Rehab Mahmoud Abd El-Baky1,2, Sahar A Mandour2, Eman Farouk Ahmed2, Zeinab Shawky Hashem1, Tim Sandle3, Doaa Safwat Mohamed2. 1. Department of Microbiology and Immunology, Faculty of Pharmacy, Minia University, Minia, Egypt. 2. Department of Microbiology and Immunology, Faculty of Pharmacy, Deraya University, Minia, Egypt. 3. School of Health Sciences, Division of Pharmacy & Optometry, University of Manchester, Manchester, United Kingdom.
Abstract
Pseudomonas aeruginosa is an opportunistic pathogen that can cause a variety of diseases especially in the hospital environment. However, this pathogen also exhibits antimicrobial activity against Gram-positive bacteria and fungi. This study aimed to characterize different virulence factors, secreted metabolites and to study their role in the suppression of Candida growth. Fifteen P. aeruginosa isolates were tested for their anticandidal activity against 3 different Candida spp. by the cross-streak method. The effect on hyphae production was tested microscopically using light and scanning electron microscopy (SEM). Polymerase chain reaction was used in the detection of some virulence genes. Lipopolysaccharide profile was performed using SDS-polyacrylamide gel stained with silver. Fatty acids were analyzed by GC-MS as methyl ester derivatives. It was found that 5 P. aeruginosa isolates inhibited all tested Candida spp. (50-100% inhibition), one isolate inhibited C. glabrata only and 3 isolates showed no activity against the tested Candida spp. The P. aeruginosa isolates inhibiting all Candida spp. were positive for all virulence genes. GC-Ms analysis revealed that isolates with high anticandidal activity showed spectra for several compounds, each known for their antifungal activity in comparison to those with low or no anticandidal activity. Hence, clinical isolates of P. aeruginosa showed Candida species-specific interactions by different means, giving rise to the importance of studying microbial interaction in polymicrobial infections and their contribution to causing disease.
Pseudomonas aeruginosa is an opportunistic pathogen that can cause a variety of diseases especially in the hospital environment. However, this pathogen also exhibits antimicrobial activity against Gram-positive bacteria and fungi. This study aimed to characterize different virulence factors, secreted metabolites and to study their role in the suppression of Candida growth. Fifteen P. aeruginosa isolates were tested for their anticandidal activity against 3 different Candida spp. by the cross-streak method. The effect on hyphae production was tested microscopically using light and scanning electron microscopy (SEM). Polymerase chain reaction was used in the detection of some virulence genes. Lipopolysaccharide profile was performed using SDS-polyacrylamide gel stained with silver. Fatty acids were analyzed by GC-MS as methyl ester derivatives. It was found that 5 P. aeruginosa isolates inhibited all tested Candida spp. (50-100% inhibition), one isolate inhibited C. glabrata only and 3 isolates showed no activity against the tested Candida spp. The P. aeruginosa isolates inhibiting all Candida spp. were positive for all virulence genes. GC-Ms analysis revealed that isolates with high anticandidal activity showed spectra for several compounds, each known for their antifungal activity in comparison to those with low or no anticandidal activity. Hence, clinical isolates of P. aeruginosa showed Candida species-specific interactions by different means, giving rise to the importance of studying microbial interaction in polymicrobial infections and their contribution to causing disease.
Pseudomonas aeruginosa is an opportunistic Gram-negative organism that is widely distributed in the environment, including the hospital environment and the bacterium is part of normal flora of healthy individuals and immunocompromised hosts. In the hospital setting, Pseudomonas spp. may be obtained from ventilators and other respiratory equipment, sinks and toilets. The bacterium can cause a variety of infections that range from mild to life-threatening infections, and because of its connection to nosocomial environments, it poses a particular risk to immunocompromised patients [1].Pseudomonas spp. possesses a panel of virulence factors that play key role in their invasiveness, toxicity, pathogenicity, and their ability to evade the host immune system. In addition, Pili, exoenzyme S, LasB elastase, exotoxin A and Phospholipase C virulence factors are involved in the more acute infections caused by Pseudomonas spp., while alginate and siderophores are involved in the triggering of chronic infections [1].Many researchers have reported the antimicrobial activity of Pseudomonas spp. against fungi, Gram positive cocci and Gram-negative diplococci but not species of Gram-negative bacilli. This inhibitory activity is attributed to secretion of compounds with antimicrobial activity such as phenazines, pyrrolnitrin, and pseudomonic acid [2, 3]. Also, many studies have demonstrated the effectivity of Pseudomonads as biocontrol agents due to their inhibitory activity against soil microbes and fungi, suggesting that the antimicrobial properties can be deployed as biological pesticides in place of organic or inorganic chemical pesticides for use in agriculture [4, 5]P. aeruginosa plays an important role in cystic fibrosis infection and infections associated with burns; here it can be co-isolated with Candida albicans [6]. It has been found that Pseudomonas spp. can inhibit the growth of many fungi such as Cryptococcus spp. and C. albicans [7-10]. Colonization by Pseudomonas spp. and C. albicans is regulated by selective pressure exerted by low nutrient availability and bacterial-fungal competition. When equilibrium is