Literature DB >> 33287879

Molecular identification of four Sarcocystis species in cattle from Lithuania, including S. hominis, and development of a rapid molecular detection method.

Petras Prakas1, Živilė Strazdaitė-Žielienė2, Vytautas Januškevičius2,3, Francesco Chiesa4, Agnė Baranauskaitė2, Eglė Rudaitytė-Lukošienė2, Elena Servienė2, Saulius Petkevičius3, Dalius Butkauskas2.   

Abstract

BACKGROUND: Six Sarcocystis species are known to use cattle (Bos taurus) as the intermediate host, two of which, S. hominis and S. heydorni, are zoonotic. There is a need for a method that will enable rapid identification of the Sarcocystis species in cattle.
METHODS: The diaphragm muscles of 102 cattle from Lithuania were examined for the presence of Sarcocystis spp., using two different methods for species identification. Individual sarcocysts were isolated from squash preparations of the diaphragm muscle under the light microscope, followed by genetic characterisation of excised cysts using sequence analysis of the 18S rRNA (18S rRNA) and cytochrome c oxidase subunit I (cox1) genes. The same cattle muscle samples were digested and species-specific PCR analyses targeting cox1 were developed to identify the Sarcocystis isolates to the species level.
RESULTS: Under the light microscope, sarcocysts were detected in 87.3% of animals, and Sarcocystis infection was verified in all digested samples. Three species, namely S. cruzi (n = 20), S. bovifelis (n = 23) and S. hirsuta (n = 6), were identified by DNA sequence analysis of isolated sarcocysts. Based on sequence analysis of cox1, the level of genetic variability depended on Sarcocystis species and geographical location. Four Sarcocystis species, S. cruzi (96.1%), S. bovifelis (71.6%), S. hirsuta (30.4%) and S. hominis (13.7%), were confirmed in the digested samples. In individual samples, the most common finding was two species of Sarcocystis (44.1%), followed by three species (26.5%), a single species (24.5%) and four species (4.9%).
CONCLUSIONS: Although examination of tissue preparations under the light microscrope did not detect any sarcocysts belonging to S. hominis, this species was identified in the digested samples subjected to a cox1-specific PCR analysis. These results demonstrate the need for effective molecular diagnosis techniques to detect Sarcocystis spp., which may be present at a lower prevalence and not detectable among the limited number of sarcocysts identified individually under the light microscope.

Entities:  

Keywords:  18S rRNA gene; Cattle; Molecular identification; Sarcocystis hominis; Trypsin digestion; cox1

Mesh:

Substances:

Year:  2020        PMID: 33287879      PMCID: PMC7720396          DOI: 10.1186/s13071-020-04473-9

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Protozoan parasites of the genus Sarcocystis (Apicomplexa: Sarcocystidae) infect mammals, birds and reptiles. The genus is characterised by an obligatory two-host life-cycle and endogenous sporulation. These parasites form sarcocysts mainly in the muscle tissues of the intermediate hosts and develop oocysts and sporocysts in the small intestine of the definitive hosts [1]. Three Sarcocystis species, S. suihominis, S. hominis and S. heydorni, are known to infect humans as definitive hosts [2-4]. The latter two species can be found in the muscles of cattle (Bos taurus), while humans may become infected by consuming raw/undercooked beef containing mature sarcocysts of S. hominis and S. heydorni. There has been much debate about the validity and classification of several Sarcocystis species from cattle, as well as their specificity to the intermediate host [5-8]. Current consensus is that that cattle may harbour up to six Sarcocystis species, namely S. bovifelis, S. bovini, S. cruzi, S. heydorni, S. hirsuta and S. hominis [4, 8–11]. As morphological analysis is not commonly sufficient to identify Sarcocystis species in cattle [12-14], the need for molecular methods is increasing. Sarcocystis spp. from cattle have been molecularly characterised at the genes for 18S rRNA (18S rRNA), 28S rRNA (28S rRNA) and cytochrome c oxidase subunit I (cox1) and at nuclear rDNA internal transcribed spacer 1 (ITS1) [8, 10, 11, 15]. Databases contain many 18S rRNA gene sequences of the genus Sarcocystis used for species identification [16-18]. However, studies have revealed that cox1 is the preferable target to differentiate taxonomically related Sarcocystis spp. whose intermediate hosts are such ruminants as cattle, sheep, goats, deer and others [19]. In Lithuania, the prevalence of Sarcocystis infection ranges from 44.9 to 98.1%, and infection has been recorded in six different muscle types of cattle [20]. However, the parasite species in the area under investigation have not yet been identified. In the study reported here, we isolated individual sarcocysts from squash preparations of muscle and then characterised the sarcocysts based on sequence analysis of 18S rRNA and cox1. We also report out development of a diagnostic technique to identify Sarcocystis species in cattle based on tissue digestion and PCR analysis using species-specific primers targeting cox1.

