Expression analysis of microbial rhodopsin-like genes in Guillardia theta.

The Cryptomonad Guillardia theta has 42 genes encoding microbial rhodopsin-like proteins in their genomes. Light-driven ion-pump activity has been reported for some rhodopsins based on heterologous E. coli or mammalian cell expression systems. However, neither their physiological roles nor the expression of those genes in native cells are known. To reveal their physiological roles, we investigated the expression patterns of these genes under various growth conditions. Nitrogen (N) deficiency induced color change in exponentially growing G. theta cells from brown to green. The 29 rhodopsin-like genes were expressed in native cells. We found that the expression of 6 genes was induced under N depletion, while that of another 6 genes was reduced under N depletion.

Introduction

Microbial rhodopsins are light-receiving membrane proteins that act as light-driven ion pumps, light-driven ion channels, light-driven enzymes, and photosensors [1]. The rhodopsin protein consists of seven transmembrane helices and binds an all-trans-retinal chromophore. The all-trans-retinal chromophore binds to a lysine residue conserved in the seventh transmembrane (TM) helix of all microbial rhodopsins through a protonated retinal Schiff base (SB) linkage. For decades, since light-driven H+ pump bacteriorhodopsin (BR) was discovered in Halobacterium salinarum (formerly H. halobium) [2], microbial rhodopsin had been considered a unique protein possessed by a limited number of species, such as halophilic archaea. However, metagenomic analysis in the 2000s revealed that many marine prokaryotes have ion-pumping rhodopsins [3]. In 2002, a rhodopsins in the green alga Chlamydomonas reinharditii was found to act as a light-gated ion channel [4]. Histidine kinase rhodopsin (HKR) was also found in C. reinharditii, which contains a histidine kinase domain and response regulator domain connected to the C-terminal side of the rhodopsin domain as the first enzymatic rhodopsin [5]. The other enzymatic rhodopsin family is found in eukaryotes, and example include rhodopsin-guanylate cyclase (Rh-GC) [6] and rhodopsin-phosphodiesterase (Rho-PDE) [7]. Moreover, a new group of rhodopsins named heliorhodopsin (HeR) was also found in nature [8]. Heliorhodopsins display less than 15% sequence identity with microbial and animal rhodopsins. In the membrane, HeR is oriented in the opposite direction to the other rhodopsins. It is now revealed that microbial rhodopsins are widely distributed in not only bacteria but also cyanobacteria, algae and giant viruses [9-11]. Physiological roles,are related to energy production, phototaxis, regulation of gene expression, and photoautotrophy. ATP synthesis measurement in mutants of haloarchea indicates that BR and light-driven Cl− pump halorhodopsin (HR) generate proton motive force (PMF) depending on light [12, 13]. Sensory rhodopsins (SR) and channel rhodopsins act as photosensor for photomotility in H. salinarum [14] and C. reinharditii [15], respectively. Anabaena sensory rhodopsin (ASR) activates a soluble transducer protein (ASRT) and regulates gene transcription [16]. Proteorhodopsin (PR) contributes to phototrophy in some species of flavobacterium [17] and proteobacterium [18] in the marine environment. Recent advances in genome research have led to the discovery of many proteins that are similar to microbial rhodopsin but lack the conserved retinal-binding lysine residue (Rh-noK). There are currently 5,558 known genes of microbial rhodopsins, including HeRs, of which approximately 600 are Rh-noK. [19]. Some Rh-noK genes were tandemly arranged with PR and retinal biosynthesis genes forming a putative operon [19]. Although the molecular properties of microbial rhodopsins are studied by many approaches, studies on the physiological functions of these molecules in nature are still in progress.

Metagenomics analyses revealed that the abundance of the PR gene is negatively correlated with nitrate concentration; however, there was no significant correlation with light intensity in the north of the Sargasso Sea [20]. Nitrogen is an important source of metabolites including amino acids. Gene expression analysis of proteorhodopsin-containing flavobacteria Dokdonia sp. MED134 revealed that the carbon fixation pathway was shifted to that with anaplerotic CO2 fixation under light conditions [21]. The effect of light was more significant in the poor-nutritional environment [21]. These results suggest that microbial rhodopsins are related to primary metabolisms processes in Dokdonia sp. MED134, such as carbon (C) and nitrogen (N) assimilation. N availability is limited in the marine environment; therefore, N availability could be the rate-limiting condition for primary metabolic processes, such as CO2 fixation [22]. Although nitrate ions (NO3−) are a major source of N in the marine environment, anthropogenic activities result in loading a high concentration of chemically reduced forms such as ammonium ions (NH4+; [23]). To assimilate NO3− into amino acids, it first needs to be reduced to NH4+.

