Literature DB >> 33314806

Immune responses against autologous tumor and human papilloma virus in lymph nodes from patients with penile cancer.

Lu Zhang1, A Ali Zirakzadeh2, Jesper Rosvall3, Mats Hedlund4, Ping Sheng Hu5, Katrine Riklund6, Amir Sherif7, Ola Winqvist8.   

Abstract

PURPOSE: Nearly half of penile cancers are related to human papillomavirus (HPV) infection. Investigations of tumor- and HPV-specific T cell reactivity in regional lymph nodes (LNs) from patients with penile cancer are warranted.
MATERIALS AND METHODS: In this study, single-cell suspensions from LNs and peripheral blood from 11 patients with penile cancer were stained with antibodies for lymphocyte markers and analyzed by fluorescence-activated cell sorting (FACS). DNA was extracted from the tumor tissue and HPV status was investigated by PCR.
RESULTS: T-cell reactivity against autologous tumor-extract and against the HPV-vaccine Gardasil® was tested by flow-cytometric assay of specific cell-mediated immune response in activated whole blood (FASCIA). CD4+/CD8+ ratios were significantly lower in HPV positive LNs (p<0.05). Immune responses to tumor extract assessed by blast transformation and expansion in vitro, of either CD4+ or CD8+ T-cells, were found in 9 of 13 LNs (69%). 5 of 6 tested patients demonstrated T cell recognition of tumor-associated antigen(s). In HPV-positive patients, dose-dependent T cell responses against L1 (late) HPV proteins (Gardasil vaccine) were demonstrated.
CONCLUSIONS: LN-derived T cells from patients with penile cancer recognize tumor antigen(s) and in HPV-positive cases, there is a response against L1 (late) HPV proteins, being constituents of the Gardasil vaccine. © The Korean Urological Association, 2021.

Entities:  

Keywords:  Adoptive immunity; Lymph node excision; Papillomaviridae; Penile neoplasms; T-lymphocytes

Mesh:

Substances:

Year:  2020        PMID: 33314806      PMCID: PMC7801168          DOI: 10.4111/icu.20200116

Source DB:  PubMed          Journal:  Investig Clin Urol        ISSN: 2466-0493


INTRODUCTION

Human papillomavirus (HPV) is a cancer-causing DNA virus infecting humans, accounting for 5.2% of cancers worldwide [1]. Penile cancer is rare in developed countries (0.3–1.0 case per 100,000/year) accounting for around 0.4% to 0.6% of all malignancies. Nearly half of all penile cancers are HPV-positive [2]. Among 170 HPV strains [3], HPV16 is the main strain accounting for 68.7% of all penile cancers [2]. The presence of HPV DNA in primary tumors and metastases indicates the potential role of HPV in tumor progression [24]. Standard treatment for invasive penile cancer is radical surgery with or without cisplatin-based chemotherapy [5]. In solid tumors, the histologic status of the regional lymph nodes (LNs) is one of the most important predictors of patient survival [67]. The LNs are regarded as the primary compartment where tumor cells and the host immune system interact. The concept of adoptive immunotherapy in cancer is based upon the immunosurveillance hypothesis [8]. There are several indications of HPV-associated malignancies eliciting a virus-specific immune response [910]. The presence of tumor-infiltrating lymphocytes (TILs) in cervical cancer correlates with prognosis, and treatment with HPV-TIL infusions demonstrates that durable and complete regression of metastases is immunologically mediated [11]. In adoptive immunotherapy, TILs are a frequently used cell population because antigen-specific T cells are accumulated intratumorally. In addition, tumor-antigen-recognizing lymphocytes occur in tumor-draining LNs in human malignancies such as colon and urinary bladder cancer, where T cells are activated by tumor antigens and presented by professional antigen-presenting cells (APCs) [1213]. Thus, tumorspecific lymphocytes obtained from LNs may be enriched, undergo ex vivo expansion, and be further used for adoptive immunotherapy. HPV early proteins, E6 and E7, are oncoproteins affecting cell growth control through inactivation of cellular tumor suppressor gene products: p53 and Rb, respectively [14]. E6 and E7 are widely studied in HPV-associated cancer immunotherapy [91011]. A study comparing the efficiency of HPV-antigen-specific T cells in killing autologous HPV-positive tumor cells in cervical cancer patients suggests that L1-specific CD8+ cytotoxic T lymphocytes are equally as effective as E7-specific CD8+ cytotoxic T lymphocytes [15]. A HPV vaccine study demonstrated that Gardasil® could be highly efficacious against HPV 16/18 [16].