disrupted, opportunistic infections arise [11]. P. aeruginosa reacts with C. albicans antagonistically by killing C. albicans hyphal cells through alteration of cell wall via the action of pyocyanin [12] or reversion of the formation of germ tubes. Resistance of C. albicansyeast cells against the killing effect of P. aeruginosa is possibly connected to O-linked mannans [9, 13].Fifty natural phenazine compounds are produced by Pseudomonads [14, 15]. Phenazines are colorful, nitrogen—containing products possessing antifungal and antibacterial activity [16]. One of the most toxic phenazines is 5-methyl-phenzaine-1-carboxylic acid, which shows greater toxicity compared with pyocyanine (5-methylphenazine-1-one). Furthermore, studies show that fungal death can be induced by 5-methyl-phenazine-1-carboxylic acid more efficiently than PCA (phenazine-1-carboxylic acid) and pyocyanine when C. albicans and P. aeruginosa are cultured together [7, 17].Phenazines such as pyocyanine increase the virulence of P. aeruginosa by impairing the engulfing action of apoptotic cells, respiration of mammalian cells, and beating of human cilia in the respiratory system [18, 19]. Furthermore, it has been found that virulence decreases in MDR P. aeruginosa by decreasing pyocyanin production [17, 20]. The inability to produce pyocyanin lowers the pathogenicity of Pseudomonas spp. which is also found to be highly susceptible to immune defense [21]. Pseudomonas-competing microorganisms are eliminated by the antimicrobial effect of pyocyanin; this provides a significant advantage that helps Pseudomonas organisms to predominate in co-cultures [22-25].Other studies show that quorum sensing controls interaction between P. aeruginosa and C. albicans where N-acyl homoserine lactone plays a sensory role for induction of target site expression [26]. It is also reported that production of pseudomonal surface adherence proteins is dependent on 3-oxo-HSL (3-oxododecanoyl- L-homoserine lactone) as this autoinducer is required for Pseudomonal adherence to Candida hypha [27].This work studied the anticandidal activity and the virulence profile of fifteen P. aeruginosa isolates, the distribution of virulence factors among P. aeruginosa, and their association with anticandidal activity.
Methods and materials
Isolation and identification
One hundred fifty samples were collected from intensive care unit (ICU) patients suffering from different infections (septicemia, pulmonary, wound and urinary tract infections) as part of the routine hospital laboratory procedures. Samples were processed and cultured using traditional microbiological procedures to isolate and identify isolates. It was found that out of these 150 samples, 50 samples were positive for P. aeruginosa and 8 samples were positive for different Candida spp. Co-existence of P. aeruginosa and the isolated Candida was observed in 6 samples (4 skin swab and 2 urine samples). Complete identification to the isolated strains was undertaken as follows:P. aeruginosa isolates were identified by Gram-stain, colony morphology, and ability to grow on cetrimide agar at 42°C. The isolated colonies were tested for their biochemical characteristics (catalase, oxidase, triple sugar iron, urease, and sulfide indole motility). Colonies were purified by streaking and stored at—80°C in stocks with 2.5 M glycerol. We selected 15 P. aeruginosa of which 6 isolates (P5, P8, P9, P16, P100 and P85) were isolated in association with the Candida isolates to be incorporated in this study.Candida strains were cultured on Sabouraud dextrose agar (Lab M, UK). Eight Candida strains were identified by macroscopic features (morphology, color, size, and texture) on Sabouraud’s dextroseagar (SDA) and CHROMagar Candida (CHROMagar Candida, France) showing 6 C. albicans and 2 C. krusei. (C. albicans isolated from samples positive for P. aeruginosa were C5, C9, C16 and C100 while C. krusei isolated from samples positive for P. aeruginosa were C8 and C85). Two C. glabrata (CT1 and CT9) were obtained from the department of Microbiology and Immunology, Faculty of Pharmacy, Minia University to be included in our study. Preservation of isolates were maintained at −70°C in Trypticase Soya Broth (TSB, Becton and Dickinson) with 10% glycerol.
Cross-streak method
P. aeruginosa strains were incubated overnight at 37°C in order to prepare fresh cultures; from these, an inoculum was prepared in 0.9% NaCl. P. aeruginosa strains were cross streaked at 1cm width with sterile cotton swab on Sabouraud dextrose agar and incubated for 24 hrs. After overnight incubation at 37°C. P. aeruginosa growth was removed by sterile glass slide. In a safety cabinet, sterile filter paper soaked in chloroform was placed in the cover of petri dishes from which the cultures of P. aeruginosa were removed with the sterile slides. Then, plates were covered and inverted to the face containing chloroform filter papers for 30 minutes in order to kill the microscopic cultural remnants. After 30 minutes, chloroform filter papers were removed, and plates were exposed to air for a few minutes to eliminate chloroform traces. Freshly prepared Candida cultures were streaked onto P. aeruginosa-Sabouraud Dextrose Agar plates. Streaking was performed perpendicularly to the original line of P. aeruginosa culture then plates were incubated at 37°C overnight. Plates were tested for Candida growth inhibition as follows: -, no inhibition; +, 25% inhibition; ++, 50% inhibition; +++, 75% inhibition; ++++, 100% inhibition of Candida culture line [3]. Blood agar culture media is also used with the same previous procedure in Kerr’s method in order to detect the anticandidal activity of P. aeruginosa strains [28].
The effect of the tested P. aeruginosa on the morphology of Candida spp.
