Isolation of enterotoxigenic Staphylococcus aureus harboring seb gene and enteropathogenic Escherichia coli (serogroups O18, O114, and O125) from soft and hard artisanal cheeses in Egypt.

Background: Soft and hard artisanal cheeses are regularly consumed in Egypt. These products are usually processed from raw milk which may harbor many pathogenic and spoilage microorganisms. Aim: To evaluate the safety of some artisanal cheeses in Egypt, such as Ras, Domiati, and Mish, through chemical and microbiological examination.
Methods: One hundred and fifty random samples of traditional Ras, Domiati, and Mish cheeses (50 each) were microbiologically and chemically analyzed. Counts of total bacteria, presumptive coliform, staphylococci, yeast, and mold were estimated. Furthermore, isolation of Escherichia coli and Staphylococcus aureus was performed, followed by PCR confirmation; isolates of E. coli were examined for the presence of virulence genes; on the other hand, the detection of the five classical enterotoxin genes of S. aureus was performed using multiplex PCR. Regarding chemical analysis, moisture, salt, and acidity content were measured. Correlations between chemical and microbial findings were investigated.
Results: Mean counts of total bacteria, presumptive coliform, staphylococci, yeast, and mold were (2 × 108, 3 × 106 and 1 × 107 ), (3 × 105, 5 × 10 and 5 × 102), (1 × 106, 4 × 105and 1 × 105), (3 × 105, 1 × 105 and 5 × 105), and (7 × 103, 4 × 103 and 3 × 104) for Ras, Domiati and Mish cheeses, respectively. Serological identification of suspected E. coli revealed that E. coli O125 was isolated from Ras and Domiati samples, E. coli O18 was recovered from Ras samples, while E. coli O114 was isolated from Mish samples. PCR results revealed that all detected isolates of E. coli were positive for both iss (increased serum survival) and fimH (type 1 fimbriae) genes. Concerning isolated S. aureus, all examined products were harboring S. aureus enterotoxigenic strains, with seb and sed genes being the most common. The mean values of moisture, salt, and acidity were (30.03, 56.44, and 58.70), (3.30, 6.63, and 7.56) and (0.65, 0.68, and 0.50) for Ras, Domiati, and Mish cheeses, respectively.
Conclusion: Enterotoxigenic S. aureus harboring seb gene and enteropathogenic E. coli (serogroups O18, O114, and O125) were frequently isolated from soft and hard artisanal cheeses in Egypt. Therefore, strict hygienic measures should be applied during their manufacture, handing, and distribution.

Introduction

Traditional Egyptian dairy products are an essential part of the daily diet in Egypt. Raw milk is the common factor in making all traditional products, which usually record high sensorial characteristics, as consumers mostly choose their dairy products based on its sensory properties, regardless if it is made from raw or pasteurized milk (Awad, 2006; El-Ghaish ; Ewida and Hussein, 2019). Some traditional products have been traced back to the pharaoh era of 4,000 BC, and is then handed down from one generation to another. There are different types of traditional cheese in Egypt and among them are Ras, Domiati, and Mish (Benkerroum, 2012).

Ras cheese is a hard cheese commonly known in Egypt as “Romi”. It is one of the artisan type cheeses, which is produced often in small factories located in rural areas. It is mainly made from raw milk, either cow’s or a mixture of cow and buffalo milk, mostly without adding a starter culture, and fermentation and ripening occur only due to the native flora of raw milk, then it is kept to ripen for 3–8 months till a sharp flavor is acquired, similar to the Greek Kefalotyri cheese (Awad, 2006; El-Fadaly ).

Domiati or Damietta cheese (Gebnah Domiata) is one of the most popular white, soft pickled cheeses. It is named after the Egyptian seaport city “Dumyât”. Typically, it is salty, unlike other pickled cheeses, as the salt is added directly to the raw milk at the proportion of 5%–14%, which varies according to season and ripening conditions (Robinson and Tamime, 1991).