MATERIALS AND METHODS

1. Patients

Eleven patients with invasive penile cancer, staged cT1-2N0-1M0, and aged 50 to 84 years, from Södersjukhuset (Stockholm, Sweden) and Norrlands Universitetssjukhus (Umeå, Sweden), were prospectively enrolled from 2013 to 2015 (Table 1). Oral and written informed consent was obtained from all participants. The study was approved by the regional ethical committee in Umeå University, Umeå, Sweden (approval number: EPN-2013/835-32). All procedures performed in the study conformed to the provisions of the Declaration of Helsinki from 1964 according to the revision in Fortaleza, Brazil, October 2013.
Table 1

Patient characteristics and cTNM and pTNM staging of the investigated patients

Patient no.Age (y)Circumcised before time of diagnosis, yes/noClinical tumor stagingpT-stagesTotal number of excised lymph nodesTotal number of metastatic lymph nodesTreatment after radical surgery
184NoT2N0M0pT240Palliative radiation
272NoT1N0M0pT1a30No
372NoT2N0M0pT240No
478NoT1N0M0pT1a20No
566NoT1N0M0pT150No
650NoT2N0M0pT240Surgery again 21.5 months later due to metastases
780NoT2N0M0pT270Total amputation of penis 1.5 months later
877NoT1N0M0pT140No
978NoT2N1M0pT281No
1078NoT1N0M0pT1a42Repeat surgery 2 months later to remove bilateral lymph nodes inguinal and iliac (yield 11/14 metastatic nodes)
1170YesaT2N0M0pT240No

a:Patient no. 11 was diagnosed with a phimosis 8 years before radical surgery and then circumcised. One year later, he developed a plasma cell balanitis (Zoon's balanitis), which was followed. Four years prior to radical surgery, the patient had a noninvasive penile cancer which finally progressed locally.

2. Preparation of specimens

One piece of primary tumor was dissected during surgery and used for PCR analyses and as antigen. LNs were identified and excised, and one-half of each LN was used for routine histopathology and immunologic evaluation.

3. Preparation of single cells

Venous blood, LNs, and tumor specimens were immediately harvested. Peripheral blood mononuclear cells (PBMCs) were purified by Ficoll-Hypaque density gradient centrifugation (Pharmacia, Amersham, Uppsala, Sweden). Single-cell suspensions from tissue specimens were obtained by gentle pressure using a loose-fit glass homogenizer. Cells were washed twice and resuspended in AIM V serum-free medium (Life Technologies, Carlsbad, CA, USA).

4. Flow cytometry (fluorescence-activated cell sorting, FACS)

PBMCs, LNs, and tumor cell suspensions at 0.5x106 cells/sample were washed in PBS containing 2% FCS and 0.05% NaN3 (FACS-buffer). To investigate lymphocyte subtypes and their functions, staining was performed with fluorophore-conjugated antibodies: Blue Live/Dead stain, anti-CD4 Pacific-Blue, anti-CD8 APC, anti-CD19 APC-Cy7, and anti-CD56 PE (Becton Dickinson-BD, Franklin Lakes, NJ, USA). Cells were investigated with LSRFORTESSA (BD) and analyzed by using the FACS DIVA software (BD).

