Literature DB >> 33287648

CTNNB1 Knockdown Inhibits Cell Proliferation and Aldosterone Secretion Through Inhibiting Wnt/β-Catenin Signaling in H295R Cells.

Tingting Zhou1, Pengwei Luo1,2, Liang Wang1, Shiwei Yang1, Shiyuan Qin1, Zhitao Wei2, Jiwen Liu1.   

Abstract

Aldosterone-producing adenomas (APA) is one of the causative factors of primary aldosteronism. Previous studies have suggested that there are somatic CTNNB1 mutations in APA, but the specific mechanism of CTNNB1 mutation in APA tumorigenesis and aldosterone secretion remains unclear. In the present study, human adrenocortical carcinoma cell line H295 R was used to establish stable CTNNB1 knockdown cell lines. Cell proliferation and aldosterone secretion of H295 R cells in response to angiotensin Ⅱ (Agn Ⅱ) were analyzed. We found that CTNNB1 knockdown reduced β-catenin expression and inhibited proliferation of H295 R cells. CTNNB1 knockdown inhibited Wnt/β-catenin signaling pathway and downregulated expression of downstream genes including axin 2, lymphoid enhancer binding factor 1 (LEF1), and cyclin D1. In addition, CTNNB1 knockdown decreased responses of H295 R cells to Agn Ⅱ and decreased aldosterone secretion. Our findings suggest that CTNNB1 knockdown can inhibit H295 R cell proliferation and decrease aldosterone secretion in the responses of H295 R cells to Ang II through inhibiting Wnt/β-catenin signaling pathway, indicating that targeting Wnt/β-catenin signaling pathway may be an important approach to decrease aldosterone secretion in the treatment of aldoster-producing adenomas.

Entities:  

Keywords:  CTNNB; H295 R cell; Wnt/β-catenin signaling pathway; aldosterone secretion; aldosterone-producing adenomas

Year:  2020        PMID: 33287648      PMCID: PMC7727057          DOI: 10.1177/1533033820979685

Source DB:  PubMed          Journal:  Technol Cancer Res Treat        ISSN: 1533-0338


Introduction

Primary aldosteronism (PA), which is characterized by hyperaldosteronism, affects 20% of patients with refractory hypertension.[1] The excessive production of aldosterone leads to hypertension, low plasma renin activity, varying degrees of hypokalemia, and metabolic alkalosis.[2] Now, PA is being recognized as the most common cause of secondary hypertension with a prevalence of 5-10% in hypertensive individuals and up to 20% in therapy-resistant hypertension.[3,4] The pathogenesis of PA is caused by adrenal aldosterone-producing adenomas (APA) or bilateral hyperplasia in 95% of patients.[5] Clinical therapy of PA relies on surgical resection and/or treatment with mineralocorticoids antagonists to minimize hypertension.[6,7] However, the medication time is still inconclusive and serious side effects are still not resolved. Therefore, existing treatment strategies are limited, which warrants exploring the molecular mechanisms of PA to improve therapeutic outcomes. Wnt/β-catenin signaling pathway has extensive biological effects and is relatively conservative in evolution, which has important effects on ontogeny, cell differentiation, apoptosis and necrosis.[8] Previous studies indicate that the abnormal activated Wnt/β-catenin pathway has been involved in tumor progression, such as breast cancer, colorectal cancer, and ovarian cancer.[9-11] β-catenin is the core molecule of Wnt/β-catenin signaling pathway, which has transcriptional regulatory activity and is encoded by CTNNB1 gene, which located on human chromosome 3p21∼22, with a total length of 23.2 kb and 16 exons.[11,12] Abnormal Wnt/β-catenin activation caused by somatic CTNNB1 mutations has been found in APA,[13] and silencing CTNNB1 has been shown to inhibit cell proliferation and stimulates apoptosis in APA cell line H295 R through decreasing Wnt/β-catenin-LEF/TCF dependent transcription.[14] Transgenic mice with specific constitutive activation of β-catenin in the adrenal cortex present with increased aldosterone production and even a risk of adrenocortical tumors.[15,16] These researches suggest that Wnt/β-catenin signaling pathway triggers off APA tumorigenesis and may be involved in aldosterone secretion. APA patients with CTNNB1 mutation are older and have more obvious hypertension symptoms. After adrenalectomy, CTNNB1 mutation carriers have a higher likelihood of residual hypertension than other APA patients.[17] Akerstrom et al reported that APA tissue containing the CTNNB1 mutant gene has a high expression of CYP11B2.[13] As the last rate-limiting enzyme for aldosterone synthesis, CYP11B2 expression is up-regulated by angiotonin Ⅱ (Ang Ⅱ) through activating calcium signaling to induce aldosterone secretion.[18] The specific mechanism of CTNNB1 mutation in APA-induced hyperaldosteronism remains unclear. In order to explore the effect of Wnt/β-catenin signaling pathway on the development of APA and to better understand the role of CTNNB1 gene in APA cell proliferation and aldosterone secretion, we knocked down CTNNB1 gene expression in vitro and investigated the effect of Wnt/β-catenin signaling pathway on cell proliferation and aldosterone secretion of human adrenocortical carcinoma cell line H295 R. Our study suggests that Wnt/β-catenin signaling pathway is a vital role in mediating the secretion of aldosterone in the responses of H295 R cells to Ang II.