Using light microscope to test the effect of cell-free filtrate of P. aeruginosa on the growth of candida cells
P. aeruginosa isolates showing anticandidal activity were inoculated into 10 ml of Trypticase soya broth (TSB) and incubated at 37°C for 2 days. Then, centrifuged at 10000x g for 15 minutes. Supernatants were exposed to filtration using sterile bacterial filters 0.2 μm. The filtrate was kept at 4°C until use. Fresh overnight culture suspension (20 μl) of the tested strains of C. albicans and C. krusei (each alone) was added to half ml of fresh human serum (peptone water, human plasma, or TSB can be also used for germ tube production) that was distributed in 7 tubes for each of the tested Candida (C. glabrata does not form germ tube). Cell free filtrate of the 15 P. aeruginosa isolates were added to tubes. One tube for each Candida isolate was used as a control containing human serum inoculated with Candida albicans or C. krusei without adding P. aeruginosa cell free filtrate. Tubes were tested for germ tube formation using light microscope (Lecia, Germany) after 3 hrs incubation at 37°C.
Using Scanning Electron Microscope (SEM)
P. aeruginosa isolates showing anticandidal activity were co-cultured with C. albicans in trypticase soya broth (TSB) at 37°C for 48 hrs. Then, samples were prepared for SEM. Cells were fixed in 2.5% glutaraldehyde for 1 hour at 4°C, followed by rinsing cells with phosphate buffer saline (PBS). Series of ethanol drying was performed. Samples were coated with gold using cathodic spraying. Finally, examination was performed using JSM-840 SEM (JEOL Ltd., Tokyo, Japan) [29].
Polymerase chain reaction (PCR)
Nutrient broth medium was used to culture P. aeruginosa isolates, the cultures were then incubated at 37°C overnight. The DNA template was prepared by the boiling method. The sample is collected in a microtube and centrifuged to be concentrated. The supernatant is discarded and resuspended in the lysis buffer. This suspension is boiled for 10 minutes for cell lysis and DNA release. Finally, a brief centrifugation is performed to pellet cell debris and the supernatant containing the nucleic acid is transferred to a new microtube, and used directly in the PCR assay [30].PCR reaction mixture was undertaken using 25 μl reaction volumes containing 12.5 μl master mix (Bioline, USA), 1 μl of each 10 μmol−1 forward and reverse primers (Laboratories Midland Certified Reagent Company Inc.), 2 μl DNA template and 8.5 μl pyrogen-free water. PCR cycling using miniPCR from Amplyus (MA, USA) was performed using the conditions summarized in Table 1 as previously described [1, 25]. PCR products were analyzed using 1.5% agarose stained with Gel-Green (CA, USA) in blueGel electrophoresis unit powered with a current of 48 V obtained from blueGel built-in power supply (AC 100–240 V, 50–60 hz).
Table 1
List of primers used in this study.
Gene
Primer sequence (5’ 3’)
PCR product (bp)
Conditions
phzABCDEFG
F: CCGTCGAGAAGTACATGAAT
484
30 cycles of 94˚C for 30s, 60˚C for 30s, and 72˚C for 30s.
R: CATAGTTCACCCCTTCCAG
phzM
F: AACTCCTCGCCGTAGAAC
313
30 cycles of 94˚C for 30s, 60˚C for 30s, and 72˚C for 30s.
R: ATAATTCGAATCTTGCTGCT
phzs
F: TGCGCTACATCGACCAGAG
664
30 cycles of 94˚C for 30s, 60˚C for 30s, and 72˚C for 30s.
R: CGGGTACTGCAGGATCAACT
algD
F: CGTCTGCCGCGAGATCGGCT
313
30 cycles of 1 minutes at 94 °C,1.5 minutes at 60°C, and 1 minutes at 72°C
R: GACCTCGACGGTCTTGCGGA
lasB
F: GGAATGAACGAAGCGTTCTCCGAC
284
30 cycles of 1 minutes at 94°C,1.5 minutes at 60°C, and 1 minutes at 72 C.
R: TTGGCGTCGACGAACACCTCG
toxA
F: CTGCGCGGGTCTATGTGCC
270
30 cycles of 1 minutes at94 °C, 1.5 minutes at 6 °C, and 1 minutes at 72 °C.
R: GATGCTGGACGGGTCGAG
plcH
F: GCACGTGGTCATCCTGATGC
608
30 cycles of 1 minutes at 94 °C,1.5 minutes at 60°C, and 1 minutes at 72°C.
R: TCCGTAGGCGTCGACGTAC
plcN
F: TCCGTTATCGCAACCAGCCCTACG
481
30 cycles of 1 minutes at 94 °C,1.5 minutes at 60°C, and 1 minutes at 72°C
R: TCGCTGTCGAGCAGGTCGAAC
exoS
F: CGTCGTGTTCAAGCAGATGGTGCTG
444
30 cycles of 1 minutes at 94 °C,1.5 minutes at 60°C, and 1 minutes at 72°C.
R: CCGAACCGCTTCACCAGGC
Lipopolysaccharide SDS- polyacrylamide gel profile for P. aeruginosa with anticandidal activity
Lipopolysaccharide (LPS) of the tested isolates were extracted and purified by hot aqueous- phenol method [31] and analyzed the purified material using SDS-PAGE, followed by carbohydrate-specific silver staining [32].