Cryptophytes are unicellular algae ubiquitously found in marine and freshwater habitats [24]. Cryptophyte is considered a model taxon to study the evolution of plastids. Cryptophytes have a secondary plastid that has been acquired from other eukaryotes with primary plastids [25]. Guillardia theta is a cryptophyte isolated from coastal seawater [26]. Owing to the importance of the evolution of plastids, G. theta was the first cryptophyte whose nuclear genome was sequenced [27]. The nuclear genome of G. theta encodes many genes similar to microbial rhodopsins. While the molecular functions of some of these genes were characterized by heterologous expression systems [28], the molecular properties and physiological functions of many G. theta rhodopsins are currently not known. However, after the report of the genomic sequence of G. theta, new functional molecules have been reported, such as natural anion channels [29] and DTD-cation channels [30, 31]. Based on these studies, interest in the uses of these rhodopsin-like proteins in native cells has been garnered.

In this study, we investigated the expression pattern of rhodopsin-like genes in G. theta under various growth conditions. The N deficiency induced color change in exponentially growing G. theta cells from brown to green. The expression of 29 rhodopsin-like genes was observed in native cells. We revealed that the expression of 6 genes was induced under N depletion, while those of the other 6 genes were reduced under N depletion. We show that some of the rhodopsin-like genes are related to the regulation of N-assimilation by energy production in this organism.

Results

Phylogenetic analysis of microbial rhodopsin-like genes

Using the gene-specific NCBI reference sequences (RefSeq) database, we found 44 rhodopsin-like genes in the G. theta genome, although over 50 genes were suggested in a previous study [29]. The difference in the number of rhodopsin-like genes derived from the improvement of annotation in the database. Although two of them were predicted to encode hypothetical 7-transmembrane receptors (Gt_161042 and Gt_162503), our phylogenetic analysis showed that their sequences could not align with the other 42 G. theta rhodopsin and the representative rhodopsin sequences. Based on these results, it is considered that these two genes do not encode microbial rhodopsin. The other 42 genes were predicted to encode microbial rhodopsin proteins. Phylogenetic analysis indicated that most G. theta rhodopsins showed low similarity to representative rhodopsins from other species (Fig 1). There are five clades of G. theta rhodopsins. Clade D and E contain four cation channels and two anion channels, respectively. A lysine residue corresponding to K216 of BR is one of the important residues of microbial rhodopsins because it forms a Schiff base linkage with the retinal chromophore. The lysine residues are also conserved in most G. theta rhodopsins, although nine of the 42 rhodopsins do not have lysine residues (Rh-noK; S1 Fig). Clades A, B, and D contain two, five, and two Rh-noKs, respectively.

Fig 1

The phylogenetic tree of rhodopsin-like gene expression of Guillardia theta (indicated in bold green) with representative microbial rhodopsins.