Materials and Methods

Cell Culture

Human adrenocortical carcinoma H295 R cell line was cultivated in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium complemented with 2 mM L-glutamine, 10% fetal bovine serum (FBS), 50 U/mL penicillin and 100 mg/mL streptomycin, at 37°C with 5% CO2. All media and supplements in this study were purchased from Invitrogen (Carlsbad, CA, USA).

CTNNB1 Knockdown

CTNNB1 was knocked down in H295 R cells with siRNA (RiboBio Co., Ltd., Guangzhou, China) in accordance with the manufacturer’s instructions. There were 3 target sequences: si-CTNNB1_001, 5′-TGGTTGCCTTGCTCAACAA-3′; si-CTNNB1_002, 5′-GCTTGGAATGAGACTGCTG-3′; si-CTNNB1_003, 5′-AGCTGATATTGATGGACAG-3′. The corresponding negative control sequence for the target gene was purchased from RiboBio Co., Ltd. To stably and efficiently knockdown CTNNB1 in H295 R cells, siRNA targeting the si-CTNNB1_003 coding sequence 5′-AGCTGATATTGATGGACAG-3′ was designed and inserted into a pGMLV-SC5RNAi lentiviral vector (Genomeditech Co., Ltd, Shanghai, China), and an interference-free siRNA was used as a negative control. Quantitative reverse transcription PCR (qRT-PCR) and Western blot analysis were used to determine the knockdown efficiencies.

Total RNA Extraction and qRT-PCR

Total RNA extraction kit (Solarbio, Beijing, China) was used to extract total RNA from H295 R cells, and was in accordance with the manufacturer’s instructions. were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) was used to determine the RNA concentrations. The iScript cDNA synthesis Kit (Bio-Rad, Hercules, CA, USA) was used to reverse-transcribe 1 microgram of total RNA to synthesize cDNA. CFX96 real-time system (Bio-Rad) and SYBR Green Supermix (Bio-Rad) were used to perform PCR and the procedures were performed according to the manufacturer’s instructions. The sequences of the primers used in this study are listed in Table 1.
Table 1.

Sequences of the Primers Used in This Study.

Target gene Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’)
CTNNB1CCCAGAATGCAGTTCGCCTTTAGTCGTGGAATGGCACCCT
AXIN2CACCACCACCACCACCATTCGACATGCTTCGTCGTCTGCTTGG
LEF1AGATTCTTGGCAGAAGGTGGCATGGGACCTGTACCTGATGCAGATTCC
CYP11B1GAACTGTCGCCAGATGCCATCGCTCCAGAATCAGACCCAC
CYP11B2GTGACCGCAGGTTGCTTTCCAGCCATCTCTGAGGTCTGTGC
Cyclin D1GCTGCGAAGTGGAAACCATCCCTCCTTCTGCACACATTTGAA
β-actinCCTGGCACCCAGCACAATGGGCCGGACTCGTCATAC
Sequences of the Primers Used in This Study.

Western Blot Analysis

The prepared protein samples were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis on a 12% gel. Subsequently, in Tris buffered saline containing 5% skim milk and 0.1% Tween-20, the separated protein samples were transferred to the nitrocellulose membranes after blocking at room temperature for 1 h. The nitrocellulose membranes were placed in a suitable concentration of primary antibody and incubated for 18 h at 4 °C. Then, membranes were placed in an incubator and stained with horseradish peroxidase-conjugated secondary antibodies for 1 hat room temperature. Finally, membranes were visualized with enhanced chemiluminescence (SuperSignal, Pierce, Rockford, IL) or ECL Plus (Amersham Pharmacia Biotech, Buckinghamshire, UK) substrates in accordance with the manufacturers’ instructions.