Material and methods

Samples and microscopic examination of sarcocysts

In 2017–2018, the diaphragm muscles of 102 cattle were collected from farmers and meat processing plants from all over Lithuania. The prevalence and density of Sarcocystis infection were evaluated in methylene blue-stained muscle specimens by counting sarcocysts per gram of sample according to Kirillova et al. [21]. The morphological analysis of sarcocysts was performed in freshly squashed preparations as described by Prakas et al. [22]. Sarcocysts were isolated from muscle fibres under a Nikon ECLIPSE 80i light microscope (Nikon Corp., Tokyo, Japan), at 40× or 100× magnification, and morphologically differentiated according to size and shape of sarcocysts, as well as the structure of the sarcocyst wall. Overall, 49 sarcocysts excised from the muscle tissues were separately preserved in 70% ethanol for molecular analysis.

Molecular analysis of sarcocysts

Genomic DNA was extracted from individual sarcocysts using the QIAamp® DNA Micro Kit (Qiagen, Hilden, Germany) tissue protocol according to the manufacturer’s recommendations. Sarcocystis species were identified by sequence analysis of 18S rRNA and cox1. The SarCF/SarDR primer pair was applied for 18S rDNA sequence amplification [23], while the SF1/SR9 primer pair was used to amplify cox1 sequences [19, 24]. The PCR conditions and product evaluation were as described previously [25]. The samples were sequenced directly with the 3500 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific, Foster City, CA, USA) using the same forward and reverse primers as for the PCR. The obtained sequences were compared with those of various Sarcocystis spp. by Nucleotide BLAST (megablast option). A total of 213 cox1 and 126 18S rRNA sequences were selected and aligned using the MUSCLE algorithm [26] included in the MEGA7 software [27]. TOPALi v2.5 software [28] was used to select a nucleotide substitution model with the best fit to the aligned sequence datasets and to construct phylogenetic trees under Bayesian inference. The intraspecific genetic variation indices, including the number of haplotypes (h), the number of segregating sites (S), haplotype diversity (Hd) and nucleotide diversity (π), were calculated for whole dataset and separate samples using DnaSP v6 [29]. Genetic differentiation for Sarcocystis spp. sample pairs was assessed with ΦST (i.e. the proportion of genetic diversity due to differences among populations) based on the Tamura-Nei distance [30] with Arlequin v. 3.5.2.2 [31]. The statistical significance of ΦST was tested by 10,000 permutations and at the 0.05 confidence level.

Trypsin digestion

Digestion of cattle diaphragm muscles was performed according to the optimised protocols of Verma et al. [32] and Chiesa et al. [33]. Following trypsin digestion of 20-g samples each in 50 ml of digestion solution (trypsin 1:250, 2.5 g/l phosphate buffered saline [PBS]) for 16 h at 37 °C in an incubator with stirring, the suspension was centrifuged for 5 min at 7000 rpm, following which the pellet was resuspended in 5 ml PBS and centrifuged for 3 min at 5000 rpm. The resulting pellet was resuspended in 5 ml PBS, and 300 µl of the suspension was used for DNA extraction.

Molecular analysis of digested samples

Genomic DNA was extracted from the digested samples using the GeneJet Genomic DNA Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania) according to the manufacturer’s protocol. The resulting DNA samples were kept frozen at − 20 °C until used as templates for PCR amplification of cox1. Primers targeting cox1 were designed with the help of Primer3Plus [34]. The primers designed for S. cruzi, S. bovifelis, S. bovini, S. heydorni, S. hirsuta and S. hominis are listed in Table 1. Each PCR was performed in a final volume of 25 μl containing 0.5 μM of each primer, dNTP mix (0.2 mM of each), 10× DreamTaq buffer with 20 mM MgCl2, 1.25 U DreamTaq polymerase (Thermo Fisher Scientific Baltics), 1 μg genomic DNA and nuclease-free water. The cycling conditions began with one cycle at 95 °C for 5 min, followed by 40 cycles at 94 °C for 45 s, 56 °C for 45 s and 72 °C for 45 s, and ending with one cycle at 72 °C for 10 min. PCR products were visualised by 1% agarose gel electrophoresis. The selected PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific Baltics) according to the manufacturer’s recommendations. Sequencing of the purified PCR fragments was performed, and the obtained sequences were compared by BLAST analysis. Differences in the prevalence of the identified Sarcocystis species were evaluated using Chi-squared test.
Table 1