5. Activation of T cells

Tumor samples were homogenized using an Ultra-Turrax homogenizer in 5 volumes (w/v) of RPMI, followed by 5 minutes of denaturation at 98℃. Activation of single-cell suspensions of PBMCs, LN cells, and TILs was tested at 0.5 million cells per tube using tumor homogenate, Gardasil HPV vaccine (0.1–1.0 µg/mL), or pokeweed mitogen (5 mg/mL) (Sigma, St. Louis, MO, USA). Activation was measured by blast transformation (day 7) and cell surface markers by flow-cytometric assay of specific cell-mediated immune response in activated whole blood (FASCIA). The optimal markers for analyzing T helper cells, cytotoxic T cells, B cells, and NK cells, namely, CD4, CD8, CD19, and CD56, were utilized [17].

6. PCR assay

Tumor samples were stored in RNA-later (Ambion, Austin, TX, USA) and extracted for DNA by use of DNAeasy Blood and Tissue kits (Qiagen, Venlo, Netherlands). Primers were used to detect the L1-region of HPV16 and HPV18 (Table 2) [1819]. HPV18-DNA extracted from HeLa cells and HPV16-DNA (Advanced Biotechnologies, Eldersburg, MD, USA) were used as positive controls. PCR assay was performed by use of a Bio-Rad T100 Thermal Cycler following standard PCR protocol.
Table 2

Primers used to detect HPV16 and HPV18 infectionsa

TypePrimerPrimer sequence (5′–3′)Region
MY09Pr1CGTCCMARRGGAWACTGATCL1
MY11Pr2GCMCAGGGWCATAAYAATGG
HPV-16Pr1TGCACGCACAAACATATATTATCATGL1
Pr2CCTGTATTGTAATCCTGATACTTTAG
HPV-18Pr1CCAAGTGGCTCTATTGTTACCTCL1
Pr2GAGTGGTATCTACCACAGTAAC

HPV, human papillomavirus.

a:All primers were targeted on the L1 region.

7. Statistical analysis

Spearman correlation was used to analyze relations between subpopulations using GraphPad software (GraphPad Software, La Jolla, CA, USA). A p-value <0.05 was considered significant.

RESULTS

1. HPV classification of tumors

In 5 of 11 included patients of the prospective cohort, primary tumors were available for DNA analysis. DNA was extracted and investigated using HPV primers for the L1 gene from HPV16 and HPV18. In samples from 2 of 5 (40.0%) tested patients (patients 7–11), we detected HPV virus (Table 3), which was comparable with reported frequencies (46.3%) [2021].
Table 3

Laboratory characteristics of lymph node cell populationsa

Patient no.Average % CD4+Average % CD8+Average % CD4+/CD8+Average % CD19+Average % CD56+HPVb
143.907.876.1138.005.20ND
221.404.974.4652.670.50ND
349.9020.002.5741.2525.40ND
468.4013.954.9443.351.50ND
569.055.0013.8115.050.60ND
659.577.378.5321.770.83ND
781.303.6019.926.670.43No
874.0011.705.6012.402.40Yes
938.902.5515.3933.501.25Yes
1029.3339.430.7520.5712.00No
1166.675.5711.9718.830.80No

HPV, human papillomavirus.

a:In samples from patients 7–11, HPV virus was investigated.

b:ND denotes not determined, Yes denotes positive detection of HPV virus, and No denotes negative detection of HPV virus.