Cell Viability Assays

Cell viability was assessed by cell counting kit-8 (CCK-8) and colony formation assays. Briefly, cells were inoculated in a 6-well plate (Corning, Corning, NY, USA) at 500 cells per well after being treated with or without CTNNB1 knockdown. The cells were cultured for 10 days, and the medium was changed at least every 3 days depending on the growth of the cells. The colonies were washed with phosphate-buffered saline (PBS), fixed in methanol, and stained with crystal violet. The number of colonies was counted under a microscope. CCK-8 assays were performed in accordance with the manufacturer’s instructions.

Quantification of Aldosterone Using ELISA Kit

After incubation of H295 R cells with the respective control medium, aldosterone in the supernatant of the cells was measured using a commercial human aldosterone ELISA Kit (ALD ELISA kit) in accordance with the manufacturer’s protocol (AmyJet Scientific, Wuhan, China).

Statistical Analysis

Each experiment was performed at least 3 times independently. The GraphPad Prism 7.0 statistical program (GraphPad, San Diego, CA, USA) was used for data analysis. The results were presented as the mean ± standard deviation (SD) unless otherwise indicated. The significance of the difference between the 2 groups was analyzed by 2-tailed Student’s t-tests. The differences between the 2 groups of count data were analyzed by chi-square test. P < 0.05 was considered statistically significant.

Results

CTNNB1 Knockdown Reduced β-Catenin Expression and Inhibited Proliferation of H295 R Cells

Stable CTNNB1 knockdown in H295 R cell lines were established to actively explore the function of endogenous CTNNB1. Based on qRT-PCR and western blot assays, si-h-CTNNB1_003 significantly downregulated the mRNA level and protein expression level of β-catenin (Figure 1A). We utilized this lentivirus-mediated siRNA to induce CTNNB1 knockdown in H295 R cells (Figure 1B). CCK-8 assays showed that CTNNB1 knockdown markedly reduced cell viability, compared with the control group (Figure 1C). Similarly, colony formation assays showed that cell proliferation was significantly decreased with CTNNB1 knockdown in H295 R cells (Figure 1D).
Figure 1.

CTNNB1 knockdown reduces β-catenin expression and inhibits proliferation of H295 R cells. (A) Efficiency of β-catenin knockdown was detected by qRT-PCR and Western blot analysis. (B) Transfection efficiency of CTNNB1 knockdown lentiviruses in H295 R cells. (C) Cell viability was detected using CCK-8 assays. (D) Cell proliferation was detected using colony formation assays. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

CTNNB1 knockdown reduces β-catenin expression and inhibits proliferation of H295 R cells. (A) Efficiency of β-catenin knockdown was detected by qRT-PCR and Western blot analysis. (B) Transfection efficiency of CTNNB1 knockdown lentiviruses in H295 R cells. (C) Cell viability was detected using CCK-8 assays. (D) Cell proliferation was detected using colony formation assays. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

Wnt/β-Catenin Signaling Pathway Was Inhibited by CTNNB1 Knockdown

To explore the effects of CTNNB1 knockdown on Wnt/β-catenin signaling pathway in H295 R cells, we detected the downstream target genes of Wnt/β-catenin signaling pathway including AXIN2 and lymphoid enhancer binding factor 1 (LEF1). Compared with the control group, the mRNA expression levels of AXIN2 (Figure 2A) and LEF1 (Figure 2B) in CTNNB1 knockdown group were significantly decreased. Western blot analysis revealed that the protein expression levels of AXIN2 and LEF1 were downregulated in CTNNB1 knockdown group (Figure 2C). After adding angiotensin Ⅱ (Ang Ⅱ) to the cells for 6 hours, the results were not affected (Figure 1B and Figure 2A-C). These results suggest that CTNNB1 knockdown inhibited Wnt/β-catenin signaling pathway.
Figure 2.