Percentage of replicate trees higher than 80, in which the associated taxa clustered together in the bootstrap test, is shown next to the branches. Guillardia theta rhodopsins whose activity has already been reported are marked by the red underlines.BR: bacteriorhodopsin from Halobacterium salinarum, AR1: archaerhodopsin-1 from Halorubrum chaoviator, AR2: archaerhodopsin-2 from Halobacterium sp. AUS-2, AR-3: archaerhodopsin-3 from Halorubrum sadomense, MR: middle rhodopsin from Haloquadratum walsbyi, HwBR: bacteriorhodopsin from Haloquadratum walsbyi, HsSRI: sensory rhodopsin I from Halobacterium salinarum, HvSRI: sensory rhodopsin I from Haloarcula vallismortis ATCC 29715, HsSRII: sensory rhodopsin II from Halobacterium salinarum, NpSRII: sensory rhodopsin II from Natronomonas pharaonis, SrSRI: sensory rhodopsin I from Salinibacter ruber M8, HsHR: halorhodopsin from Halobacterium salinarum, NpHR: halorhodopsin from Natronomonas pharaonis, SrHR: halorhodopsin from Salinibacter ruber DSM 13855, ChR1: channelrhodopsin 1 from Chlamydomonas reinhardtii, ChR2: channelrhodopsin 2 from Chlamydomonas reinhardtii, GlPR: proteorhodopsin from Gillisia limnaea, KR1: proteorhodopsin from Krokinobacter eikastus, NdR1: proteorhodopsin from Nonlabens dokdonensis, GPR: Proteorhodopsin from uncultured marine gamma proteobacterium, BPR: Blue-absorbing Proteorhodopsin from uncultured gamma proteobacterium, ESR: proteorhodopsin from Exiguobacterium sibiricum, TR: thermophilic rhodopsin from Thermus thermophiles, XR: xanthorhodopsin from Salinibacter ruber, GR: Gloeobacter rhodopsin from Gloeobacter violaceus, C. JLT1363 ClR: bacterial chloride pump rhodopsin (ClR) from Citromicrobium sp. JLT1363, CbClR: ClR from C. bathyomarinum, FR: ClR from Fulvimarina pelagi, SbClR: ClR from Sphingopyxis baekryungensis, NmClR: ClR from Nonlabens marinus, PmNaR: sodium pump rhodopsin (NaR) from Phycisphaera mikurensis, LaNaR: NaR from Lyngbya aestuarii, TrNaR1 and 2: Truepera radiovictrix NaR1 and 2, MsNaR: NaR from Micromonospora sp. CNB394, DsNaR: NaR from Desulfofustis sp. PB-SRB1, IaNaR: NaR from Indibacter alkaliphilus, K. 4H-3-7-5 NaR: NaR from Krokinobacter sp. 4H-3-7-5, KR2: NaR from Krokinobacter eikastus, DsNaR: NaR from Dokdonia sp. PRO95, NsNaR: NaR from Nonlabens sp. YIK-SED-11, FsNaR: NaR from Flagellimonas sp., NdNaR: NaR form Nonlabens dokdonensis.

Using cDNAs derived from the extracted mRNAs, we re-analyzed the amino acid coding regions of Gt_164280 and Gt_120390. Gt_164280 was compared to the model transcript in the RefSeq database (S2 Fig). The nucleotides corresponding to the 451st to 462nd base were deleted in the model transcript and the 710th, 816th and 869th bases of re-analyzed sequence were replaced from T to C, T to C and G to A, respectively (S2A Fig). As a result, a four-amino acid insertion occurred in the amino acid sequence corresponding to TM4 in the predicted protein from the re-sequenced gene compared to that of the model transcript (S2B Fig). In re-analyzed sequence, Met234 and Ser287 of the model transcript were replaced to Thr and Gly, respectively. Gt_120390 was compared to both the model transcript and the genomic sequence (S3 Fig). The seventh exon predicted from the genomic sequence was an exact match to the mRNA sequence we determined, but the model transcript had a large deletion of 144 bases (S3A Fig). On the other hand, the mRNA we determined had a 44-base extension after the 10th exon to the intron region and then a stop codon was appeared. The 11th exon was deleted in our sequence. As a result, the transmembrane region of the predicted protein from the re-analyzed gene was consistent with that of the model transcript, but a 48-residue insertion and 14-residue amino acid substitution occurred in the C-terminal extension (S3B Fig). The C-terminal six residues were truncated in the predicted protein from re-analyzed transcript.

Guillardia theta also carries two heliorhodopsin-like genes (XM_005821825 and XM_005823076); however, we did not analyze the expression of these heliorhodopsins in this study.

Effects of nitrogen availability in the growth of G. theta

Guillardia theta could grow in an artificial sea water-based medium. The color of cells turned reddish-brown to green in the late culture period (Fig 2). The color change reflected a difference in the carbon (C) or nitrogen (N) availability. Cells cultured in the C-deficient medium remained reddish-brown at the late stage of culture, whereas cells cultured in N-deficient medium turned green earlier than those cultured in N-sufficient medium. Growth of G. theta cells in aeration culture (12 h/12 h day/night) was monitored (Fig 3). The cellular growth in NO3- as the sole N source was stopped by day 5 (Fig 3A, top panel), which was earlier than those under other conditions containing NH4+ (Fig 3A, middle and bottom panels). The growth rate in the logarithmic phase depended only on the NH4+ concentration (Fig 3A, middle and bottom panels). Greening was started in the late log phase to the stationary phase and was stimulated under N-deficient conditions. These results indicate that cell greening was caused by N deficiency in the cells. Furthermore, greening occurred when NO3- was the sole N source but was not observed when NH4+ was the sole N source. These results indicate that NH4+ was preferred as the N source compared with NO3- in G. theta cells.

Fig 2

Representative Guillardia theta cells grown in different nitrogen conditions.

