions. Then, b, y (HCD) and a (CID) ions are generated. HCD was applied in this study. According to these y and b ions, the amino acid sequences can be calculated.
Analyses for MS data
A total of 18 raw files generated from LC‐MS/MS were analysed via MaxQuant search engine (Lin et al., 2019) (version 1.6.0.16). Based on the MaxQuant search engine, the LC–MS/MS data were searched against the Uniprot database restricted to S. roseosporus which contains 6520 sequences (Nov 29th, 2019). Two missed tryptic cleavages were allowed. Oxidation (M) and protein N‐terminal acetylation (N) were allowed to be the variable modifications, and carbamidomethylation of cysteine was allowed to be a fixed modification. Initial n class="Chemical">peptide mass tolerance was set to 20 ppm and fragment mass tolerance was 0.1 Da. + 2 was set as default charge state of each peptide. The false discovery rates (FDRs) of peptide and protein were set as 0.01. LFQ min ratio count was set as 2.
Perseus (version 1.6.1.3) was used to analyse clustering and correlation (Lin et al., 2019). The invalid values caused by contaminants and peptides identified by site were filtered by default setting in Perseus. Additionally, LFQ intensities were generated using log (base 2) transformation. Each sample was assigned to its corresponding group, WT (control) versus ΔdptP. At least two unique peptides of a protein successfully detected in each sample was acceptable. The proteins identified in more than two out of three biological replicates in at least one group were used for further analyses. A data imputation step was used to replace the missing values with values of low abundant proteins. These proteins were randomly chosen from a distribution specified by a downshift of 1.8 times the mean SD of all measured values and a width of 0.3 times this SD. The two‐sample t‐tests were conducted based on normalized intensity values. The absent proteins in one group were identified from the pre‐imputation dataset. GO and KEGG analyses were carried out in KEGG database. t‐Tests were used to compare difference of two groups. Zscores was used to count the enrichment values of the pathways (Liu et al., 2020).
Extraction and identification of membrane proteins
Total proteins were extracted using lysis buffer (50 mM Tris–n class="Chemical">HCl, pH 8.0, 0.2 mM EDTA, 100 mM NaCl, and 1% (v/v) Triton X‐100, 1% deoxycholate, 0.1% SDS). The detergent triton X‐100 and SDS improved the extraction efficiency of membrane protein. Extraction of membrane proteins was referred to the previous report (Cheng and Li, 2014). For separation of membrane from cytoplasm, mycelia were lysed using lysis buffer 1 (50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1 mM phenylmethanesulfonyl fluoride (PMSF), 1 mM trichloroethyl phosphate (TCEP)) and centrifugated at 8000 g for 40 min. The supernatant was collected for high‐speed centrifugation at 110 000 g for 1 h. The supernatant was collected for preparation of cytoplasm proteins, and the precipitate was resuspended using lysis buffer 2 (50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% Triton X‐100, 1% sodium deoxycholate, 1% NP‐40, 1 mM PMSF) to collect membrane proteins. The cytoplasm and membrane fractions with equal mass were used to detect the localization of DptP by Western blot. Moreover, Flag‐tagged DptP protein and its interacting proteins were enriched using anti‐Flag antibody‐coupled beads and separated using SDS‐PAGE. Then, the target SDS‐PAGE was cut and digested with trypsin followed by desalting and MS identification.
Gene transcription analysis
The WT, ΔdptP and OP strain mycelia were cultured in 3 ml n class="Chemical">MYG at 30°C for 48 h and then collected for total RNA extraction and subsequent transcription analysis. The transcription levels of dpt gene cluster members, including dptA, dptBC, dptD, dptE, dptF, dptG, dptP, dptM, dptN, dptR1, dptR2 and dptR3, were measured by real time‐quantitative PCR (RT‐qPCR). The PCR reaction mix included 5 μl of SYBR Green Mix, 1 μl of cDNA, 1 μl of each primer at a final 10 pmol ml‐1 concentration and 5 μl of ddH2O. The endogenous gene hrdB, encoding a RNA polymerase sigma factor, was used as the internal control. The expression levels of target genes were normalized by the expression of hrdB. The experiment was performed at least three independent biological replicates.