Wnt/β-catenin signaling pathway was inhibited by CTNNB1 knockdown. (A) mRNA levels of AXIN2 were detected by qRT-PCR. (B) mRNA levels of LEF1 were detected by qRT-PCR. (C) Levels of protein expression of AXIN2 and LEF1 were detected using Western blot analysis. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

Wnt/β-catenin signaling pathway was inhibited by CTNNB1 knockdown. (A) mRNA levels of AXIN2 were detected by qRT-PCR. (B) mRNA levels of LEF1 were detected by qRT-PCR. (C) Levels of protein expression of AXIN2 and LEF1 were detected using Western blot analysis. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

CTNNB1 Knockdown Reduced Expression of Cycling D1

Since cycling D1 is known to play an important role in cell proliferation, qRT-PCR and Western blot analysis were used to detect expression of cycling D1 in H295 R cells. In CTNNB1 knockdown group, the mRNA levels of cycling D1 were significantly decreased (Figure 3A) and the protein expression levels of cycling D1 were also downregulated (Figure 3B), compared to the control group. In addition, the expression levels of cycling D1 were not affected by adding Ang Ⅱ. These results suggest that CTNNB1 knockdown inhibits cell proliferation through reducing expression of cycling D1.
Figure 3.

CTNNB1 knockdown reduces expression of cycling D1. (A) mRNA levels of cyclin D1 were detected by qRT-PCR. (B) Levels of cyclin D1 protein expression was detected using Western blot analysis. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

CTNNB1 knockdown reduces expression of cycling D1. (A) mRNA levels of cyclin D1 were detected by qRT-PCR. (B) Levels of cyclin D1 protein expression was detected using Western blot analysis. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

CTNNB1 Knockdown Decreased Aldosterone Secretion in H295 R Cells

Cytochrome P450 family 11 subfamily B member 2 (CYP11B2) is one of the rate-limiting enzymes for aldosterone synthesis and is also the terminal enzyme. In order to explore the effect of CTNNB1 on aldosterone secretion, we detected the basal and Ang Ⅱ-treated CYP11B2 expression levels. CTNNB1 knockdown inhibited the mRNA and protein expression levels of CYP11B2 (Figure 4A and C), but not the expression levels of CYP11B1 (Figure 4B and C). In addition, Ang Ⅱ significantly increased the expression levels of CYP11B2 in H295 R cells, which was reversed by CTNNB1 knockdown (Figure 4A and C). On the contrary, Ang Ⅱ also increased the expression levels of CYP11B1, which was not influenced by CTNNB1 knockdown (Figure 4B and C). Moreover, aldosterone ELISA Kit was used to detect the concentration of aldosterone in the supernatant of H295 R cells. We found that Ang Ⅱ-induced upregulation of aldosterone secretion was reversed by CTNNB1 knockdown (Figure 4D). These results suggest that CTNNB1 knockdown reduces the responses of H295 R cells to Ang II and decreases secretion of aldosterone.
Figure 4.

CTNNB1 knockdown decreases aldosterone secretion in H295 R cells. (A) mRNA levels of CYP11B2 were detected by qRT-PCR. (B) mRNA levels of CYP11B1 were detected by qRT-PCR. (C) Levels of CYP11B2 and CYP11B1 protein expression were detected using Western blot analysis. (D) Secretion of aldosterone was detected by ELISA kits. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

CTNNB1 knockdown decreases aldosterone secretion in H295 R cells. (A) mRNA levels of CYP11B2 were detected by qRT-PCR. (B) mRNA levels of CYP11B1 were detected by qRT-PCR. (C) Levels of CYP11B2 and CYP11B1 protein expression were detected using Western blot analysis. (D) Secretion of aldosterone was detected by ELISA kits. Error bars indicate SD. *P < 0.05, **P < 0.01, ***P < 0.001.