GC-MS analysis of the extracted LPS
LPS fatty acids, whole cell phospholipids, and whole cell fatty acids were derivatized to fatty acid methyl esters by methanolysis in 2 M methanolic HCl at 80°C for 18 hrs with the addition of pentadecanoic acid as an internal standard. After the addition of an equal volume of saturated NaCl solution, the methyl esters were extracted with hexane and analyzed by gas chromatography/ mass spectrometry and the compounds were identified by ChemSpider Database [33].
Statistical analysis
Statistical analyses were done using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA). One-Way ANOVA was employed to evaluate any significant difference between the prevalence of the tested factors among the different sources of samples. P< 0.05 indicates significant difference.
Results and discussion
C. albicans and P. aeruginosa are commonly able to form resistant biofilms and they are often found in mixed infections, especially in cystic fibrosis and immunosuppressed patients. Many researchers have studied the way by which these organisms can co-exist with each other, concluding that their interaction is mainly antagonistic [17, 34, 35]. However, other studies showed that their interaction may be antagonistic or synergistic depending on environmental parameters like growth state. For example, low concentration of phenanzines will inhibit hyphal growth switching Candida respiration to fermentation leading to formation of ethanol which in turn caused feedback potentiation of P. aeruginosa in a synergistic manner [36].Our results revealed that the tested P. aeruginosa showed variable antifungal activity against all tested Candida strains. Strains that were isolated from samples positive for Candida such as P5, P8, P9, P16, and P100 showed variable inhibitory activity against all tested Candida isolates (50–100% inhibition). PSA2 inhibited C. glabrata only. In addition, PS1, PS2, PS3, PSA1, P82 and P85 showed no or only low inhibitory activity (0–50% inhibition) according to the tested Candida isolates. On the other hand, three Pseudomonas isolates (P118, P111 and P93) did not show any inhibitory activity at all against the tested Candida (Table 2 and Fig 1).
Table 2
Distribution of anticandidal activity, phenazine genes and different virulence factors genes among the tested P. aeruginosa.
Candida spp.
Phenazine genes*
Virulence genes*
Inhibition of germ tube**
Source of samples
C. albicans
C. glabrata
C. krusei
phzP
phzS
phzM
toxA
algD
lasB
exoS
plcN
plcH
C5 /C9
CT1/CT9
C8/C85
P5
++++/++++
++++/++
++++/++++
+
+
+
+
+
+
+
+
+
+
Blooda
P8
++++/++++
+++/++++
++++/++++
+
+
+
+
+
+
+
-
+
+
Blooda
P9
++++/++++
++++/++++
++++/++++
+
+
+
+
+
+
+
+
+
+
Sputuma
P16
++++/++
+++/+++
+++/++++
+
+
+
+
+
+
+
+
+
+
Sputuma
P100
++++/++++
++++/++++
++++/++++
+
+
+
+
+
+
+
+
+
+
Blooda
PS1
-/-
-/-
-/+
+
-
+
+
+
+
-
-
-
+
Woundb
PS2
-/-
+/+
-/+
+
-
+
+
+
+
-
+
-
+
Woundb
PS3
+/+
-/-
-/+
+
-
+
+
+
+
+
-
+
+
Woundb
P82
-/-
-/-
-/+
+
-
+
+
+
-
-
+
-
+
Urineb
P85
++/++
-/-
-/+
+
-
+
+
+
-
+
+
+
+
Woundb
PSA1
-/-
+/-
-/+
+
-
+
+
+
+
-
+
-
+
Urineb
P93
-/-
-/-
-/-
-
-
-
+
+
+
+
+
+
-
Urineb
P118
-/-
-/-
-/-
-
-
-
+
+
+
-
-
+
-
Urineb
P111
-/-
-/-
-/-
-
-
-
+
+
+
+
-
+
+
Urineb
PSA2
-/-
++++/++++
-/-
+
+
-
+
+
+
-
-
-
-
Urineb
Anticandidal activity was interpreted as follows: -, no inhibition; +, 25% inhibition; ++, 50% inhibition; +++, 75% inhibition; ++++, 100% inhibition with respect to Candida culture line.
* the tested genes results were presented as–indicating the absence of the gene and + indicating the presence of the gene.
**Germ tube inhibition test was done for C. albicans and C. krusei only: +, means germ tube formation inhibition.—: means germ tubes are not inhibited.
a and b: refer to the significant differences among different source of infections in the virulence profiles in which samples carrying the same letter a or b had no significant difference while those with different letters had significant difference. P<0.05 significant value.
Fig 1
Anticandidal activity of the tested P. aeruginosa against 6 Candida Spp.
A: showed complete inhibition by P5 strain to 5 Candida strains and showed (50%) ++ inhibition of C. glabrata. B: showed variable activity of PS2 strain against the tested Candida: no inhibition was observed against C. albicans and one C. krusei; 25% (+) inhibition against one C. krusei and the tested C. glabrata.
Anticandidal activity of the tested P. aeruginosa against 6 Candida Spp.