Oligonucleotide primers used to amplify cox1 of Sarcocystis spp. isolated from cattle

Primer nameOrientationPrimer sequence (5′→3′)SpeciesAmplified product (bp)
GaBfEFForwardATCAACTTCCTAGGTACAGCGGTATTS. bovifelis523
GaBfERReverseCCACATCATTGGTGCTTAGTCTAGTA
GaBnEFForwardATGGAGATGTGGTATTCTGTACGTCTS. bovini485
GaBnERReverseACAGTGCAACATCATTGGTATGTATC
GaCrEFForwardGCTATGTATCTACTTACGGCAGGTATCS. cruzi531
GaCrERReverseGAATATAATGGCCCAGGTAAATAATG
GsSheyFForwardGGTATCCGGTATGAAGCATACAACS. heydorni443
GsSheyRReverseGATCCGCTGTCAGTGTACGATATT
GaHiEFForwardGTTGTGCGGTATGAATTATCAACCTS. hirsuta513
GaHiERReverseGGTAAGAACTGGAATGGTTAATATCAG
GaHoEFForwardTCTCTGGTTTTGGTAACTACTTCGTS. hominis551
GaHoERReverseCAGACACTGGGATATAATACCGAAC
Oligonucleotide primers used to amplify cox1 of Sarcocystis spp. isolated from cattle

Results

Morphological examination of sarcocysts

Examination of methylene blue-stained squash preparations of diaphragm muscles from cattle reared in Lithuania revealed the presence of sarcocysts in 87.3% (89/102) of the samples collected. The number of sarcocysts per gram of muscle ranged from one to 79 (mean 10.5/g muscle, median 5.0/g muscle). Three types of sarcocysts were detected under the light microscope. Type I sarcocysts were thread-shaped, about 800 × 75 μm in size (n = 58) and had thin 3-µm-long hair-like protrusions; these sarcocysts were characterised as being S. cruzi-like. Type II sarcocysts were spindle- or fusiform-shaped, about 1600 × 130 μm in size (n = 40) and had 5- to 6-µm-long finger-like protrusions; these cysts were characterised as being S. bovifelis- and S. bovini-like. Type III sarcocysts were thread-shaped, about 2600 × 500 µm in size (n = 2) and had about 7-µm-long finger-like protrusions; these cysts were considered as being S. hirsuta-like. The molecular analysis revealed that cysts belonging to types I–III were sarcocysts of S. cruzi (n = 20), S. bovifelis (n = 23) and S. hirsuta (n = 6), respectively. In some cases, sarcocysts morphologically assigned to S. hirsuta were identified as S. bovifelis or vice versa. In two cases, fragments of sarcocysts appeared to be smooth; however, based on molecular methods these cysts were assigned to S. cruzi.

Molecular results on isolated sarcocysts

The obtained 18S rRNA sequences of S. bovifelis (865 bp), S. cruzi (867 bp) and S. hirsuta (874 bp) were deposited in GenBank under accession numbers MT792432–MT792480. The analysed 18S rRNA fragments correspond to position 924–1774 of the S. neurona (U07812) sequence. Comparison of the 18S rRNA sequences of S. bovifelis and S. cruzi did not reveal intraspecific genetic variability. In contrast, one transition (C/T) at nucleotide position 588 was detected between the obtained isolates of S. hirsuta. Twenty sequences of S. cruzi showed 99.8–100% identity with other sequences of this species available in GenBank (AB682779–AB682780, AF017120, JX679467–JX679468, KC209738, KT901167, LC171827–LC171830). Among the Sarcocystis spp. isolated from cattle, the 18S rRNA sequences of S. cruzi demonstrated the greatest similarity (99.1–99.2%) with S. heydorni (KX057996–KX057997). The BLAST analysis revealed that six 18S rRNA gene sequences of S. hirsuta obtained in the present study shared 99.3–100% identity with those of S. hirsuta (AF017122, JX855283, KC209741, KT901156–KT901166, LC171839, MT706003–MT706004) and showed < 98% similarity with those of other Sarcocystis spp. from cattle. Based on 18S rRNA sequence analysis, Lithuanian isolates of S. bovifelis displayed 99.8–100% identity with S. bovifelis (KT901117–KT901138, KC209742–KC209744) and 99.2–99.5% similarity with S. bovini (KT901139–KT901155). It should be noted that these two species could be separated based on three fixed nucleotide positions: at nucleotide positions 441, 457 and 587 of the region studied, S. bovifelis had A, T and A, and S. bovini—G, A and T, respectively. Phylogenetic analysis showed that the 18S rRNA fragment used in this study was suitable for the discrimination of Sarcocystis spp. forming cysts in the muscles of cattle (Fig. 1a). It should be noted that four species (S. bovifelis, S. bovini, S. hominis and S. hirsuta) characterised on the basis of sarcocysts with finger-like protrusions [8] were grouped into one cluster. The same topology was shown by the phylogenetic tree generated by sequence analysis of cox1 (Fig. 1b).
Fig. 1