Discussion

Hypertension is one of the most common cardiovascular diseases in China.[19] In recent years, with the clinical application of plasma aldosterone/renin activity ratio (ARR) and the extensive application of computed tomography, magnetic resonance imaging and other imaging technologies, the detection rate of PA in hypertensive population has been significantly improved. PA has become the common cause of intractable hypertension.[1] In addition, the tissues in the heart, brain and kidneys in PA patients were more seriously damaged than those in PH patients, which results in more grievous consequences.[3] Therefore, exploring novel therapeutic targets is an urgent and promising undertaking for the clinical treatment of PA. Aldosterone production is stimulated by Ang II or extracellular K+ and is mediated mainly by Ca2 + influx into adrenal glomerulosa cells through calcium signaling pathway.[18,20] During the past years, significant progress has been made in the knowledge of the genetic basis of APA development. The mutation site of APA is related to the specific biochemical and clinical features of PA. Over 50% of APA patients have been identified to have multiple gene mutation sites, such as KCNJ5, CACNA1D, ATP1A1, and ATP2B3 mutations, which belong to cell membrane ion channel protein encoding gene.[21] These mutations may increase intracellular calcium concentrations through various ways, opening voltage-dependent calcium channels, thereby activating calcium signaling and aldosterone secretion.[22] However, there are no obvious association between these mutations and adrenal tumorigenesis. Most majorities of APA patients have been detected to possess activation of Wnt/β-catenin signal pathway.[23] In adrenal tumors, the main cause for activation of Wnt/β-catenin signal pathway is CTNNB1 mutation.[13] Patients with CTNNB1 mutation have larger adenomas size, but not higher level of aldosterone, compared to the patients with other mutations.[17,24] H295 R cells have been shown to be an Ang II-responsive steroid-producing adrenocortical cell line.[25] Gaujoux et al has reported that silencing CTNNB1 can inhibit cell proliferation and stimulate apoptosis of H295 R through decreasing Wnt/β-catenin-LEF/TCF dependent transcription,[14] but the relationship between Wnt/β-catenin signaling and Ang II-induced aldosterone secretion is unclear. In the present study, the secretion of aldosterone and the expression of rate-limiting enzyme gene CYP11B1 and CYP11B2 were increased by Ang II, and the silencing CTNNB1 inhibited aldosterone secretion and the expression of CYP11B2 but not CYP11B1 in H295 R cells. Furthermore, the expression of CYP11B2 and aldosterone secretion of H295 R cells in response to Ang II were both decreased by CTNNB1 knockdown, but CTNNB1 knockdown had no effect on expression of CYP11B1. These results suggested that silencing CTNNB1 genes reduced aldosterone secretion and responsiveness to Ang II of H295 R cells by inhibiting the expression of CYP11B2. In addition, the relationship between CTNNB1 knockdown and H295 R cell proliferation in response to Ang II was also investigated. Our results showed that CTNNB1 knockdown decreased expression of β-catenin and inhibited proliferation of H295 R cells. Moreover, the downstream target genes of Wnt/β-catenin signaling pathway, AXIN2 and LEF1, were downregulated by CTNNB1 knockdown in H295 R cells, which were consistent with Gaujoux et al.[14] However, there was no difference in the Wnt/β-catenin signaling pathway of H295 R cells after Ang II treatment. These results indicate that the activation of Wnt/β-catenin signal pathway promoted APA tumorigenesis, which was independent of Ang II. Uncontrolled cell proliferation is the most important hallmarks of cancer cells. Abnormal progression of cell cycle is the leading reason for dysregulation of cell proliferation. Cell cycle is regulated by a coordination of several cyclins and cell cycle inhibitors.[26] Different cyclins are involved in different cell cycle stages. Cyclin D1 is a key protein that drives G1/S transition of the cell cycle.[27] In our study, expression of cyclin D1 was investigated in H295 R cells. The protein and mRNA levels of cyclin D1 were significantly reduced by CTNNB1 knockdown. These results suggest that CTNNB1 knockdown downregulates cyclin D1 expression to inhibit H295 R cell proliferation. In conclusion, our findings suggest that CTNNB1 knockdown can inhibit H295 R cell proliferation and decrease aldosterone secretion in the responses of H295 R cells to Ang II through inhibiting Wnt/β-catenin signaling pathway, indicating that targeting Wnt/β-catenin signaling pathway may be an important approach to decrease aldosterone secretion in the treatment of aldoster-producing adenomas.
  26 in total

Review 1.  Cell cycle regulation and neural differentiation.

Authors:  Umberto Galderisi; Francesco Paolo Jori; Antonio Giordano
Journal:  Oncogene       Date:  2003-08-11       Impact factor: 9.867

Review 2.  Wnt/β-catenin signaling and disease.

Authors:  Hans Clevers; Roel Nusse
Journal:  Cell       Date:  2012-06-08       Impact factor: 41.582

3.  Prevalence of primary hyperaldosteronism in resistant hypertension: a retrospective observational study.

Authors:  Stella Douma; Konstantinos Petidis; Michael Doumas; Panagiota Papaefthimiou; Areti Triantafyllou; Niki Kartali; Nikolaos Papadopoulos; Konstantinos Vogiatzis; Chrysanthos Zamboulis
Journal:  Lancet       Date:  2008-06-07       Impact factor: 79.321

4.  Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC.

Authors:  P J Morin; A B Sparks; V Korinek; N Barker; H Clevers; B Vogelstein; K W Kinzler
Journal:  Science       Date:  1997-03-21       Impact factor: 47.728

5.  Calcineurin mediates the angiotensin II-induced aldosterone synthesis in the adrenal glands by up-regulation of transcription of the CYP11B2 gene.