Left; Normal C/N condition, Middle; C depletion, Right; N depletion.

Fig 3

Effect of nitrogen condition on growth of Guillardia theta.

a; The effect to growth rate, b; The effect to chlorophyll a content. Data are the mean value of three experimental replicates (±SD).

To investigate the effect of N nutritional status on the pigment content, pigment extraction from the cells was carried out with acetone, and the change in the chlorophyll content was investigated (Fig 3B). As a result, the Chl a content decreased under the culture conditions where the color of the cell changed to green. In addition, the times when the Chl a content was less than 2 μg/105 cells and when the color change of the cell almost agreed with each other. These results suggest that chlorophyll content is one of the values that can be used as an indicator of N depletion.

Gene expression pattern in different N availability on G. theta

The expression pattern of 42 microbial rhodopsin-like genes was investigated under different nitrogen conditions. The full length of each rhodopsin-like gene was amplified by reverse transcription polymerase chain reaction (RT-PCR). Twenty-nine genes could be amplified from mRNA derived from native cells (S4 Fig), indicating that these 29 genes were expressed in native cells. Among them, 25 genes could be detected using quantitative RT-PCR method. Guillardia theta has a predicted beta-carotene 15, 15'-monooxygenase gene (blh; Gt_105242), which is an enzyme that produces all-trans-retinal from beta-carotene. Based on this result, the relative expression of 25 microbial rhodopsin genes and a blh gene under N-deficient conditions against N-sufficient condition were quantified (Fig 4). The expression levels of nine of the 25 genes and the blh gene increased in N depletion (Fig 4A). Among these genes, six microbial rhodopsin genes showed > 2-fold increase in N depletion. In particular, the expression level of two genes significantly increased; Gt_120390 (GtCCR1) showed 10-fold increase and Gt_111593 (GtACR1) showed a 136-fold increase in N depletion (Fig 4A, middle and right panels, respectively). The expression levels of one anion channel and two cation channels significantly increased under N depleted conditions.

Fig 4

Effect of nitrogen condition on rhodopsin-like gene expression of Guillardia theta.

a; genes of which expression levels increased in N depletion, b; genes of which expression levels decreased in N depletion. Data are the mean value of three experimental replicates. The error bar shows the lower and upper bound of the fold-change.

The expression level of 15 genes decreased upon N depletion (Fig 4B). Among these genes, six genes showed a > 0.5-fold decrease in N depletion. The expression of the genes encodeing putative sensory rhodopsins Gt_092481 (GtR1) and Gt_085745 (GtR2), and proton pump Gt_139416 (GtR3) were significantly suppressed in N deficiency. The gene expression of Gt_122016 (putative HKR) also tended to decrease under N-deficient conditions. Six Rh-noKs were expressed in native cells. The expression of two of six Rh-noKs, Gt_150025 and Gt_150790, was significantly suppressed in N deficiency (< 0.5-fold decrease). There was no difference in the gene expression of Gt_159333 regardless of nitrogen conditional.

Discussion

N availability of Guillardia theta

While NO3− assimilation requires more reducing power than NH4+, the preferential utilization of NH4+ had inhibitory effects on the growth in aqueous culture conditions resulting from proton imbalance [32]. Therefore, there are variations in the preference for nitrogen sources among organisms. The growth pattern of G. theta cells indicated that these algae prefer to use NH4+ as an N source rather than NO3− (Fig 3). The color of G. theta cells turned reddish-brown to green, which was related to the nitrogen nutritional condition (Fig 2). Rhodomonas sp, the other species of cryptophyta, also caused the cell color change in N depletion, similar to G, theta [33]. In this case, phycoerythrin was preferentially degraded compared with Chl a and c under N-limiting conditions [33]. Based on this knowledge, the reason for cell color change in N depletion (Fig 2) is predicted to decrease of color pigments, such as phycobilin, carotenoid, and chlorophyll. Quantitative analysis of phycobilin and phycoerythrin is a topic of future research.