Mish is one of the oldest indigenous milk products in Egypt that has a sharp harsh flavor with a relatively higher salt content and is mostly yellowish brown color. Karish cheese is considered as the basic raw material for such a product. Some other ingredients that may be included in Mish are sour milk, buttermilk, morta (a byproduct of ghee), different types of pepper (green, red, and paprika), table salt, and a portion of an old Mish which acts as the starter culture. All ingredients are brined under microaerophilic conditions mostly in earthenware containers for more than 1 year to obtain matured mish, which consists of Mish cheese and Mish slurry (pickling medium), and both are consumed (Tamime, 2006).

Raw milk used in the production of traditional dairy products and harbor a large number of native microflora that may participate in the development of a desirable aroma and an appropriate flavor, but it may also contain pathogenic microorganisms such as Escherichia coli, Staphylococcus aureus, and others that are considered as public health hazards, causing a serious food illness and may produce lethal toxins in the food (Awad ; El-Ghaish ). Moreover, undesirable spoilage organisms may also be found that cause defects and limits the shelf life of these products, rendering them unmarketable. Many other factors may cause an increase in the microbial load of traditional products, such as manufacture, handling, storage, and even marketing ways, which are still primitive and unhygienic (Osman ).

The current study was conducted to assess the safety of some traditional cheeses in Egypt, such as Ras, Domiati, and Mish, through chemical and microbiological examination.

Materials and Methods

Samples collection

One hundred and fifty random samples of Ras, Domiati, and Mish cheeses (50 each) were collected from different Egyptian Governorates. The samples were identified, placed in an ice box, and examined immediately.

Chemical analysis

Moisture and acidity were analyzed according to the AOAC guidelines (Association of Official Analytical Chemists) (2000) and salt according to the APHA guidelines (American Public Health Association) (2004).

Microbiological examination

Preparation of food homogenate and decimal dilutions, total bacterial count (TBC; CFU/g), presumptive coliform count (MPN/g), and isolation of E. coli were carried out according to the APHA guidelines (American Public Health Association) (2004).

Biochemical identification of E. coli (microscopic examination, oxidase, urea, IMVC, TSI, L-Lysin decarboxylase, carbohydrate fermentation tests, and confirmed tests for thermotolerant (fecal) coliforms) was carried out according to Silva description.

Serological identification of E. coli was done using DENKA SEIKEN CO., LTD. kits. The molecular characterization, and virulence genes detection was performed using PCR, where DNA was extracted from the bacterial isolates using QIAamp® DNA Mini Kit (Catalogue no.51304) according to the instruction manual. PCR was done for characterization of 5 genes of E. coli using Emerald Amp GT PCR master mix, Takara (Catalogue No. RR310A), using 5 different pair of primers (as uniplex PCR) as mentioned in Table 1. The PCR products were electrophoresed in 1.5% agarose according to that described in Sambrook study.

Table 1.

Oligonucleotide primers’ sequences and PCR conditions.

Target agent	Length of amplified product	Primer sequence (5’-3’)	Gene	Reference
S. aureus	102 bp	GGTTATCAATGTGCGGGTGG	sea	Mehrotra et al., 2000x
		CGGCACTTTTTTCTCTTCGG
	278 bp	CCAATAATAGGAGAAAATAAAAG	sed
		ATTGGTATTTTTTTTCGTTC
	209 bp	AGGTTTTTTCACAGGTCATCC	see
		CTTTTTTTTCTTCGGTCAATC
	164 bp	GTATGGTGGTGTAACTGAGC	seb
		CCAAATAGTGACGAGTTAGG
	451 bp	AGATGAAGTAGTTGATGTGTATGG	sec
		CACACTTTTAGAATCAACCG
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 57°C/40 seconds; extension: 72°C/45 seconds; No. of cycles: 35; final extension: 72°C/10 minutes.
	1250 bp	AC GGAGTTACAAAGGACGAC	23S rRNA	Straub et al., 1999
		AGCTCAGCCTTAACGAGTAC
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 55°C/40 seconds; extension: 72°C/1.2 minutes.; No. of cycles: 35; final extension: 72°C/12 minutes.
E. coli	266 bp	ATGTTATTTTCTGCCGCTCTG	Iss	Yaguchi et al., 2007
		CTATTGTGAGCAATATACCC
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 54°C/30 seconds; extension: 72°C/30 seconds; No. of cycles: 35; final extension: 72°C/7 minutes.
	614 bp	ACACTGGATGATCTCAGTGG	Stx1	Dipineto et al., 2006
		CTGAATCCCCCTCCATTATG
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 58°C/40 seconds; extension: 72°C/45 seconds; No. of cycles: 35; final extension: 72°C/10 minutes.
	508 bp	TGCAGAACGGATAAGCCGTGG	fimH	Ghanbarpour and Salehi, 2010
		GCAGTCACCTGCCCTCCGGTA
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 50°C/40 seconds; extension: 72°C/45 seconds; No. of cycles: 35; final extension: 72°C/10 minutes.
	620 bp	GGT GGT GCA CTG GAG TGG	Tsh	Delicato et al., 2003
		AGT CCA GCG TGA TAG TGG
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 54°C/40 seconds; extension: 72°C/45 seconds; No. of cycles: 35; final extension: 72°C/10 minutes.
	720 bp	CGATTCTGGAAATGGCAAAAG	phoA	Hu et al., 2011
		CGTGATCAGCGGTGACTATGAC
	Primary denaturation: 94°C/5 minutes; secondary denaturation: 94°C/30 seconds; annealing: 55°C/40 seconds; extension: 72°C/45 seconds; No. of cycles: 35; final extension: 72°C/10 minutes.

