| Literature DB >> 33330883 |
Elizabeth C Stahl, Connor A Tsuchida, Jennifer R Hamilton, Enrique Lin-Shiao, Shana L McDevitt, Erica A Moehle, Lea B Witkowsky, C Kimberly Tsui, Kathleen Pestal, Holly K Gildea, Matthew McElroy, Amanda Keller, Iman Sylvain, Clara Williams, Ariana Hirsh, Alison Ciling, Alexander J Ehrenberg, Fyodor D Urnov, Bradley R Ringeisen, Petros Giannikopoulos, Jennifer A Doudna.
Abstract
Commonly used RT-qPCR-based SARS-CoV-2 diagene">nostics require 2-3 separate reactioene">ns or rely oene">n detectioene">n of a single viral target, adding time aene">nd cost or risk of false-negative results. Curreene">ntly, no test combines detectioene">n of widely usedEntities:
Year: 2020 PMID: 33330883 PMCID: PMC7743092 DOI: 10.1101/2020.12.10.20247338
Source DB: PubMed Journal: medRxiv
Primer and probes tested for the development of the IGI-LuNER assay
| Sequence (5’→3’)[ | Concentration[ | Citation | |
|---|---|---|---|
| N1 Forward Primer | GACCCCAAAATCAGCGAAAT | 400 nM | [ |
| N1 Reverse Primer | TCTGGTTACTGCCAGTTGAATCTG | 400 nM | [ |
| N1 Probe | FAM-ACCCCGCATTACGTTTGGTGGACC-ZEN/IABkFQ | 200 nM | [ |
| RNase P Forward Primer | AGATTTGGACCTGCGAGCG | 150 nM | [ |
| RNase P Reverse Primer | GAGCGGCTGTCTCCACAAGT | 150 nM | [ |
| RNase P Probe | ATTO647-TTCTGACCTGAAGGCTCTGCGCG-TAO/IABkRQ | 200 nM | [ |
| RdRp Forward Primer | GTGARATGGTCATGTGTGGCGG | 800 nM | [ |
| RdRp Reverse Primer | CARATGTTAAA | 600 nM | [ |
| RdRp P2 Probe | SUN-CAGGTGGAACCTCATCAGGAGATGC-ZEN/IABkFQ | 100 nM | [ |
| E-Sarbeco Forward Primer | ACAGGTACGTTAATAGTTAATAGCGT | 400 nM | [ |
| E-Sarbeco Reverse Primer | ATATTGCAGCAGTACGCACACA | 400 nM | [ |
| E-Sarbeco Probe | SUN-ACACTAGCCATCCTTACTGCGCTTCG-ZEN/IABkFQ | 200 nM | [ |
R is G/A; S is G/C (site of mismatch)
Concentrations are given in nanomole per liter (nM) based on the final reaction mix from 10 μM primer stock solution into 12.5 μL total reaction
Figure 1.Implementation and adaptation of the Saliva Direct RT-qPCR assay to detect SARS-CoV-2 N1 and human RNase P with the QuantStudio-6. Plasmid DNA was added directly into the master mix at 200,000 copies/mL (2–4x Saliva Direct limit of detection) in triplicate. A) Full and half reaction volumes on the CFx96 with 2x master mix, B) Full and half reaction volumes on the QuantStudio-6 with 2x master mix, D) Full and half reaction volumes on the QuantStudio-6 with 4x master mix. Samples which failed to amplify are denoted as “not detected” (ND).
Figure 2.Evaluating E-Sarbeco and RdRp-SARSr primers and probes with RNase P on the QuantStudio-6. A) Full and half-sized reactions of E-Sarbeco on the QuantStudio-6 with 4x master mix B) Full and half-sized reactions of RdRp on the QuantStudio-6 with 4x master mix. Plasmid DNA was added directly into the master mix at 200,000 copies/mL (2–4x Saliva Direct limit of detection) in triplicate. C) Evaluation of corrected RdRp reverse primers at two different concentrations on pooled RNA eluted from positive clinical swab samples in triplicate. p<0.001 (*) between mismatch and corrected at 400nM and between both concentrations of primers. Not significant (ns). D) E-Sarbeco primers and probes multiplexed with N1 and RNase P in a single half-sized reaction on the QuantStudio-6 with 4x master mix.