A: showed complete inhibition by P5 strain to 5 Candida strains and showed (50%) ++ inhibition of C. glabrata. B: showed variable activity of PS2 strain against the tested Candida: no inhibition was observed against C. albicans and one C. krusei; 25% (+) inhibition against one C. krusei and the tested C. glabrata.Anticandidal activity was interpreted as follows: -, no inhibition; +, 25% inhibition; ++, 50% inhibition; +++, 75% inhibition; ++++, 100% inhibition with respect to Candida culture line.* the tested genes results were presented as–indicating the absence of the gene and + indicating the presence of the gene.**Germ tube inhibition test was done for C. albicans and C. krusei only: +, means germ tube formation inhibition.—: means germ tubes are not inhibited.a and b: refer to the significant differences among different source of infections in the virulence profiles in which samples carrying the same letter a or b had no significant difference while those with different letters had significant difference. P<0.05 significant value.Light microscopic examination showed that cell free filtrate of P. aeruginosa inhibited germ tube formation of the tested Candida (C. albicans and C. krusei) (Fig 2B) in comparison to control cells (Fig 2A). Bandara, Yau [34] reported that the interaction among P. aeruginosa and 5 non-C. albicansCandida species was variable and species-specific; a finding that is in agreement with our results. Also, in keeping with our observations, variation in the effect of the tested P. aeruginosa on the tested Candida species was reported by Xu, Zeng [10]. In particular, some P. aeruginosa exhibited high antifungal activity and some showed partial or no activity against the tested Candida spp.
Fig 2
A: C. albicans forming germ tube after their incubation in human serum for 3 hrs. B: showed C. albicans with no observable germ tubes after their incubation in human serum containing P. aeruginosa culture cell free filtrate for 3 hrs.
A: C. albicans forming germ tube after their incubation in human serum for 3 hrs. B: showed C. albicans with no observable germ tubes after their incubation in human serum containing P. aeruginosa culture cell free filtrate for 3 hrs.Strains of P5, P8, P9, P16 and P100 were positive for all phenazine genes while PS1, PS2, PS3, PSA, P82 and P85 were positive for phzP and phzM. PSA2 was positive for phzP and phzS. Furthermore, it was observed that P118, P111 and P93 were each negative for all tested phenazine genes (Table 2 and Fig 3A).
Fig 3
A: shows amplicons for phenazines encoding genes. B: shows amplicons for different virulence genes of the tested P. aeruginosa.
A: shows amplicons for phenazines encoding genes. B: shows amplicons for different virulence genes of the tested P. aeruginosa.One of the most common characteristics of P. aeruginosa symptoms is the presence of blue pigmentation in the pus of wounds or in the sputum, especially in case of pulmonary infections. This is due to the production of the redox active metabolite pyocyanin, a toxin. Pyocyanin production is controlled by 2 core loci (operon phz A1B1C1D1E1F1G1 and phz A2B2C2D2E2F2G2) which are responsible for the synthesis of phenazine-1-carboxylic acid (PCA) and 2 genes (phzM and phzS) encoding enzymes responsible for the conversion of phenazine-1-carboxylic acid to pyocyanin. Mavrodi, Bonsall [37] and Nowroozi, Sepahi [25] reported that the presence of both phzM and phzS are essential for pyocyanin production, a finding which may explain the decrease in the antifungal activity of strains that were negative for one of these genes or negative for both.All tested P. aeruginosa isolates were positive for toxA and algD genes, and 13 strains of the tested P. aeruginosa were positive for and LasB genes. In addition, 11 P. aeruginosa samples were positive for pLcH and 9 isolates were positive for exoS and pLcN. Table 2 and Fig 3B showed that the 5 P. aeruginosa showing inhibitory activity against all tested Candida were positive for all virulence genes except P8, which was negative for pLcN. Many studies have reported on the important role of P. aeruginosa virulence factors in the development and the severity of disease and in relation to the killing effect on Candida Spp. [10, 38]. Caldwell, Chen [35] and Taylor, Machan [39] showed that type IV pili, phospholipase C, phenazines, pyocyanin and pseudomonasquinolones secreted molecules showed inhibiting activity on Candida species, a finding which is in agreement with our results.Elastase B or pseudolysin is a Zn dependent metallo-endopeptidase enzyme which is regulated by the expression of LasB gene controlled by quorum sensing transcription system Las and rhl [40]. This enzyme plays an important role in the invasiveness of P. aeruginosa during infection. It can degrade the extracellular matrix of the host cells such as elastin, vitronectin, fibronectin and collagen. In addition, it affects several components of the immune defense and some component of complement system [41, 42]. Also, LasB is necessary for biofilm formation [43]. The expression of algD gene is usually associated with the production of the mucoid colonies that protect the microorganism from the host defense factors, antibiotics and initiate colonization and adhesion to cells. Exoenzyme S is encoded by exoS gene which is ADP ribosyltransferase secreted by type III secretion system and this exhibits a cytotoxic effect while phospholipase C enzymes are encoded by plcH and plcN genes, enabling them to hydrolyze phospholipids [44, 45]. Phospholipase C enzymes of P. aeruginosa were found to recognize membrane phospholipids of eukaryotic cells. There are 2 types of phospholipases: plcH with hemolytic activity and plcN with no hemolytic activity. These enzymes were found to affect neutrophils activity, decreasing phagocytosis and increasing their survival during infection [46]. Previous studies showed that Candida spp. possess similar eukaryotic phospholipid membranes containing