Putative physiological functions of rhodopsin-like genes in G. theta

In our results, N depletion induced a decrease in chlorophyll a content (Fig 3B) and an increase in the expression of some rhodopsin-like genes (Fig 4). There was an overall negative correlation between PR gene abundance and chlorophyll a concentrations (but not light) in the surface samples and the depth profiles [20]. In the latter, there was also a negative correlation between PR genes and inorganic nutrients. The decrease in chlorophyll a content during the greening period suggested that the solar energy conversion by photosystems I and II decreased during the greening period. These results suggest that many rhodopsin-like genes are expressed under N-deficient conditions to compensate for the decrease in the utilization of solar energy. One of the physiological functions was predicted to emerge PMF for ATP synthesis [1]. Gt_139416 (GtR3) induced hyperpolarization of hippocampal neurons in response to blue light illumination and inhibited neuronal spikes [34]. Although the ion transporting activity was not characterized in detail, this study suggested that GtR3 could function as a light-dependent H+ pump. The expression of GtR3 decreased with N depletion (Fig 4B), suggesting GtR3 might play a role other than the generation of PMF in N-depleted cells. The phylogenetic analysis showed that G.theta rhodopsin genes form five distinct clades from other representative microbial rhodopsins (Fig 1 and S1 Fig). Clade A includes GtR1 and GtR2, which have been suggested in the past as sensory rhodopsin related to phototaxis [28], but the functions of the other molecules are not known. The function of the molecules in Clade B is still unknown. This clade contains five Rh-noKs, the most numerous of all clades. The gene expression of all Rh-noK genes in clade B tended to decrease in N depletion (Fig 4). Although the function of these Rh-noK genes remains unknown, there is a possibility that these Rh-noKs has some function to modulate nitrogen homeostasis. Two of the three molecules in Clade C contain the histidine kinase domain, so they are predicted to be histidine kinase rhodopsins (HKR). The photoreaction of rhodopsin domains was reported in HKRs from C. reinharditii [5]. However, the histidine kinase activity of HKR as well as its physiological functions have not been revealed. Clade D has four cation channels reported to date [30, 31] and other unexplored molecules may also have cation channel activity. The Clade also contains two Rh-noKs. Clade E contains two anion channels GtACRs [29]. The channel activity of Gt_161302 was also investigated in this study; however no activity was observed [29]. GtACR1 transports NO3− more preferentially than other anions [29], so that the increase in GtACR1 expression could enhance the transport of NO3− in native cells to compensate for N depletion. Gt_120390 (GtCCR1) and Gt_111593 (GtACR1) showed relatively red-shifted maximum absorbance in the CCR and ACR family, respectively [29, 30]. The expression of these genes was drastically increased in N depletion (Fig 4A). The cell color change in N depletion (Fig 2) should be the cause of change in the light absorbance spectrum of G. theta cells compared with N sufficiency. The change in light absorbance spectrum might be the cause of the increase in GtCCR1 and GtACR1 in N depletion.

Rh-noK expression

The expression of Rh-noK genes in native G. theta cells was first detected in this study. Unexpectedly, six Rh-noK genes were expressed in G. theta cells (Fig 4 and S4 Fig), indicating that these Rh-noK genes were expressed and coded as functional proteins. Rh-noK does not have a lysine residue that binds the chromophore, all-trans retinal, so it is likely to function without binding the all-trans retinal. Photoreceptor proteins such as phytochrome and cyanobacteriochrome have GAF domains that bind chromophore phytochromobilin [35]. The chromophore binds to conserved cysteine residues in the GAF domain. However, as Rh-noK has no conserved lysine residues, there are also proteins that have a GAF domain but no conserved cysteine residues [36]. Although these proteins could not bind any chromophore, they have many diverse functions, such as a sensor for sodium-ion [37] and chloride ion concentrations [36]. Many Rh-noK genes have been found in organisms such as fungi and algae [38]; therefore, they play important roles in their lives. In yeast, Rh-noKs (called ORPs) are involved in the regulation of the plasma membrane H+-ATPase [39] and the maintenance of pH homeostasis [40]. It has been suggested that it has been shown to function as a chaperone [41]. The study of Rh-noK will be an interesting field for future investigation.

This study focused on the gene expression pattern of microbial rhodopsin-like genes in G. theta and revealed that nitrogen nutrient conditions affected to gene expression patterns. In the next step, the interest should be on the gene and/or protein expression under other circumstances, such as light conditions. The temporal and positional patterns of their expression will also be interesting to reveal the functional differentiation among these rhodopsins in native cells.

Methods

Cell culturing

Guillardia theta CCMP2712 was obtained from the Provasoli-Guillard National Center for Marine Algae and Microbiota. Cultures were grown in polyethylene culture flask in h/2 media aerated at 25°C under white light (30 mmol photons m−2 s−1) with light-dark cycle (12 h: 12 h). The growth rate was monitored by the optical density at 730 nm (OD 730). The value of OD 730 was correlated with the cell number which was counted with a cell counting plate (Fukaekasei, Japan). The cell number was then calculated according to the equation described below.