Figure 3.Limit of detection and reproducibility. A) The limit of detection was defined by extracting RNA from heat inactivated virus at concentrations ranging from 50 TCID50/mL to 0.1 TCID50/mL and performing RT-qPCR with the LuNER reagents. B) Twenty replicates at 2x LoD (1 TCID50/mL) were prepared by extracting RNA from heat inactivated virus and performing RT-qPCR with the LuNER reagents to test for reproducibility. Samples were positive if either N gene or E gene was detected at a Ct value < 40. Samples that did not amplify or had Ct values >=40 are shown on the x-axis. C) Controls for the LuNER assay are valid, including negative buffer-only control (“NC”), human RNA control (“HC”), qPCR negative, and qPCR positive controls.
Figure 4.Clinical concordance. A) RNA was extracted from known clinical samples and reanalyzed with the TaqPath COVID-19 kit or IGI-LuNER assay. B) Ct value comparisons for the 61 expected positive samples show 9 negative samples in the IGI-LuNER assay (pink lines), which were also negative in the TaqPath COVID-19 kit. An additional 10 samples assayed with the TaqPath COVID-19 kit returned an alternative result. C) Ct value comparison for N-gene between the IGI-LuNER and TaqPath assays shows strong concordance. Pink lines reflect samples in the TaqPath kit that returned inconclusive or invalid results despite amplifying N-gene in the expected positive samples. Logic gating for possible sample results is listed in the Methods.
Clinical evaluation of IGI-LuNER RT-qPCR with matched swab samples
| TaqPath | TaqPath | IGI-LuNER | TaqPath | TaqPath | IGI-LuNER | TaqPath | TaqPath | IGI-LuNER | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sample | Sample | Sample | |||||||||
| A1 | A13 | K13 | |||||||||
| A3 | A19 | K17 | |||||||||
| A5 | A21 | K21 | |||||||||
| A7 | A23 | M9 | |||||||||
| C1 | C15 | M11 | |||||||||
| C3 | C17 | M13 | |||||||||
| C5 | C19 | M21 | |||||||||
| C7 | C21 | O11 | |||||||||
| E1 | C23 | O13 | |||||||||
| E3 | E11 | O17 | |||||||||
| E5 | E13 | O21 | |||||||||
| E7 | E15 | O23 | |||||||||
| G1 | E19 | A11 | |||||||||
| G3 | E23 | C13 | |||||||||
| G5 | G9 | E9 | |||||||||
| I1 | G11 | E17 | |||||||||
| I3 | G13 | E21 | |||||||||
| I5 | G15 | K23 | |||||||||
| I7 | G17 | I15 | |||||||||
| K1 | G19 | K19 | |||||||||
| K3 | G21 | O9 | |||||||||
| K5 | G23 | O15 | |||||||||
| K7 | I9 | A15 | |||||||||
| M1 | I11 | A17 | |||||||||
| M3 | I13 | C11 | |||||||||
| M5 | I17 | I19 | |||||||||
| M7 | I21 | K15 | |||||||||
| O1 | I23 | M15 | |||||||||
| O3 | K9 | M17 | |||||||||
| O5 | K11 | M23 | |||||||||
| O19 |
| Sample Result | Extraction control | Viral Targets |
|---|---|---|
| Positive | - | Either E-gene |
| Negative | RNase P Ct < 35 | Both E-gene |
| Invalid | RNase P Ct ≥ 35 | Both E-gene |
| Controls | Valid when |
|---|---|
| NC | RNase P Ct ≥ 35, both E-gene |
| HC | RNase P Ct < 35, both E-gene |
| qPCR Negative | RNase P Ct ≥ 35, both E-gene |
| qPCR positive | RNase P Ct < 35, both E-gene |
| Sample Result | Extraction spike-in control (Bacteriophage MS2) | Viral Targets ( |
|---|---|---|
| Positive | Not required | ≥2 of 3 viral targets have Ct < 37 |
| Negative | MS2 Ct < 37 | 0 viral targets have Ct < 37 |
| Invalid | MS2 Ct ≥ 37 | 0 viral targets have Ct < 37 |
| Inconclusive | MS2 Ct < 37 | 1 of 3 viral targets have Ct < 37 |
| Controls | Valid when |
|---|---|
| NC | MS2 Ct < 37, 3 of 3 viral targets Ct ≥ 37 |
| HC | MS2 Ct < 37, 3 of 3 viral targets Ct ≥ 37 |
| qPCR Negative | MS2 Ct ≥ 37, 3 of 3 viral targets Ct ≥ 37 |
| qPCR positive | MS2 Ct ≥ 37, 3 of 3 viral targets Ct < 37 |