The phylogenetic placement of Sarcocystis spp. from cattle based on sequence analysis of the 18S rRNA (18S rRNA; a) and cytochrome c oxidase subunit I (cox1; b) genes. Trees were scaled according to the branch length and rooted on S. arctica

The phylogenetic placement of Sarcocystis spp. from cattle based on sequence analysis of the 18S rRNA (18S rRNA; a) and cytochrome c oxidase subunit I (cox1; b) genes. Trees were scaled according to the branch length and rooted on S. arctica The genetic comparison of cox1 sequences of S. bovifelis, S. cruzi and S. hirsuta obtained in the present study are presented in Table 2. The highest sequence differences were found within S. cruzi. The 18S rRNA region used in this study was characterised by minimal intraspecific genetic variability among the analysed Sarcocystis species. Therefore, S. bovifelis, S. cruzi and S. hirsuta from different geographical areas were compared only for cox1. The highest overall intraspecific genetic variability was detected in S. cruzi, while a similar level of overall genetic variation was calculated in S. bovifelis and S. hirsuta (Table 3). Differences in the level of genetic variation were observed between samples of the same species. Relatively low variation was established for S. bovifelis from Lithuania and S. hirsuta from New Zealand, and relatively high variation was noticed for S. cruzi from China. The overall ΦST values showing genetic differentiation between populations were high for S. hirsuta (ΦST = 0.401, P < 0.001) and S. cruzi (ΦST = 0.255, P < 0.001) and medium for S. bovifelis (ΦST = 0.141, P < 0.01).
Table 2

Molecular examination of Sarcocystis species from cattle based on cox1 sequence analysis

Sarcocystis speciesSample typeCox1 GenBank accession no. (length in bp)Differences between obtained sequences (%)Sequence identity (%)
Comparison of isolates of the same speciesComparison of isolates with other closely related species
S. bovifelisSarcocystMT796903–MT796925 (1038)0–1.098.4–100% to S. bovifelis (KT900961–KT900998, KC209690–KC209696, MK962347–MK962348)93.0–93.9% to S. bovini (KT900999–KT901022, LC171858)
DigestedMT796952–MT796954 (471)097.9–100% to S. bovifelis92.4–93.0% to S. bovini
S. cruziSarcocystMT796926–MT796945 (1038)0.2–1.296.1–99.9% to S. cruzi (KC209597–KC209600, KT901078–KT901095, LC171859–LC171862, MG787071–MG787076)92.6–93.9 to S. levinei (KU247874–KU247885, MH255771–MH255781)
DigestedMT796955–MT796957 (478)0–0.497.7–99.8% to S. cruzi< 95% similarity with other Sarcocystis spp.
S. hirsutaSarcocystMT796946–MT796951 (1038)0–0.799.2–100% to S. hirsuta (KC209634, KT901023–KT901077, LC171863)93.4–93.7 to S. buffalonis (KU247868–KU247873, MG792800–MG792802)
DigestedMT796958–MT796960 (461)0–0.299.4–100% to S. hirsuta95.6–96.3% to S. buffalonis
S. hominisDigestedMT796961–MT796964 (501)098.2–98.6% to S. hominis (MH021119, MK497840–MK497843)< 90% similarity with other Sarcocystis spp.
Table 3

Measurements of intraspecific genetic variability of three Sarcocystis species from cattle based on cox1 sequence analysis