Staphylococci count (CFU/g) and S. aureus isolation were carried out according to the APHA guidelines (American Public Health Association) (2004).

Identification of suspected S. aureus strains (microscopic examination, catalase activity test, coagulase test, thermostable nuclease, and anaerobic utilization of mannitol) was carried out according to that described in Silva study. Molecular characterization of S. aureus strains and enterotoxin genes detection was done as in E. coli. Six genes of S. aureus (5 enterotoxins done by multiplex PCR and 23S rRNA) and six pairs (5 as multiplex and 1 pair as uniplex PCR) were used (Table 1).

Yeast and mold counts (CFU/g) were conducted according to APHA’s guidelines (American Public Health Association) (2004).

Statistical analysis

The collected data were analyzed using Statistical Package for the Social Sciences Statistics 17 for Windows.

Ethical approval

In this study, no experimental live animals were used. All cheese samples were collected directly from the Egyptian local markets.

Results

The chemical analysis of the examined samples, including moisture, salt, and acidity, is illustrated in Table 2; for Ras cheese samples, the mean values were 30.03, 3.30, and 0.65, respectively. The mean values of Domiati cheese samples were 56.44, 6.63, and 0.68, respectively, and were 58.70, 7.56, and 0.50, respectively, for Mish samples.

Table 2.

Chemical analysis of examined samples (n = 50 each).

Samples	Moisture %			Salt %			Acidity %
	Min.	Max.	Mean ± SE	Min.	Max.	Mean ± SE	Min.	Max.	Mean ± SE
Ras cheese	22.35	39.96	30.03 ± 0.59	2.00	4.40	3.30 ± 0.10	0.36	0.97	0.65 ± 0.02
Domiati cheese	48.92	62.92	56.44 ± 0.50	3.51	8.78	6.63 ± 0.20	0.36	2.16	0.68 ± 0.04
Mish	43.67	69.38	58.70 ± 0.97	3.51	9.33	7.56 ± 0.29	0.14	1.44	0.50 ± 0.05