Western blot analysis
Protein quantification was performed using BCA protein assay kit (P0012; Beyotime Biotechnology, Shanghai, China). Western blot analysis was performed following the procedures as previously described (Zhang et al., 2017). 60 μg proteins of each group were separated using n class="Chemical">SDS‐PAGE. Western blot analysis was performed with rabbit polyclonal anti‐Flag antibody (0912‐1; Huabio, Hangzhou, Zhejiang, China).
Conflict of interests
The authors declare that they have no competing interests.
Authors’ contributions
Dan Zhang, Xixi Wang, Yang Ye, Yu He performed experiments. Fuqiang He and Yongqiang Tian analyzed data. Yunzi Luo supervised dptP‐deletion plasmid construction. Shufang Liang conceived, instructed experiments and revised the paper. All authors read and approved the final manuscript.Fig. S1. The complete nucleotides of the 556‐bp PCR fragment from dptP‐deletion colony presented in Fig. 2C by DNA sequencing. The sequences presented in red font are 248‐bp upstream genome sequences near n class="Chemical">dptP, and the sequences presented in blue font are 308‐bp downstream sequences near dptP. The underlined sequences are the complete sequences of dptP gene. The deletion region includes these underlined sequences in black font.
Click here for additional data file.Fig. S2. Label‐free quantification (LFQ) proteomic analyses for differentially expressed proteins between S. roseosporus WT and ΔdptP strain. (A) Workflow of LFQ proteomics approach. (B) Venn diagram of proteins identified in WT and Δn class="Chemical">dptP strains. 2076 proteins were initially identified in both WT and ΔdptP, 237 proteins were uniquely identified in WT. The multiscatter blot (C) and the cluster analysis (D) of the biological replicates indicated a high degree of similarity among the biological replicates. 1‐3 represent the experimental and biological replicates of WT group; 4‐6 represent the experimental and biological replicates of ΔdptP group
Click here for additional data file.Fig. S3. The sequencing data of the 745‐bp PCR product shows pSET152‐kasOp*‐dptP insertion into genomes of S. roseosporus and S. ambofaciens. The complete nucleotides of the Flag‐tagging n class="Chemical">dptP amplified from the genome DNA of S. roseosporus OP and S. ambofaciens harbouring pSET152‐kasOp*‐dptP. Nucleotide sequences of kasOp*, dptP and Flag tag were presented in red, black and purple font respectively.
Click here for additional data file.Dataset S1. (A) All Proteins identified in WT. (B). All Proteins identified in ΔdptP group. (C) Statistically increased (t‐test, P < 0.05) proteins in Δn class="Chemical">dptP groupStatistically increased (t‐test, P < 0.05) proteins in ΔdptP group. (D). Statistically decreased (t‐test, P < 0.05) proteins in ΔdptP group. (E). Absent proteins in ΔdptP group.
Dataset S2. (A). Total DptP‐interacting proteins.Dataset S3. (A) Primers used in this study. (B) Strains and plasmids used in this study.Click here for additional data file.
Authors: Vivian Miao; Marie-Françoise Coëffet-Legal; Paul Brian; Renee Brost; Julia Penn; Andrew Whiting; Steven Martin; Robert Ford; Ian Parr; Mario Bouchard; Christopher J Silva; Stephen K Wrigley; Richard H Baltz Journal: Microbiology Date: 2005-05 Impact factor: 2.777
Authors: Robert D Arbeit; Dennis Maki; Francis P Tally; Edward Campanaro; Barry I Eisenstein Journal: Clin Infect Dis Date: 2004-05-20 Impact factor: 9.079