Measuring chlorophyll content

Cells were collected from 1 mL culture by centrifugation. The collected cells were finally suspended in 90% acetone to obtain an extract containing all the pigments. The concentrations of chlorophyll a in the cells were determined by absorption using a UV/VIS spectrophotometer (Unicam UV 550, Thermo Spectronic, UK) and calculated according to the equations described below [42].

Where A664 and A630 represent the absorptions at 664 and 630 nm, respectively.

RNA extraction

Cells were grown under different nitrogen conditions (Table 1) based on artificial seawater media (h/2 media). The cells harvested by centrifugation at 3,000 × g for 15 min at 4°C. Total cellular RNA was isolated using the RNeasy mini kit (QIAGEN, Germany) with a manufacturing protocol.

Table 1

Nitrogen concentration of culture condition.

Condition	NO3- (M)	NH4+ (M)	Total N (M)
N×0	0	0	0
NO3×0.3	4.15×10−4	0	4.15×10−4
NO3×1	1.38×10−3	0	1.38×10−3
NO3×3	4.15×10−3	0	4.15×10−3
NH4×0.3	0	4.15×10−4	4.15×10−4
NH4×1	0	1.38×10−3	1.38×10−3
NH4×3	0	4.15×10−3	4.15×10−3
NO3+NH4×0.3	2.65×10−4	1.50×10−4	4.15×10−4
NO3+NH4×1	8.82×10−4	5.00×10−4	1.38×10−3
NO3+NH4×3	2.65×10−3	1.50×10−3	4.15×10−3

RT-PCR to amplify full length of microbial rhodopsin genes

The RNA was reverse-transcribed using the SMARTerTM RACE cDNA Amplification Kit (Takara Bio, USA). Oligo-dT primers and random primers (N-15) were used for the first strand synthesis. The full-length microbial rhodopsin-like genes were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs, USA) and gene-specific primers based on the mRNA sequences in the NCBI database (Table 2). Gene-specific primers contained restriction enzyme recognition sites to clone each gene to the pET21a vector.

Table 2

Primer sequences for amplification of full-length microbial rhodopsin genes.