As reported in Table 3, the TBCs of Ras, Domiati, and Mish samples were 2 × 108, 3 × 106, and 1 × 107, respectively, while coliforms were determined in 44%, 48%, and 92% of that examined in Ras, Domiati, and Mish samples, with a mean values of 3 × 105, 5 × 10, and 5 × 102, respectively. The examined samples were positive for E. coli in 8% of Ras cheese samples and in 4% of both Domiati and Mish samples, respectively, as shown in Table 5. The serological identification of the suspected isolated E. coli using slide agglutination test (Table 5) revealed that E. coli O125 was isolated from Ras and Domiati cheese samples; E. coli O18 was isolated from Ras samples, while E. coli O114 was detected in Mish samples. The molecular characterization of E. coli showed that all E. coli strains isolated from the present study were positive for phoA gene (Fig. 1). All isolates of E. coli lacked both stx1 and tsh genes; on the other hand, all detected isolates were positive for both iss and fimH genes (Figs. 2–5). Staphylococci were found in 92%, 88%, and 100% of Ras, Domiati, and Mish samples with mean values of 1 × 106, 4 × 105, and 1 × 105, respectively (Table 3). The incidences of S. aureus in the examined Ras, Domiati, and Mish samples based on biochemical identification were 26%, 36%, and 18%, as presented in Table 6. The number of molecularly identified S. aureus isolates by using 23S rRNA for the examined Ras, Domiati, and Mish samples was 2, 13, and 6, respectively (Fig. 6). The detection of the five classical enterotoxin genes of S. aureus revealed that the two strains identified from Ras cheese were enterotoxigenic strains having seb and sed genes; in Domiati samples, 10 strains were enterotoxigenic strains harboring seb, sed, and see genes, while the 6 strains from Mish samples were enterotoxigenic strains harboring seb gene (Fig. 7). The mean values of yeast / mold counts of the examined Ras, Domiati and Mish samples were 3 × 105/7 × 103, 1 × 105/ 4 × 103, and 5 × 105/3 × 104 as reported in Table 3.

Table 3.

Microbiological evaluation of examined samples (CFU/g) (n = 50 each).

		Ras cheese	Domiati cheese	Mish
Total bacterial count	No. (%) of positive samples	50 (100%)	50 (100%)	50 (100%)
	Min.	5 × 105	7 × 104	7 × 103
	Max.	1 × 109	1 × 107	1 × 108
	Mean ± SE	2 × 108 ± 0.5 × 108	3 × 106 ± 0.4 × 106	1 × 107 ± 0.2 × 107
Coliforms count (MPN/g)	No. (%) of positive samples	22 (44%)	24 (48%)	46 (92%)
	Min.	2 × 104	4 × 10	2 × 10
	Max.	2 × 106	2 × 102	2 × 103
	Mean ± SE	3 × 105 ± 1 × 105	5 × 10 ± 0.1 × 10	5 × 102 ± 0.8 × 102
Staphylococcus count	No. (%) of positive samples	46 (92%)	44 (88%)	50 (100%)
	Min.	1 × 104	1 × 104	7 × 102
	Max.	6 × 106	2 × 106	9 × 105
	Mean ± SE	1 × 106 ± 0.2 × 106	4 × 105 ± 0.7×105	1 × 105 ± 0.2 × 105
Yeast count	No. (%) of positive samples	45 (90%)	50 (100%)	46 (92%)
	Min.	1 × 104	3 × 103	4 × 103
	Max.	1 × 106	8 × 105	1 × 106
	Mean ± SE	3 × 105 ± 0.6 × 105	1 × 105 ± 0.2 × 105	5 × 105 ± 0.6 × 105
Mold count	No. (%) of positive samples	25 (50%)	22 (44%)	36 (72%)
	Min.	2 × 103	1 × 103	3 × 102
	Max.	2 × 104	2 × 104	1 × 105
	Mean ± SE	7 × 103 ± 0.9 × 103	4 × 103 ± 0.9 × 103	3 × 104 ± 0.7 × 104

Table 5.

Biochemical, serological, molecular identification, and incidence of virulence genes of E. coli isolated from examined samples using PCR.

Types of samples	Samples containing E. coli strains identified biochemically		Strains identified serologically			Strains identified by phoA gene	Strains harbor Stx1 gene	Strains harbor Tsh gene	Strains harbor Iss gene	Strains harbor fimH gene
	No.	%	No.	serotype
				No.	type	No.	No.	No.	No.	No.
Ras cheese	4	8	4	3	O125	4	Nil	Nil	4	4
				1	O18
Domiati cheese	2	4	2	2	O125	2			2	2
Mish	2	4	2	2	O114	2			2	2

Fig. 1.

Agarose gel electrophoresis of the PCR product of phoA gene for DNA extracted from analyzed E. coil isolates. Lane L: ladder; Lane P: positive control. Lanes 1–8: showing positive E. coil strains at 720 bp.

Fig. 2.

Agarose gel electrophoresis of E. coil stx1 virulence gene. Lane L: ladder; Lane P: positive control. Lanes 1–8: showing negative strains at 614 bp.

Fig. 5.