phosphatidyl choline and phosphatidyl serine. Also, Oura and Kajiwara [47] reported that sphingolipids present in Candida membranes play important role in the morphogenesis of C. albicans, pathogenesis and hyphal elongation. Hence, phospholipase enzymes production can affect C. albicans morphogenesis and pathogenicity.Exotoxin S is a cytotoxin that is characterized as ADP-ribosylating enzymes for several proteins such as lipoprotein A, IgG3 and several Ras super family proteins. The Ras super family proteins are responsible for the regulation of cell proliferation, survival, and differentiation in human cells. Therefore, enzymes affecting these proteins play role in the pathogenesis of the organism during infection [48]. In Candida albicans, morphogenesis is stimulated by the presence of sugars, amino acids or serum via activating adenylate cyclase by different pathways [49]. Leberer, Harcus [50] reported that Ras super family controls the morphogenesis of C. albicans and the formation of true hyphae by activating adenylate cyclase after their activation by phosphorylated glucose, which indicates that exoS enzyme may affect hyphae formation by their effect upon Ras super family proteins. Additionally, ExoS has a GTPase-activating protein (GAP) activity targeting eukaryotic cells proliferation, DNA synthesis and cell morphogenesis.Our results showed that pseudomonas strains isolated from blood and sputum were positive for the tested phenazine and virulence genes. Also, showed a powerful anticandidal activity against the tested Candida species. On the other hand, strains isolated from urine and swab samples showed variable activity against the tested Candida and variability in their virulence (Table 2). Hickey, Schaible [51] reported similar results. As they showed that Pseudomonas aeruginosa isolated from blood stream were more virulent than those isolated from peripheral sites which may be attributed to the bloodstream microenvironment and the prevalence of several proteins (LecA, RNA polymerase sigma factor 54, and proteins important for cellular metabolism and replication) stimulating the expression of many virulence factors. So, the present work confirmed a strong relationship between different virulence factors distributed among P. aeruginosa isolates and their ability to inhibit Candida hyphae (Table 2). Accordingly, P. aeruginosa strains showing clinical manifestations in patients such as septicemia, pneumonia, urinary infections or wound infections have potent anticandidal activity.In the study, LPS SDSpolyacrylamide gel for 4 P. aeruginosa with anticandidal activity and 2 isolates with no anticandidal activity was performed. The lipopolysaccharide profile revealed the presence of Lipid A core and O-antigen repeats that appeared after performing silver staining in strains with anticandidal activity. One (P111) of isolates with no anticandidal activity but no band for lipid A core was observed in the other strain with no anticandidal activity (P) (Fig 4).
Fig 4
LPS SDS-polyacrylamide gel profile stained by silver nitrate.
Lanes 1, 2, 3&4 (P5, P8, P9 and P16 isolates with anticandidal activity). Lane 5 and Lane 6 (P111 and P118 isolates with no anticandidal activity).
LPS SDS-polyacrylamide gel profile stained by silver nitrate.
Lanes 1, 2, 3&4 (P5, P8, P9 and P16 isolates with anticandidal activity). Lane 5 and Lane 6 (P111 and P118 isolates with no anticandidal activity).Lipopolysaccharide profile analysis revealed the presence of Lipid A core and O-antigen repeats in P. aeruginosa isolates with anticandidal activity; while isolates showing no anticandidal activity showed a different LPS profile, except one (P111) that showed a similar LPS profile to those with anticandidal activity. It has been previously reported that LPS of Gram-negative bacteria play a role in the interaction between bacteria and Candida spp. in mixed infections. The interaction is usually mediated by hydrophobic-electrostatic or among cell surface molecules or bacterial lipopolysaccharide and quorum sensing molecules [52, 53]. Bandara, Yau [54] and Bandara, Lam [53] showed that LPS of P. aeruginosa, E. coli and some other Gram-negative bacteria has a direct modulatory effect upon the preformed in-vitro Candida biofilms. In addition, LPS increases the inhibitory effect of human polymorphonuclear leukocytes to Candida growth. Moreover, Bandara, K Cheung [55] reported that there was a growth difference between LPS treated Candida and the untreated Candida. As they observed, a reduction in the optical density in LPS treated Candida indicated the decrease in hyphae and yeast formation. Also, they reported that the formed biofilms appeared relative insubstantial and in the form of patchy aggregates of blastopores. Nevertheless, biofilms formed by the control strain showed well-structured filaments and dense sessile structures. In addition, the presence of LPS was found to affect ATP production by suppressing glycolysis.Another important observation was where GC/ Mass spectra indicated that strains with anticandidal activity showed peaks that were detected in the 320–537 m/z range. These were derived primarily from the presence of rhamnolipids, recording peaks in the range of 240–320, which refers mostly to the presence of quorum sensing quinolones secreted by P. aeruginosa. In addition, some bioactive metabolites with antimicrobial activity were detected. Isolates with high anticandidal activity showed spectrum for some bioactive metabolites, which were known to have antimicrobial activity such as propanoic acid, 2-mercapto, methyl ester, undecanoic acid, 3- hydroxyl, methyl ester, butanoic acid, 2- methyl, heptyl ester, 1H Indole, 5-methyl-2-phenyl, quorum sensing quinolones and rhamnolipids. The presence of these compounds was found to vary among the tested strains (Figs 5–7) but it was found that spectrum of PSA2 that affect only C. glabrata showed peaks for Quorum sensing quinolones and rhamnolipids (Fig 8).