Gene name	Accession number of mRNA	Primer sequence 5' - 3'
		Forward primer (5’– 3’)	Reverse primer (5’– 3’)
Gt_62605	XM_005842420.1	GATGCTAGCATGGCAGCGTGCGCGACG	GATCCTCGAGGACAAACTCTCTCTGTG
Gt_85284	XM_005837311.1	GATCATATGGATGTGAGTTCTGCCG	GATCCTCGAGGATGTAAGATTCAACG
Gt_85745	XM_005836281.1	GATCATATGGTCGAGGAGGGGATG	GATCCTCGAGCACGTATTCTTTTTGAG
Gt_86360	XM_005834275.1	GATCATATGGCAGCAGCGATGGGACG	GATCCTCGAGAACATATTGCTGGGAG
Gt_91599	XM_005841277.1	GATCATATGGCCTCTTCCTTCGG	GATCCTCGAGAATGGATTCATATCCTG
Gt_92481	XM_005838710.1	GATCATATGGTGCTCCAGCAGCTTGC	GACTAGCGGCCGCCACATACTCCTGGTTC
Gt_99631	XM_005841908.1	GATCATATGAGGTCGATCCAATTTTTATTG	GATCCTCGAGGTCGTTTCCGATATTCTC
Gt_99837	XM_005841278.1	GATCATATGTCTGAGGTATCGGAGGC	GATCCTCGAGGACGTACTGCTGGGAG
Gt_99928	XM_005841372.1	GATCATATGGTTGCGAGCAGCGCTG	GACTAGCGGCCGCGAAGTCCGACTCGCG
Gt_106708	XM_005834183.1	GATCATATGTCGAGCCTGACTAACGC	GATCCTCGAGGACTAGGGAAGTCTTCTC
Gt_106800	XM_005834276.1	GATCATATGCTTTTTGAGGCAGAGC	GATCCTCGAGGACGTACTGCTGGGAGGAC
Gt_107802	XM_005833107.1	GATCATATGACAGGATCGGTCCCCGG	GACTAGCGGCCGCCAACTTGCGGGTGGG
Gt_107989	XM_005832876.1	GATCATATGGTTTCTTCGAGCGCAG	GATCCTCGAGCCTGATACTTCTCTTGGC
Gt_109252	XM_005831750.1	GATCATATGGCCTTCGCTGGACCC	GATCCTCGAGAACGTACTGCTGGGAGG
Gt_111593	XM_005829240.1	GATCATATGTCAAGCATCACCTGCG	GATCCTCGAGAGCCGAATCATCATGCTC
Gt_120390	XM_005820365.1	GATGCTAGCATGGTGGAAAGCAGTGCAG	GATCCTCGAGTCCACACGCAGCAGCTTC
Gt_120936	XM_005819792.1	GATCATATGCCGGGGCTGATGTGGC	GACTAGCGGCCGCCTGCCTTGCCTTGGG
Gt_122016	XM_005818716.1	GATCATATGGAAAAGGAGCGGAGAG	GATCCTCGAGAACGCGACTTCCTTTC
Gt_122924	XM_005817793.1	GATCATATGTTCCAGATTCTCGC	GATCCTCGAGAACGAACTCCTTTGAC
Gt_135937	XM_005836710.1	GATCATATGACTGATTCAACTCCG	GATCCTCGAGCTCAGGCGTGAACATGATG
Gt_138253	XM_005833449.1	GATCATATGGCCATTGAAAGTCTGTC	GATCCTCGAGGACGTATTCCTTATCCG
Gt_139416	XM_005831714.1	GATCATATGCTCGTTGGGGAGGGCGC	GATCCTCGAGGATGGATTCGTAGCCAG
Gt_145279	XM_005823958.1	GATCATATGCCAGCGGCGGTGCAGGC	GATCCTCGAGAACATATTCACGAGTTC
Gt_146828	XM_005821925.1	GATCATATGGCAAGCCAAGTCG	GACTAGCGGCCGCGCACATGGAATGATC
Gt_146834	XM_005821936.1	GATCATATGAGCACAACTCAAAACTC	GATCCTCGAGAAAAATGAAAGTAGATTC
Gt_148137	XM_005820041.1	GATCATATGGCGAGGATGAGGGAAGG	GATCCTCGAGGAGATTGTCTTCCAGGTC
Gt_148915	XM_005818945.1	GATCATATGAGCACCTCTTCGGTAGC	GATCCTCGAGGACGTCACGTGACATC
Gt_148916	XM_005818946.1	GATCATATGAGCACCTCTTCGGTAGC	GATCCTCGAGCACATCACGCGACAT
Gt_150025	XM_005841409.1	GATGCTAGCATGTTCATTGGAGCTATCTG	GATCCTCGAGAACATACTGGTTGGTG
Gt_150790	XM_005838658.1	GATCATATGCTGGAGATGCTGAACG	GATCCTCGAGGACATATTCGCGAGACTG
Gt_150796	XM_005838672.1	GATCATATGCCGTTCGCTATGCTCGC	GACTAGCGGCCGCAACATATTCGCGAGCC
Gt_151068	XM_005837691.1	GATCATATGGCTGGAGCCGCAGGGG	GATCCTCGAGAGTCAAAGTGGCTCCGCTC
Gt_151284	XM_005837266.1	GATCATATGGTCGAGCTTACAAGTAC	GACTAGCGGCCGCTGTTCTGTAGGAATC
Gt_152706	XM_005832311.1	GATCATATGGGTCCCATCTACTAC	GATCCTCGAGTACGAACGTGCTGCTCG
Gt_152884	XM_005831772.1	GATGCTAGCATGGCTCAGTTCGCTTCCC	GATCCTCGAGAACGTACTGCTGGGAGG
Gt_159333	XM_005838038.1	GATCATATGGCGGTCCAAGATG	GATCCTCGAGTACATACTCCTTCTCCAC
Gt_161302	XM_005839022.1	GATCATATGAGCGTCGTATACGGAG	GATCCTCGAGTCTGAGGTACTCAGGGGC
Gt_162755	XM_005833981.1	GATCATATGGTTTCTGCATTGGATC	GACTAGCGGCCGCAATCGAGCGACCCGCTC
Gt_163469	XM_005831796.1	GATCATATGTGGACTGGCATCGG	GATCCTCGAGGACGTATTGCTGAGAC
Gt_164142	XM_005829249.1	GATCATATGCGCGTGAATCGGCTATG	GATCCTCGAGATCCCTCTGCTCCAGCTC
Gt_164280	XM_005828899.1	GATCATATGACGACGTCTGCCCCTTC	GATCCTCGAGAACGGCCTCGGACTCCTGC
Gt_164579	XM_005827826.1	GATCATATGGCGACGTCTGCCCCTT	GATCCTCGAGCATTCTTTCATCATCTTGC