Agarose gel electrophoresis of E. coil fimH virulence gene. Lane L: ladder; Lane P: positive control. Lanes 1–8: showing positive strains at 508 bp.

Table 6.

Biochemical, molecular identification, and incidence of enterotoxin genes of S. aureus isolated from examined samples using multiplex PCR.

Types of samples	Samples harbor coagulase positive S. aureus		Strains identified by 23S rRNA	Samples harbor enterotoxigenic strains	Type of SEs
					sea	seb	sec	sed	see
	No.	%	No.	No.	No.	No.	No.	No.	No.
Ras cheese	13	26	2	2	Nil	2	Nil	1	Nil
Domiati cheese	18	36	13	10		10		3	1
Mish	9	18	6	6		6		Nil	Nil

Fig. 6.

Agarose gel electrophoresis of the PCR product of 23S rRNA gene for DNA extracted from analyzed S. aureus isolates. Lane L: ladder; Lane P: positive control. Lanes 1–21: showing positive S. aureus strains at 1,250 bp.

Fig. 7.

Agarose gel electrophoresis showing multiplex PCR amplification products for S. aureus enterotoxin genes. Lanes L, ladder lane P: positive control. Staphylococcal enterotoxin A (sea) positive isolates at 102 bp. Staphylococcal enterotoxin D (sed) positive isolates at 278 bp. Staphylococcal enterotoxin E (see) positive isolates at 209 bp. Staphylococcal enterotoxin B (seb) positive isolates at 164 bp. Staphylococcal enterotoxin C (sec) positive isolates at 451 bp.

Discussion

The chemical parameters, including moisture, salt, and acidity, are shown in Table 2; for Ras cheese samples, nearly similar results were obtained by Ahmed (2016) and El-Refaay concerning salt and acidity, while higher results were recorded by Awad , Osman , and Dahmash for salt and moisture. For Domiati cheese samples, nearly similar results for salt were obtained by Aly and El-Baradei , higher results recorded by El-kholy , El-Zahar (2014), and El-Refaay for salt and acidity. The results for the Mish samples were in agreement with El-Zahar (2014) and El-Refaay . The apparent variation among the examined parameters in different examined samples could be attributed to variances in composition, properties of raw milk, and biodiversity of the organisms in each product, as well as other ingredients employed in the manufacture of traditional raw products, especially with lack of Egyptian standards for such products (Aly ).

Total bacterial, presumptive coliform, yeast and mold counts were considered the most significant indices for the microbial quality (APHA (American Public Health Association), 2004). Nearly similar results of TBC for Ras cheese samples were obtained by Awad , El-Zahar (2014), and El-Leboudy , while lower results were found by Osman and Abd El-Halem . The results of TBC for Domiati cheese samples were in agreement with those obtained by Aly , Sayed , and Ibrahim , and higher results were obtained by El Sayed , while lower findings were obtained by El-kholy and Ibrahim . Nearly similar TBC results for Mish samples were reported by Zaki and Shokry (1988) and El-Zahar (2014). TBC is not directly related to the presence of pathogens or toxins, but it may be a convenient indicator of poor sanitation, defects in process control systems, and/or contaminated raw ingredients (APHA (American Public Health Association), 2004; Silva ). There was a negative correlation between TBC, salt, and acidity in the all examined samples, but was not significant as not all but most microorganisms were suppressed by salt and acidity content (Aly ). Nevertheless, there was a positive significant correlation between TBC and moisture in Domiati and Mish cheese samples (Table 4). The relatively high moisture allows the growth of different types of desirable and undesirable microorganisms that may be introduced through raw milk used or during the processing steps (Aly ).

Table 4.

Statistical correlation between chemical and microbiological analyses.