Fig 5
Mass spectrum of the extracted LPS obtained from P8 isolate.
Mass spectrum of the extracted LPS obtained from PSA2 isolate.
A: Quorum sensing quinolones B: Rhamnolipids.Several bioactive materials were identified using GC/Mass spectroscopy and the traced compounds were characterized by ChemSpider Database. Many of these compounds were found to have antibacterial, antifungal and anti-inflammatory effects according to that reported by several previous studies [56-61]. In addition, GC/Mass spectra revealed the presence of peaks in the range of 320 to 537 m/z. These are indicative of the presence of rhamnolipids. Rhamnolipids are glycolipids biosurfactants that have previously been identified and reported by many researches. Rhamnolipids were first identified in 1949 [62]. These compounds were found to be essential for biofilm formation and maturation of P. aeruginosa, swarming motility and the dispersion and the spread of P. aeruginosa from the biofilm mass. These compounds have an antagonistic activity against many types of bacteria and fungi that help in the dominance of P. aeruginosa during infections [62, 63]. As an example, Briard, Rasoldier [64] showed that Rhamnolipids inhibit the growth of Aspergillus niger by inhibiting β-1,3 glycan synthase which is essential for cell wall synthesis [65, 66]. Furthermore, strains with anticandidal activity recorded peaks in the range of 240–320 m/z, a range that indicates the presence of quorum sensing quinolones molecules. These compounds in association with acyl homoserine lactones act on the regulation of genes encoding P. aeruginosa virulence factors such as pyocyanin production and elastases secretion [66].Scanning electron micrographs showed P. aeruginosa adhered to Candida cells with no hyphae and with disorganized and disrupted membranes (Fig 9A and 9B). P. aeruginosa tends to attach to filaments of Candida by their pili and killing it for gaining nutrients helping their growth [38]. Hogan and Kolter [38] showed that P. aeruginosa attached to Candida filaments in biofilm environment while Candida in the yeast form remains viable. Pugh and Cawson [67] reported that Candida albicans invasion to membranes depends on the conversion of blastospores to hyphae with phospholipase activity concentrated at the growing tip of the germ tube. So, hyphae formation is essential for the production of phospholipases. P. aeruginosa will attack filaments formed by C. albicans decreasing their ability to produce phospholipases. On the other hand, Pugh and Cawson [67] reported that non-albicans Candida are negative for phospholipase activity and C. albicans showed variable ability to produce phospholipases showing high quantity in blood borne infections. Clancy, Ghannoum [68] showed that non-albicans Candida may produce phospholipases but in very low amount (10 times much lower than C. albicans). According to these previous findings P. aeruginosa is able to inhibit the Candida hyphae growth as Pseudomonas spp. forms biofilm on C. albicans hyphae and kills the filamentous cells. So, it has been suggested that only the filamentous form of C. albicans, not the yeast form, is affected by Pseudomonas spp.
Fig 9
Scanning electron micrograph showing P. aeruginosa adhered to C. albicans after incubating the 2 organisms together for 48 hrs.
A: Candida cells showed irregular cell wall and some disrupted cells with no observable hyphae and scattered P. aeruginosa cells. B: SEM graph showed candida cells with disorganized and disrupted cell wall after their incubation with P. aeruginosa culture cell free filtrate.
Scanning electron micrograph showing P. aeruginosa adhered to C. albicans after incubating the 2 organisms together for 48 hrs.
A: Candida cells showed irregular cell wall and some disrupted cells with no observable hyphae and scattered P. aeruginosa cells. B: SEM graph showed candida cells with disorganized and disrupted cell wall after their incubation with P. aeruginosa culture cell free filtrate.