2. Immunophenotyping of LNs

Single-cell suspensions obtained from tumor, LNs, and peripheral blood were analyzed by FACS (Fig. 1A) [21]. The average fraction of CD4+ T lymphocytes in LNs was between 21% and 81.3% and that of CD8+ T lymphocytes was between 2.5% and 39.4% (Table 3). CD4+/CD8+ ratios were significantly different between LNs and peripheral blood (p<0.001) (Fig. 1B). The CD4+/CD8+ ratio in PBMCs was 2.5 compared with 10 in LNs (Fig. 1B), demonstrating expansion of CD4+ T lymphocytes in LNs. By comparing lymphocyte populations, we found a significant correlation between CD8+ T lymphocytes and CD56+-expressing lymphocytes (Spearman r=0.67, p<0.001) (Fig. 2A). Furthermore, we found an inverse correlation between the fraction of CD19+ B lymphocytes and CD4+ T lymphocytes (Spearman r=−0.71, p<0.001) (Fig. 2B). Additionally, we found an inverse correlation between the fraction of CD19+ B lymphocytes and the CD4+/CD8+ ratio (Spearman r=−0.61, p<0.001) (Fig. 2C). When analyzing CD4+/CD8+ ratios in HPV+ LNs, we found a significantly decreased CD4+/CD8+ ratio in LNs derived from HPV-positive patients (p<0.05), suggesting a relative increase in virus-recognizing CD8+ T lymphocytes in HPV patients (Fig. 3A).
Fig. 1

Single-cell suspensions obtained from tumor, LNs, and peripheral blood were analyzed by FACS (A) and gated according to side and forward scatter followed by lineage-specific cell surface markers for T lymphocytes (CD4+ and CD8+) and B lymphocytes (CD19+). (B) CD4+/CD8+ ratios between LNs and PBMCs were compared. PBMC, peripheral blood mononuclear cell; LN, lymph node; FACS, fluorescence-activated cell sorting. ***p<0.001.

Fig. 2

Single-cell suspensions from lymph nodes were analyzed by FACS (fluorescence-activated cell sorting) by using specific cell surface markers for T lymphocytes (CD4+ and CD8+) and B lymphocytes (CD19+) and correlated with the activation marker CD56+ by using Spearman correlation tests. The correlations between the fraction of (A) CD8+ cytotoxic T cells and CD56+-expressing lymphocytes, (B) CD19+ B lymphocytes and CD4+ T helper cells, and (C) CD19+ B lymphocytes and CD4+/CD8+ ratios were investigated. Regression coefficients and p-values are given in the figure.

Fig. 3

CD4+/CD8+ T lymphocyte ratios were compared between HPV-positive LNs and HPV-negative LN (A). Evaluation of immune responses toward autologous tumor extract by FASCIA was carried out in 13 LNs from six patients. The response to tumor extract/untreated was calculated. Responses above 1 (blue line) were considered as tumor-induced T cell responses (B). Lymphocytes were evaluated by stimulation with the Gardasil HPV vaccine containing L1 proteins derived from HPV, and tumor extract from HPV-positive patients, and compared with the general response to PWM and untreated (C). The fraction of blast responding CD4+ and CD8+ T lymphocytes from PBMCs and lymph nodes was evaluated by FASCIA on day 7 from HPV-positive patient no. 8. HPV, human papillomavirus; PBMC, peripheral blood mononuclear cell; LN, lymph node; PWM, pokeweed mitogen; FASCIA, flow-cytometric assay of specific cell-mediated immune response in activated whole blood.

3. Anti-tumoral reactivity in regional LNs

In 13 available LNs (6 patients), we investigated immune responses toward autologous tumor extract by FASCIA [22]. We observed CD4+ T lymphocyte responses in 6 of 13 LNs (Fig. 3B). Correspondingly, CD8+ T lymphocyte blast responses were seen in 7 of 13 LNs (Fig. 3B). In total, we found an immune response, either CD4+ or CD8+, in 9 of 13 tested LNs. Thus, 5 of 6 (83%) tested patients demonstrated a T cell recognition of autologous tumor antigens.

4. HPV-reactivity in regional LNs

Due to the association with HPV infection, we conducted both HPV vaccine and tumor extract-stimulation with LN cells from HPV-positive patients. When using tumor extract as antigen for stimulation, a small T cell response was noted with PBMCs and cells from LNs (Fig. 3C). However, we found strong responses in PBMCs and LN cells in HPVpositive patient no. 8 (Fig. 3C). Both HPV-positive patients (patients 8 and 9) responded to HPV vaccine and to tumor extract. Only absent or very weak responses toward HPV vaccine were noted in HPV-negative patients (not shown), demonstrating that L1 protein responses were restricted to HPV-positive patients. The LN-derived lymphocytes from HPV-positive patient no. 9 responded in a dose-dependent manner against HPV vaccine (Fig. 4A). Investigation of the cell surface expression of the activation marker HLA-DR showed a 10-fold increase from the unstimulated to the HPV virus-stimulated group, substantiating vaccine-dependent T cell activation (Fig. 4B).
Fig. 4