Sarcocystis speciesCountry of originGenBankn/hSHd ± SDπ ± SD
S. bovifelisArgentinaKC209690–KC209696, KT900961–KT90099340/17250.937 ± 0.0180.00525 ± 0.00029
GermanyMK962348, KT900994–KT9009986/5170.933 ± 0.1220.00635 ± 0.00281
LithuaniaMT796903–MT79692523/12190.779 ± 0.0910.00275 ± 0.00064
Overall69/32450.919 ± 0.0250.00491 ± 0.00043
S. cruziArgentinaKC209597–KC209600, KT901078–KT90109522/13230.931 ± 0.0360.00687 ± 0.00093
ChinaMG787071–MG7870766/6501.000 ± 0.0960.02667 ± 0.00390
LithuaniaMT796926–MT79694520/20331.000 ± 0.0160.00718 ± 0.00054
Overall48/38760.984 ± 0.0100.01124 ± 0.00170
S. hirsutaBrazilKT901042–KT90105615/550.810 ± 0.0590.00256 ± 0.00028
GermanyKT901057–KT90107721/6100.795 ± 0.0510.00399 ± 0.00037
LithuaniaMT796946–MT7969516/590.933 ± 0.1220.00308 ± 0.00084
New ZeelandKT901023–KT90104119/250.199 ± 0.1120.00096 ± 0.00054
Overall61/15190.863 ± 0.0280.00387 ± 0.00029

n/h, Number of isolates/number of haplotypes; S, number of segregating sites; Hd, haplotype diversity; π, nucleotide diversity; SD standard deviation

Molecular examination of Sarcocystis species from cattle based on cox1 sequence analysis Measurements of intraspecific genetic variability of three Sarcocystis species from cattle based on cox1 sequence analysis n/h, Number of isolates/number of haplotypes; S, number of segregating sites; Hd, haplotype diversity; π, nucleotide diversity; SD standard deviation

Molecular results of digested samples

Cox1 fragments amplified using the GaBfEF/GaBfER, GaCrEF/GaCrER, GaHiEF/GaHiER and GaHoEF/GaHoER primer pairs were examined by DNA electrophoresis. To ascertain whether the used primers were species-specific, three PCR products amplified with each primer pair were purified and sequenced. Primer-annealing sequences were not included in the BLAST analysis. The sequence identity values are given in Table 2. DNA of S. bovifelis, S. cruzi and S. hirsuta extracted from individual sarcocysts were further used as positive or negative controls in the analysis of the digested samples. The control DNA sample of S. hominis was isolated from the muscular tissue of cattle in Italy [11] and subjected to 18S rRNA amplification and sequencing using the SarAF/SarBR and SarCF/SarDR primer pairs [23]. The obtained 1796-bp-long 18S rRNA sequence (MT792481) showed 99.4–99.7% similarity with S. hominis (JX679470–JX679471, KF954731) and up to 97.3% similarity with other Sarcocystis spp. Sarcocystis spp. were detected in all 102 beef diaphragm samples examined using the newly developed molecular identification technique based on muscle digestion and species-specific PCR analysis targeting cox1. The Lithuanian cattle analysed in this study were most frequently infected with S. cruzi, which was identified in 98 samples (96.1%) (Fig. 2a). The prevalence of S. cruzi in the analysed cattle was statistically significantly higher than that of S. bovifelis (71.6%; χ2 = 22.59, P < 0.0001), the presence of which was confirmed in 73 samples. The third most common species was S. hirsuta (30.4%), detected in 31 samples. The prevalence of S. hirsuta was statistically significantly lower than of S. bovifelis (χ2 = 34.60, P < 0.0001) and higher than that of S. hominis (13.7%; χ2 = 8.24, P < 0.01), which was detected in 14 samples. Although the molecular technique did not identify S. hominis among the individual sarcocysts excised from the diaphragm samples, it was identified in the digested samples. These results show that individual cattle may be infected up to four species of Sarcocystis at any one time (Fig. 2b). The most common finding was the presence of two species of Sarcocystis (45 samples, 44.1%); three species were detected in 27 samples (26.5%), a single species was identified in 25 samples (24.5%) and four species were identified in five samples (4.9%). In cases of a single species being detected, S. cruzi was identified in 21 samples and S. bovifelis was confirmed in four samples. When two species of Sarcocystis were observed in the samples, co-infection with S. bovifelis/S. cruzi was the most common finding (86.7%), whereas S. cruzi/S. hirsuta (8.9%) and S. cruzi/S. hominis (4.4%) co-infections were much rarer. Three different species were identified in 27 samples, with S. bovifelis/S. cruzi/S. hirsuta (74.1%) being the most common combination, while mixed infections with S. bovifelis/S. cruzi/S. hominis (18.5%) and S. cruzi/S. hirsuta/S. hominis (7.4%) were rarely detected. It is noteworthy that S. hominis was established in different districts of Lithuania: Pasvalys (two cases), Tauragė (two cases), Kupiškis (two cases), Anykščiai (two cases), Jonava (one case), Tauragė (one case), Šakiai (one case), Šilalė (one case), Skuodas (one case) and Kėdainiai (one case).
Fig. 2

Identification of Sarcocystis spp. in digested muscle samples of cattle from Lithuania. a Prevalence of Sarcocystis species, b Distribution of the number of species in samples