Conclusion
Clinical isolates of P. aeruginosa showed many virulence factors, which in turn contributed to the isolates’ pathogenicity and; hence, Candida species-specific interactions through different ways. This finding gave rise to the importance of studying microbial virulence genes and their relation to microbial interaction in polymicrobial infections and their contribution to several diseases. Also, as the currently available antifungal agents in the market are limited due to their toxicity, low effectiveness, and cost for prolonged treatment. So, it is important to develop new antifungal agents which can overcome these problems.(ZIP)Click here for additional data file.6 Aug 2020PONE-D-20-17124Virulence profiles of some Pseudomonas aeruginosa clinical isolates and their association with the suppression of Candida growth in polymicrobial infectionsPLOS ONEDear Dr. Abd El-Baky,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Sep 20 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Shankar Thangamani, DVM, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for including the following ethics statement on the submission details page:'"N/A" because samples are collected as part of the routine hospital laboratoryprocedures.'Please also include this information in the ethics statement in the Methods section of your manuscript.3.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.4. Please ensure that you refer to Figure 1 in your text as, if accepted, production will need this reference to link the reader to the figure.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: NoReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This manuscript demonstrates natural phenazine compounds produced by Pseudomonas, and describe anticandidal activity against 3 different Candida spp. Then they also checked the effect on hyphae production and some virulence gene. Finally they analyzed the fatty acids by GC-MS as methyl ester derivatives. Manuscript needs more refinements in addition to several issues which need to be addressed.1) Candida should be mentioned in ilatics in line no. 2.2) The spelling of C. krusi is wrong, it should be C. krusei.3) Please be accurate in writing the degree centigrade unit.4) Candidal can be replaced by Candida in line no. 99.5) "and" before 42°C can be removed in line no. 113.6) It will be more appropriate to write Pseudomonas aeruginosa as P. aeruginosa instead of Ps. aeruginosa in methods section.7) Authors can also use one more method for determining antibacterial activity.8) Please convert rpm into g in line no. 145.9) There is no uniformity of using units as somewhere written µl or µL. Please correct this throughout the manuscript.10) Please mention the full name of light microscope company mentioned in line no. 152. Same should be written in line no. 167.11) Please ensure to write either hour or hours throughout the manuscript like in line no. 153, hours is written and in line no. 156, it is written hrs.12) figure 3B is written in line no. 228, authors have written as Figure throughout the manuscript, please be uniform.13) Authors have used only single method for germ tube formation. There are many other hypha inducing media for studying the effects on germ tube formation. I would recommend the authors to use one more method to validate the observations.14) Please mention the reference for method used for SEM, generally 4% glutaraldehyde is used for fixing the cell. After drying with ethanol, TMS/HMDS is used after drying and before sample mounting.15) In section, 2.4, the method used for DNA isolation is unclear. Please mention the protocol used briefly.16) Phospholipases enzyme are also secreted by C. albicans to degrade the host tissues (https://pubmed.ncbi.nlm.nih.gov/9467900/). So, it is unclear that how the phospholipases of one species affect the phospholipases of another species belonging to same class. Please put some more evidences to support you findings.17) Please recheck the references no. 1 and 44.18) Figures resolution and clarity should be ensured. Some words are blurred due to over zooming.19) Authors have mentioned only about the antagonistic relation of P.aeruginosa and C. albicans where as this is not always the case. Please refer to this article Dhamgaye, S., Qu, Y., & Peleg, A. Y. (2016). Polymicrobial infections involving clinically relevant Gram-negative bacteria and fungi. Cellular microbiology, 18(12), 1716–1722. https://doi.org/10.1111/cmi.12674 (Studies have showed both antagonistic and synergistic interactions, depending on diverse environmental factors, timing of interaction, and growth state at the time of interaction. A lower concentration of phenazines impaired hyphal growth of C. albicans and more importantly switched fungal respiration to fermentation leading to the production of ethanol, glycerol, and acetate by C. albicans in glucose containing media (Morales et al., 2013). It was shown that C. albicansethanol production not only influenced biofilm maturation but also promoted more phenazine production by P. aeruginosa through WspR‐dependent activation of Pel exopolysaccharide (Chen et al., 2014). The spectrum of P. aeruginosaphenazines produced was in favor of those most effective against fungal cells and led to greater production of ethanol by C. albicans , forming a feedback loop driving the polymicrobial interaction towards the protection of P. aeruginosa (Chen et al., 2014).It has now been shown that Candida colonization of the respiratory tract may promote the development of pseudomonal VAP and has been associated with the presence of multidrug‐resistant bacteria (Azoulay et al., 2006; Hamet et al., 2012). The laboratory studies characterizing the diverse interactions between Candida and Pseudomonas highlight the real complexities of their interaction, and questions still remain as to how they apply during humaninfection.20) The manuscript is not thoroughly written, it need lots of language and grammar refinements.21) There is nothing written about the statistical significance (p value) of the work.22) The conclusion is not represented very well. Authors can rewrite this section.23) The work is good but lacks the novelty as many previous studies have reported the interaction of both species in polymicrobial infections.Reviewer #2: Major comments:The authors should clarify the link between P. aeruginosa virulence and anticandidal activity in relation to clinical severity in patients. Did the strains with potent anticandidal activity show clinical manifestations in patients specific to Pseudomonas such as (pneumonia, urinary infections or wound infections) or there was no link. Please clarify and include this in discussion section. This is important since both pseudomonas and candida are opportunistic pathogens and they are part of normal flora in healthy individuals.Minor Comments:1-The authors should list the site of lesions for all isolated strains and clinical diseases of affected patients if there is any.2-Conclusion should be expanded to highlight the significance of the study.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.1 Oct 2020Response to reviewers were uploaded with the corrected ManuscriptSubmitted filename: Response to Reviewers.docxClick here for additional data file.23 Nov 2020Virulence profiles of some Pseudomonas aeruginosa clinical isolates and their association with the suppression of Candida growth in polymicrobial infectionsPONE-D-20-17124R1Dear Dr. Abd El-Baky,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Rashid NazirAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #2: (No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2: (No Response)**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #2: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: No27 Nov 2020PONE-D-20-17124R1Virulence profiles of some Pseudomonas aeruginosa clinical isolates and their association with the suppression of Candida growth in polymicrobial infectionsDear Dr. Abd El-Baky:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr Rashid NazirAcademic EditorPLOS ONE
Authors: Charles C Caldwell; Yi Chen; Holly S Goetzmann; Yonghua Hao; Michael T Borchers; Daniel J Hassett; Lisa R Young; Dmitri Mavrodi; Linda Thomashow; Gee W Lau Journal: Am J Pathol Date: 2009-11-05 Impact factor: 4.307