Lymph node-derived lymphocytes from HPV-positive patient no. 9 were evaluated by FASCIA on day 7 after stimulation with 0.1, 0.3, or 1.0 µg/mL Gardasil HPV vaccine or PWM as a control (A). In the same experiment the cell surface expression of the T cell activation marker HLA-DR was evaluated by FACS (B). PWM, pokeweed mitogen; HPV, human papillomavirus; FASCIA, flow-cytometric assay of specific cell-mediated immune response in activated whole blood; FACS, fluorescence-activated cell sorting.

DISCUSSION

We have here for the first time demonstrated tumor antigen and HPV-specific T cell responses in LNs from patients with penile cancer. We found that HPV-infected penile cancer patients displayed a significant decrease of the CD4+/CD8+ ratio in LNs, suggesting activation and expansion of HPV-recognizing CD8+ T lymphocytes (Fig. 3A). Although CD56+ is a known NK cell marker, CD56+ is also expressed on activated cytotoxic CD8+ T lymphocytes [23], suggesting that LNs contain an increased number of activated CD8+ T lymphocytes, further demonstrating their state of activation (Fig. 2A). Additionally, we found activation of CD4+ Th cells in LNs responding to the HPV-L1 proteins from HPV16 or HPV18 present in the Gardasil HPV vaccine, supporting the concept of HPV-specific immune responses. The FASCIA assay used the addition of tumor homogenate or L1 proteins from HPV16 or HPV18 present in the HPV vaccine, and the length of the peptides or the exogenously provided homogenate promotes presentation in the major histocompability complex (MHC) class II pocket and hence stimulation of CD4+ T lymphocytes. The activation of CD8+ T lymphocytes against HPV vaccine was poor in PBMC cultures, but they responded nicely in LNs (Fig. 3C). This suggests cross-presentation in LN cultures where specialized APCs may have the capacity to load MHC class I molecules for CD8+ T cell activation [24]. Interestingly, our data might also confirm the postulated inverse relationship between CD19+ B lymphocytes and the CD4+/CD8+ T lymphocyte ratio (Fig. 2C). Experimental data from other groups have suggested that regulatory B lymphocytes, Bregs, may suppress the proliferation of helper T1 (Th1) cells. We did not pursue this matter in detail, which would have required a more extensive panel of markers [2526]. In studies of cervical cancer, HPV infection can affect the host immune responses [27], where accumulation of ineffective CD8+ T lymphocytes was observed in stage II/III CINs [28]. HPV-specific T cell responses seem to be important in cancer defense, since a higher incidence of HPV-related lesions are observed in immunosuppressed individuals after organ transplantation [29]. The increased T cell proliferation in response to Gardasil HPV vaccine compared with tumor extract suggests that HPV vaccine contains higher concentrations of pure antigens compared with autologous tumor extracts. Since we demonstrated a dose-dependent response toward L1-proteins, HPV vaccine may be a source in expansion of HPV-specific T cells in HPV-positive penile cancer patients for adoptive T cell therapy. To enhance the effect of an adoptive immune response in penile cancer, we suggest using HPV-peptide cocktails promoting CD8+ T cell responses. Compared with autologous tumor extracts, which contain a mixture of unknown proteins, defined HPV peptides might be more efficient. In a recent study using HPV E6 and E7 peptides to stimulate and expand TILs from patients with cervical cancer, two patients experienced complete responses [11]. In addition, HPV-specific CD8+ and CD4+ T cell responses against E6 and E7 proteins were found in patients with cervical cancer [30], suggesting a potential role of specific T cell therapy in HPV malignancies. Thus, the use of E6 and E7 peptides to expand HPV-specific T cells for immunotherapy of patients with penile cancer may be useful. Note that in the most optimal setting, parts of all extracted nodes could have undergone analysis. Yet availability and, in some instances, very small nodes with low volumes of nodal tissue did not allow us to infringe on standard clinical and pathology practices. Furthermore, it would have been more optimal to differentiate between sentinel nodes and nonsentinel nodes, because these different types of LNs hypothetically have different immunologic properties. Although this differentiation was not performed, it is a goal in our forthcoming studies. Note also that two of the patients had three metastatic nodes in total. None of them were analyzed in our study.