Identification of Sarcocystis spp. in digested muscle samples of cattle from Lithuania. a Prevalence of Sarcocystis species, b Distribution of the number of species in samples

Discussion

In the present study sarcocysts isolated from the diaphragm muscles of cattle were attributed to three morphological types, with molecular methods identifying the types as S. cruzi, S. bovifelis and S. hirsuta. Of the six Sarcocystis species known to use cattle as an intermediate host, two species, S. cruzi and S. heydorni, can be relatively easily differentiated by morphological characteristics [4]. Sarcocysts of S. cruzi are distinguished by hair-like protrusions, while sarcocysts belonging to S. heydorni have an apparently smooth cyst wall; sarcocysts of the other four species (S. bovifelis, S. bovini, S. hirsuta and S. hominis) are characterised by finger-like protrusions [4, 8, 9, 35]. During the course of this study, morphological examination of fragments of two sarocysts released from muscle fibres appeared to be smooth and to be similar to S. heydorni; however, based on molecular methods, these were identified as S. cruzi. In these cases, the protrusions of S. cruzi were likely torn off during manipulation of the sarcocysts with preparation needles. Moreover, sarococyts belonging to S. bovifelis were sometimes misidentified as S. hirsuta and vice versa. Sarcocysts of S. hominis were not found during the light microscopy study, but this species was confirmed in 13.7% of digested samples using molecular methods. These results suggest that the isolation of individual sarcocysts is ineffective when the prevalence of infection of the species is low and, therefore, that the digestion protocol may be preferable in epidemiological studies. The 18S rRNA fragment used in the present study showed sufficient variability for the discrimination of Sarcocystis spp. found in cattle (Fig. 1a). Studies involving population genetic research on Sarcocystis species from cattle are scarce. One study demonstrated a low genetic variability among various isolates of S. cruzi from different geographical regions [36]. In the present study, analysis of cox1 sequences implied that the level of genetic variability depended on the Sarcocystis species and geographical area. Also, a relatively high genetic differentiation between the samples of compared species was revealed. This study established that the GaBfEF/GaBfER, GaCrEF/GaCrER, GaHiEF/GaHiER and GaHoEF/GaHoER primer pairs were specific to S. bovifelis, S. cruzi, S. hirsuta and S. hominis, respectively. In all cases, no PCR product was generated using the negative DNA controls. In summary, the developed molecular technique based on the digestion of the muscle samples and species-specific PCR was found to be suitable for the detection of S. bovifelis, S. cruzi, S. hirsuta and S. hominis from beef. Methylene-blue staining of squash preparations of the muscle samples detected sarcocysts in 87.3% of preparations; in comparison, the molecular methods confirmed the presence of Sarcocystis spp. in all 102 of the digested specimens examined. A very high prevalence of Sarcocystis infection, exceeding 90%, has also been reported in cattle from Argentina, Belgium, the Czech Republic, Egypt, Germany, Iran, Italy, Japan, Mexico, New Zealand, Sudan, Thailand and Turkey (reviewed by Dubey et al. [1]). The findings of the present study are consistent with the data obtained by other researchers demonstrating a different infection prevalence depending on the method used. For example, Moré et al. [37] reported a higher level of prevalence when molecular methods were used (67.7% PCR, 69.6% real-time PCR) in comparison to microscopy analysis (40.0%). Daptardar et al. [38] calculated 44% infection prevalence using intact cyst isolation, 58% infection using pepsin-HCl digestion and 68% infection prevalence using PCR analysis. Hence, current Sarcocystis infection prevalence data should be considered as being critically dependent on the method employed to detect prevalence. The high prevalence of Sarcocystis spp. detected in cattle in Lithuania could be explained by husbandry practices, as carcasses of slaughtered cattle in small farms are fed to dogs and cats, especially in rural areas. Also, a raw diet, which has become popular among dog breeders in recent years, where pets are fed fresh meat, is one possible pathway for the spread of sarcocysts [39]. Our examination of the diaphragm samples of 102 cattle bred in Lithuania identified S. cruzi in 83.7% of samples, S. bovifelis in 71.6%, S. hirsuta in 30.4%, and S. hominis in 13.7% (Fig 2a). The prevalence and abundance of Sarcocystis species may depend on the type of the muscle being analysed. For example, S. heydorni tissue tropism was noted in cattle from China [35], with the highest prevalence (9.7%) recorded in skeletal muscles, followed by 3.4% prevalence in the oesophagus, 2.5% in the diaphragm and 0.1% in the tongue muscles; however, S. heydorni was absent in the heart muscle. This zoonotic species has also been identified in cattle from the Netherlands (1%) and Turkey [4, 10]. It should be noted that due to the different morphological, serological or molecular methods used in studies, it is difficult to compare the distribution of Sarcocystis species identified in cattle. Nevertheless, several trends in the prevalence of Sarcocystis species can be indicated. Most studies carried out in cattle reported the highest prevalence of S. cruzi employing canids as definitive hosts [10, 14, 15, 18, 37, 40–44]. By contrast, a relatively low prevalence of S. hirsuta using felids as definitive hosts was often recorded [14, 15, 37, 41, 45]. Research performed in cattle from the Netherlands and Italy showed S. hirsuta infection rates of < 2% [10, 40]. By contrast, using PCR-restriction fragment length polymorphism, S. hirsuta infection in Iran was recorded as reaching 58.9% [46], whereas microscopy analysis noted a prevalence of S. hirsuta as high as 94.0% in Brazil [47]. Sarcocystis hirsuta has been identified in different geographic regions [8, 10, 14, 15, 40, 44, 45]. Felids are also known to be definitive hosts of S. bovifelis and S. bovini [8, 48]; however, there is a lack of knowledge of the geographical distribution of these two Sarcocystis species. It should be pointed out that S. bovini has not been identified in Europe yet; S. bovifelis and S. bovini have been confirmed in Argentina, and only S. bovini has been found in New Zealand [8] and in beef from New Zealand imported to Japan [15]. In addition, based on comparison of 18S rRNA sequences S. bovini has also been found to be common in China [8]. Differences in the distribution of Sarcocystis species in cattle across geographical regions are possibly related to the abundance of definitive hosts. We detected from one single Sarcocystis species up to four Sarcocystis species simultaneously in individual samples, with the highest prevalence noted for two species concurrently in one animal (Fig 2b). Two species forming sarcocysts in cattle, namely S. bovifelis and S. bovini, were (re)described only in 2016 [8]. Therefore, there is a lack of reliable data on the number of Sarcocystis species in individual bovine samples. However, mixed infections of different Sarcocystis species in cattle is a common occurrence [10, 37, 44]. Further studies are needed to reveal the rate of combinations of Sarcocystis species in individual samples from different countries. The high level (> 40%) of S. hominis infection reported in cattle from countries such as Italy and Iran [33, 46] is most likely overestimated due to the confusion in identifying S. hirsuta and S. bovifelis/S. bovini. The majority of the 18S rRNA sequences formerly presented in GenBank as S. hominis actually belonged to S. bovini, S. bovifelis or S. sinensis infecting the water buffalo [8]. There is a lack of detailed S. hominis molecular data [49] and the first cox1 sequence of this species became available in the GenBank database only in 2018. The prevalence of S. hominis infection in different countries based on molecular methods is poorly studied. A 0.2% prevalence of S. hominis was detected in China [50], 0.5% in Argentina [42], 3.5% in Iran [44], 6.2 % in Germany [37] and 12.5% in the Netherlands [10]. The molecular technique established in this study is an important step in the development of zoonotic S. hominis diagnosis in both cattle and humans.