	Moisture %		Salt %		Acidity %
	Pearson correlation	Sig.	Pearson correlation	Sig.	Pearson correlation	Sig.
Ras cheese
TBC	0.215	0.134	−0.151	0.295	−0.171	0.235
Coliforms count	0.430a	0.002a	−0.394a	0.005a	−0.048	0.739
Staph. count	0.182	0.207	−0.197	0.170	−0.088	0.542
Yeast count	0.067	0.644	−0.070	0.630	−0.169	0.240
Mold count	0.169	0.241	−0.094	0.518	−0.078	0.589
Domiati cheese
TBC	0.326b	0.021b	−0.170	0.237	−0.237	0.097
Coliforms count	0.229	0.110	−0.806a	0.000a	−0.103	0.475
Staph. count	0.388a	0.005a	−0.267	0.061	−0.391a	0.005a
Yeast count	0.115	0.427	−0.306b	0.031b	−0.245	0.086
Mold count	0.062	0.668	−0.142	0.327	−0.256	0.073
Mish
TBC	0.423b	0.022b	−0.169	0.381	−0.047	0.807
Coliforms count	0.039	0.788	−0.590a	0.000a	−0.165	0.215
Staph. count	0.131	0.364	−0.315b	0.026b	−0.516a	0.000a
Yeast count	0.556a	0.000	−0.221	0.123	−0.481a	0.000a
Mold count	0.054	0.707	−0.144	0.317	−0.259	0.070

Correlation is significant at the 0.01 level (2-tailed).

Correlation is significant at the 0.05 level (2-tailed).

The presence of coliforms in cheese is objectionable as it reflects unsanitary conditions during production, handling, storage, and even distribution (Sayed ). Its existence may constitute a biological hazard since coliforms are implicated in many reported cases of food poisoning. Moreover, coliforms possess an economic significance as products contaminated with coliforms will be of inferior quality and unmarketable (Martin ). Nearly similar results of coliforms for Ras cheese were obtained by El-Zahar (2014), lower results were obtained by Osman , Awad , and Abd El-Halem , while higher results recorded by Abd elsalam (2014) and Ahmed (2016). For Domiati cheese samples, higher findings were introduced by Ibrahim and Abd Allah , while lower results were recorded by Sayed . For Mish samples, higher results were recorded by El-Zahar (2014). There was a positive significant correlation between coliform count and moisture in Ras cheese samples (Table 4). The comparatively low incidence of coliforms in Ras cheese samples may be related to low moisture content and consequently low water activity that will influence microbial growth (Trmčić ). Salt content had a significant negative correlation with coliforms in all examined samples as added salt not only enhances flavor but it also acts as a preservative; the anti-microbial activity of salt is owed to its ability to decrease water activity in food by damaging the microbial cell membrane (Ayyash and Shah, 2011). Concerning E. coli incidence rate, higher results for Ras cheese samples were obtained by Ombarak and Abd El-Halem . Nearly similar results in Domiati cheese samples were recorded by Sayed , while El-kholy and Ibrahim obtained higher results. For Mish samples, higher results obtained by Dawoud . All isolated E. coli serotypes (O125, O18, and O114) belonging to enteropathogenic E. coli mainly infect infants younger than 2 years. Acute watery diarrhea, vomiting, and low-grade fever are the most detected symptoms. E. coli O18 also results in extra intestinal infections as neonatal meningitis, septicemia, pyelonephritis, and pneumonia (Stenutz ; Dedeić-Ljubović ; Ewida and Hussein, 2019). The molecular characterization of E. coli was carried out using phoA gene (alkaline phosphatase) as a target gene for detecting E. coli (Thong ) and all E. coli strains were positive for (phoA) gene. E. coli bacteria possesses multiple virulence genes from which four genes were detected (stx1, tsh, iss, and fimH); all detected isolates were positive for both (iss) and (fimH) genes. The virulence gene iss encodes a protein associated with increased serum survival of E. coli in humans and is considered as a protective factor for the pathogen against phagocytosis. E. coli acquires this gene to have the ability to cause extra intestinal infections, such as neonatal meningitis and sepsis (Sarowska ). The adhesion criteria of E. coli are related to fimH virulence gene which is important for both normal ecosystem and pathogenicity of E. coli. Although 95% of E. coli isolates show expression for type 1 fimbriae, the gene is not essential for the presence of E. coli in the colon. However, it helps E. coli to transitory colonize in the oropharyngeal portal which is significant for normal fecal/oral transmission of E. coli among hosts, as well as it plays an important role in the incidence of urinary tract infections caused by E. coli (Sokurenko ; Sarowska ).