CONCLUSIONS

LN-derived T lymphocytes from patients with penile cancer respond to tumor antigen. HPV-positive cases respond to the Gardasil HPV vaccine. In penile cancer, strategies using L1-proteins from HPV as an antigen may be useful for adoptive T cell therapy.
  30 in total

Review 1.  Antigen presentation to naive CD4 T cells in the lymph node.

Authors:  Andrea A Itano; Marc K Jenkins
Journal:  Nat Immunol       Date:  2003-08       Impact factor: 25.606

2.  Detection of immune responses against urinary bladder cancer in sentinel lymph nodes.

Authors:  Per Marits; Mona Karlsson; Amir Sherif; Ulrike Garske; Magnus Thörn; Ola Winqvist
Journal:  Eur Urol       Date:  2005-11-14       Impact factor: 20.096

Review 3.  Regulatory B cells in inflammatory diseases and tumor.

Authors:  Xiaoyu Cai; Lingling Zhang; Wei Wei
Journal:  Int Immunopharmacol       Date:  2018-12-17       Impact factor: 4.932

4.  Detection by PCR of human papillomavirus in Colombia: Comparison of GP5+/6+ and MY09/11 primer sets.

Authors:  Milena Camargo; Sara Soto-De Leon; Ricardo Sanchez; Marina Munoz; Erika Vega; Magda Beltran; Antonio Perez-Prados; Manuel Elkin Patarroyo; Manuel Alfonso Patarroyo
Journal:  J Virol Methods       Date:  2011-08-22       Impact factor: 2.014

5.  Effect of human papillomavirus infection on the immune system and its role in the course of cervical cancer.

Authors:  Dan Song; Hong Li; Haibo Li; Jianrong Dai
Journal:  Oncol Lett       Date:  2015-05-29       Impact factor: 2.967

6.  Evaluation of T and B lymphocyte function in clinical practice using a flow cytometry based proliferation assay.

Authors:  Per Marits; Ann-Charlotte Wikström; Dusan Popadic; Ola Winqvist; Sarah Thunberg
Journal:  Clin Immunol       Date:  2014-06-06       Impact factor: 3.969

7.  EAU guidelines on penile cancer: 2014 update.

Authors:  Oliver W Hakenberg; Eva M Compérat; Suks Minhas; Andrea Necchi; Chris Protzel; Nick Watkin
Journal:  Eur Urol       Date:  2014-11-01       Impact factor: 20.096

Review 8.  Acquisition and Presentation of Tumor Antigens by Dendritic Cells.

Authors:  Irene Bonaccorsi; Stefania Campana; Barbara Morandi; Guido Ferlazzo
Journal:  Crit Rev Immunol       Date:  2015       Impact factor: 2.214

9.  Prognostic factors in node-positive carcinoma of the penis.

Authors:  Durgatosh Pandey; Vikash Mahajan; R Ravi Kannan
Journal:  J Surg Oncol       Date:  2006-02-01       Impact factor: 3.454

10.  Immunotherapy for penile cancer.

Authors:  Carlo Buonerba; Martina Pagliuca; Francesca Maria Vitrone; Ilaria Ascione; Ivana Elefante; Vittorio Riccio; Francesca Romano; Sabino De Placido; Giuseppe Di Lorenzo
Journal:  Future Sci OA       Date:  2017-05-02
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.