Conclusion

Based on molecular methods, the presence of S. cruzi (96.1%), S. bovifelis (71.6%), S. hirsuta (30.4%), and S. hominis (13.7%) was confirmed in Lithuanian cattle meat for the first time. A rapid, accurate and relatively cheap technique was developed for the identification of Sarcocystis species in cattle meat. Further research on S. hominis epidemiology in various regions is needed.
  45 in total

1.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

2.  Sarcocystis species identification in the moose (Alces alces) from the Baltic States.

Authors:  Petras Prakas; Viktorija Kirillova; Rafael Calero-Bernal; Muza Kirjušina; Eglė Rudaitytė-Lukošienė; Miguel Ángel Habela; Inese Gavarāne; Dalius Butkauskas
Journal:  Parasitol Res       Date:  2019-03-21       Impact factor: 2.289

Review 3.  The resurrection of a species: Sarcocystis bovifelis Heydorn et al., 1975 is distinct from the current Sarcocystis hirsuta in cattle and morphologically indistinguishable from Sarcocystis sinensis in water buffaloes.

Authors:  Bjørn Gjerde
Journal:  Parasitol Res       Date:  2015-10-14       Impact factor: 2.289

4.  Molecular identification targeting cox1 and 18S genes confirms the high prevalence of Sarcocystis spp. in cattle in the Netherlands.