Authors:  Toshiyuki Yamashiro; Hideaki Kuge; Jin Zhang; Koichi Honke
Journal:  J Biochem       Date:  2010-04-22       Impact factor: 3.387

6.  Molecular profiling of isolated histological components of wilms tumor implicates a common role for the Wnt signaling pathway in kidney and tumor development.

Authors:  Mariana Maschietto; Beatriz de Camargo; Helena Brentani; Paul Grundy; Simone T Sredni; César Torres; Louise D Mota; Isabela W Cunha; Diogo F C Patrão; Cecília M L Costa; Fernando A Soares; Ricardo R Brentani; Dirce M Carraro
Journal:  Oncology       Date:  2008-09-11       Impact factor: 2.935

7.  Constitutive beta-catenin activation induces adrenal hyperplasia and promotes adrenal cancer development.

Authors:  Annabel Berthon; Isabelle Sahut-Barnola; Sarah Lambert-Langlais; Cyrille de Joussineau; Christelle Damon-Soubeyrand; Estelle Louiset; Mark M Taketo; Frédérique Tissier; Jérôme Bertherat; Anne-Marie Lefrançois-Martinez; Antoine Martinez; Pierre Val
Journal:  Hum Mol Genet       Date:  2010-01-27       Impact factor: 6.150

8.  Changes in the perceived epidemiology of primary hyperaldosteronism.

Authors:  Riccardo Maria Fagugli; Chiara Taglioni
Journal:  Int J Hypertens       Date:  2011-08-04       Impact factor: 2.420

9.  Silencing mutated β-catenin inhibits cell proliferation and stimulates apoptosis in the adrenocortical cancer cell line H295R.

Authors:  Sébastien Gaujoux; Constanze Hantel; Pierre Launay; Stéphane Bonnet; Karine Perlemoine; Lucile Lefèvre; Marine Guillaud-Bataille; Felix Beuschlein; Frédérique Tissier; Jérôme Bertherat; Marthe Rizk-Rabin; Bruno Ragazzon
Journal:  PLoS One       Date:  2013-02-07       Impact factor: 3.240

10.  Activating mutations in CTNNB1 in aldosterone producing adenomas.

Authors:  Tobias Åkerström; Rajani Maharjan; Holger Sven Willenberg; Kenko Cupisti; Julian Ip; Ana Moser; Peter Stålberg; Bruce Robinson; K Alexander Iwen; Henning Dralle; Martin K Walz; Hendrik Lehnert; Stan Sidhu; Celso Gomez-Sanchez; Per Hellman; Peyman Björklund
Journal:  Sci Rep       Date:  2016-01-27       Impact factor: 4.379

View more
  2 in total

1.  Determination of WWOX Function in Modulating Cellular Pathways Activated by AP-2α and AP-2γ Transcription Factors in Bladder Cancer.

Authors:  Damian Kołat; Żaneta Kałuzińska; Andrzej K Bednarek; Elżbieta Płuciennik
Journal:  Cells       Date:  2022-04-19       Impact factor: 7.666

2.  Somatic mutations of GNA11 and GNAQ in CTNNB1-mutant aldosterone-producing adenomas presenting in puberty, pregnancy or menopause.

Authors:  Junhua Zhou; Elena A B Azizan; Claudia P Cabrera; Fabio L Fernandes-Rosa; Sheerazed Boulkroun; Giulia Argentesi; Emily Cottrell; Laurence Amar; Xilin Wu; Sam O'Toole; Emily Goodchild; Alison Marker; Russell Senanayake; Sumedha Garg; Tobias Åkerström; Samuel Backman; Suzanne Jordan; Satyamaanasa Polubothu; Daniel M Berney; Anna Gluck; Kate E Lines; Rajesh V Thakker; Antoinette Tuthill; Caroline Joyce; Juan Pablo Kaski; Fiona E Karet Frankl; Lou A Metherell; Ada E D Teo; Mark Gurnell; Laila Parvanta; William M Drake; Eva Wozniak; David Klinzing; Jyn Ling Kuan; Zenia Tiang; Celso E Gomez Sanchez; Per Hellman; Roger S Y Foo; Charles A Mein; Veronica A Kinsler; Peyman Björklund; Helen L Storr; Maria-Christina Zennaro; Morris J Brown
Journal:  Nat Genet       Date:  2021-08-12       Impact factor: 41.307

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.