Staphylococci are widespread microorganisms that are present everywhere. Staphylococci outbreaks are usually caused by food handlers with bad personal hygiene (EL-Kholy ). Our results (Table 4) showed that there was a significant positive correlation between moisture and staphylococci count and a significant negative correlation between it and acidity in Domiati cheese samples. While staphylococci count significantly decreases with increase in salt and acidity in Mish samples, the growth of staphylococci relies mainly on many parameters, such as temperature, pH, salt, water activity, and oxidation reduction potential; their growth can be decreased by the integration of two or more parameters (Bellio ). Staphylococcus aureus is incriminated in 9,000 deaths every year; it is regarded as the third most serious pathogen causing foodborne illnesses worldwide (Ahmed ). The presence of S. aureus in dairy products is regarded as a serious public health hazard as the organism may lose its viability during manufacturing processes but its preformed heat stable enterotoxin will still present and induce vomiting and diarrhea within 1–6 hours. However, food poisoning is not only the main health problem concerning S. aureus, but it also causes toxic shock syndrome, pneumonia, post-operative wound infection, and skin infections (FDA (Food and Drug Administration), 2012; EL Malt, 2013; Bellio ). Large numbers of extracellular proteins and toxins are produced by S. aureus. The most important toxins are Staphylococcal enterotoxins (SEs), which are SEA, SEB, SEC, SED, and SEE, that cause 95% of staphylococcal food poisoning cases, while only 5% of outbreaks occurred by newly described SEs (SEG-SEI, SEIJ, SEIQ, SER-SET, and SEIU-SEIV) and TSST-1. SEs are soluble in water, stable against most proteolytic enzymes (pepsin and trypsin), especially SEB, and heat-resistant even after boiling for 30 minutes (Bhunia, 2008; Ahmed ). The detection of the five classical enterotoxin genes of S. aureus (Fig. 7) revealed that Ras cheese strains harbor the seb and sed genes, while Domiati cheese strains were harboring seb, sed, and see genes. Moreover, Mish samples S. aureus strains harbor the seb gene. In Egypt, Abolghait recently reported similar results that methicillin-resistant S. aureus isolated from chicken meat and giblets often produces staphylococcal enterotoxin B (SEB) in non-refrigerated raw chicken livers. Production of enterotoxins by S. aureus is influenced by a combination of several factors, such as moisture, water activity, salt, acidity, and temperature as well as microbial competition (FDA (Food and Drug Administration), 2012; Bellio ).

The low pH and the high nutritional profile of most cheeses are favorable for the growth of yeasts and molds. Their presence in cheese not only influences the sensory characteristics and decreases the grading of cheese but it also possesses a potential hazard. Some of them have the ability to produce several toxins, such as aflatoxins, and others have the ability to cause human and animal pathogenicity (Ledenbach and Marshall, 2009; ELbagory ; El-Fadaly ). Nearly similar results of yeast and mold counts for Ras samples were obtained by El-Zahar (2014) and El-Fadaly , and lower counts were recorded by ELbagory . Nearly similar results in Domiati cheese were obtained by Sayed , higher results were obtained by Aly , and lower results were recorded by Ibrahim ). The results of Mish samples are well in line with those reported by El-Zahar (2014) and El-Refaay . In Mish samples, a significant positive correlation was found between yeast and moisture, as well as a significant negative correlation with acidity. The higher moisture content of the product, the more susceptibility for spoilage, off flavors, and over ripening, which result in more breakdown of acids, sugars, proteins, and lipids (Morales ; Aly ). Corresponding to the relatively high counts of yeasts and molds in the examined samples, using raw milk, poor cleaning practices, and inadequate ripening and storage conditions are the main causes (D’Amico, 2014).

Conclusion

Enterotoxigenic S. aureus harboring seb gene and enteropathogenic E. coli (serogroups O18, O114, and O125) were frequently isolated from soft and hard artisanal cheeses in Egypt. Therefore, strict hygienic measures should be applied during their manufacture, handing, and distribution. Also, more awareness training programs for producers of dairy products should be conducted about how to produce safe products through the implementation of the recent food safety management systems as good manufacturing practices as well as hazard analysis and critical control points in production sites. Also, consumers should be aware of the correct handling and storage methods in order to maintain product safety.