Authors:  B J A Hoeve-Bakker; J W B van der Giessen; F F J Franssen
Journal:  Int J Parasitol       Date:  2019-08-07       Impact factor: 3.981

5.  Prevalence of Sarcocystis spp. in Argentinean cattle.

Authors:  G Moré; P Abrahamovich; S Jurado; D Bacigalupe; J C Marin; M Rambeaud; L Venturini; M C Venturini
Journal:  Vet Parasitol       Date:  2010-12-01       Impact factor: 2.738

6.  Isolation, Culture and Cryopreservation of Sarcocystis species.

Authors:  S K Verma; D S Lindsay; M E Grigg; J P Dubey
Journal:  Curr Protoc Microbiol       Date:  2017-05-16

7.  Sarcocystis entzerothi n. sp. from the European roe deer (Capreolus capreolus).

Authors:  Petras Prakas; Eglė Rudaitytė; Dalius Butkauskas; Liuda Kutkienė
Journal:  Parasitol Res       Date:  2016-10-18       Impact factor: 2.289

8.  Prevalance, Morphology, and Molecular Characterization of Sarcocystis heydorni Sarcocysts from Cattle (Bos Taurus) in China.

Authors:  J J Hu; T Wen; X W Chen; T T Liu; G W Esch; S Huang
Journal:  J Parasitol       Date:  2016-06-30       Impact factor: 1.276

9.  Different Sarcocystis spp. are present in bovine eosinophilic myositis.

Authors:  Lieve Vangeel; Kurt Houf; Peter Geldhof; Katleen De Preter; Jozef Vercruysse; Richard Ducatelle; Koen Chiers
Journal:  Vet Parasitol       Date:  2013-06-10       Impact factor: 2.738

10.  Sarcocystis heydorni, n. sp. (Apicomplexa: Sarcocystidae) with cattle (Bos taurus) and human (Homo sapiens) cycle.

Authors:  Jitender P Dubey; Erna van Wilpe; Rafael Calero-Bernal; Shiv Kumar Verma; Ronald Fayer
Journal:  Parasitol Res       Date:  2015-08-06       Impact factor: 2.289

View more
  7 in total

1.  Invasive American mink (Neovison vison) as potential definitive host of Sarcocystis elongata, S. entzerothi, S. japonica, S. truncata and S. silva using different cervid species as intermediate hosts.

Authors:  Petras Prakas; Eglė Rudaitytė-Lukošienė; Donatas Šneideris; Dalius Butkauskas
Journal:  Parasitol Res       Date:  2021-05-04       Impact factor: 2.289

2.  Molecular identification of Sarcocystis species in diaphragm muscle tissue of European mouflon (Ovis gmelini musimon) from Austria.

Authors:  Petras Prakas; Steffen Rehbein; Eglė Rudaitytė-Lukošienė; Dalius Butkauskas
Journal:  Parasitol Res       Date:  2021-06-24       Impact factor: 2.289

3.  Molecular detection of cattle Sarcocystis spp. in North-West Italy highlights their association with bovine eosinophilic myositis.

Authors:  Selene Rubiola; Tiziana Civera; Felice Panebianco; Davide Vercellino; Francesco Chiesa
Journal:  Parasit Vectors       Date:  2021-04-23       Impact factor: 3.876

Review 4.  A Review on Alaria alata, Toxoplasma gondii and Sarcocystis spp. in Mammalian Game Meat Consumed in Europe: Epidemiology, Risk Management and Future Directions.

Authors:  Lisa Guardone; Andrea Armani; Francesca Mancianti; Ezio Ferroglio
Journal:  Animals (Basel)       Date:  2022-01-21       Impact factor: 2.752

5.  Molecular Identification of Parasitic Protozoa Sarcocystis in Water Samples.

Authors:  Živilė Strazdaitė-Žielienė; Agnė Baranauskaitė; Dalius Butkauskas; Elena Servienė; Petras Prakas
Journal:  Vet Sci       Date:  2022-08-05

6.  Molecular Identification of Sarcocystis Species in Sheep from Lithuania.

Authors:  Alina Marandykina-Prakienė; Dalius Butkauskas; Naglis Gudiškis; Evelina Juozaitytė-Ngugu; Vytautas Januškevičius; Eglė Rudaitytė-Lukošienė; Petras Prakas
Journal:  Animals (Basel)       Date:  2022-08-11       Impact factor: 3.231

7.  The Role of Mustelids in the Transmission of Sarcocystis spp. Using Cattle as Intermediate Hosts.

Authors:  Petras Prakas; Linas Balčiauskas; Evelina Juozaitytė-Ngugu; Dalius Butkauskas
Journal:  Animals (Basel)       Date:  2021-03-15       Impact factor: 2.752

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.