Reverse-transcription quantitative PCR (RT-qPCR)

The RNA was reverse-transcribed using ReverTra Ace® qPCR RT Master Mix with gDNA remover (TOYOBO, Japan). The expression levels of each microbial rhodopsin-like gene were determined using real-time PCR assay. Real-time PCR was performed on an Eco™ Real-Time PCR System (Illumina, USA) using 1 ng total RNA eq. of cDNA for each sample. THUNDERBIRD™ SYBR® qPCR Mix (TOYOBO, Japan) was used to detect products, and 10 μM primers were used. The relative amount of cDNA in each sample was normalized using Gt_95624 (encoding an actin gene), and the melting curve was used to verify specificity. PCR was initially set at 95°C for 60 s, followed by 42 cycles of 95°C for 15 s and 60°C for 60 s. The melting curve was set at 95°C for 15 s, 55°C for 15 s, and 95°C for 15 s. Each gene-specific primer was based on the mRNA sequences in the NCBI database (Table 3).

Table 3

Primer sequences for RT-qPCR.

ID	Gene	Forward primer (5’– 3’)	Reverse primer (5’– 3’)
Gt_085284	rhodopsin	AGCCATGACGGCTTGGATCG	TGCAACGCCTTGCTCAGATG
Gt_085745	rhodopsin	GGCGTCCTTCTCCTATTTTGCG	CAGCCAGCAGCCCAATGTTC
Gt_086360	rhodopsin	GAGCGAGACTGTGCCCCTTA	AGTGCCGAGTGAAATCTAAAGCA
Gt_091599	rhodopsin	GCTTCCATCGCATACTTCTCC	GCTCACTCCAGCAACAAGACC
Gt_092481	rhodopsin	TGGGAGGTTATCTGGGCACG	AAGTTGACGGCGAGAGCGTA
Gt_099631	rhodopsin	GGGTTTGCGGTCCTCTACC	GTCTTGCCTGCTTCCTCTGCTTG
Gt_106708	rhodopsin	GACTCAGCAGGCAAGGAACG	TTGGTCAGGTCGCAGATGG
Gt_111593	rhodopsin	GCCCAATGTCACTCAAGGTGG	TCGCTCATAATACACGCTCCTG
Gt_120390	rhodopsin	AACCTCAACGACCCACCAGC	AAACCATCTTCTTCGGTAAACTCCG
Gt_120936	rhodopsin	TCTCCCTTCAGCATCGTCATCC	AAGCCAGCCACCAAAAGAGC
Gt_122016	rhodopsin	CACTCAAGCAGGCGACACAAG	ATCAGCCAGAGGGCGAACAG
Gt_139416	rhodopsin	TGGCTCATCACAACTCCCCTC	GCCCCAGTAGCAATCATCAAGAC
Gt_145279	rhodopsin	ACAGTGAAGTGGTTCTGGTTCC	TCCTCCCTTGTTCTCGGCTG
Gt_146828	rhodopsin	GCAAGCCAAGTCGTTTATGGAG	CTGACAACAGCCCAGACCAG
Gt_148137	rhodopsin	CGTGTTCATAGTGTGCTTCTCTTC	GCTACGGCGGACAAATCATCG
Gt_150025	rhodopsin	ATGCCACCGACAACTCCAAG	CGCTCTCCTCAACTCCGAAAG
Gt_150790	rhodopsin	CGTCAGGAGAGCAGCGAAAA	GCAAAGTGCGAGTAGAAGAACTG
Gt_151068	rhodopsin	TGCTGGGTGCCGATTTCTTG	CGATGCGGTAGATGAAGGTTGA
Gt_151284	rhodopsin	CATCCTGCTGCTCACAACCC	AGAGGGACCACCCAACACAG
Gt_152884	rhodopsin	TCTCACACATCCACACATCGG	GGAATAGAGCGAGGCACACTTG
Gt_159333	rhodopsin	AAGTGGTTGTGGTTCTTTTTCGG	GTTGCTTGTCGGGGTTCTCC
Gt_162755	rhodopsin	TGGATTGGGTTCATTGCCTTATTTG	ACATCATCTTGGTCTGGTCCTTTG
Gt_163469	rhodopsin	CAGGAGGTTGGACTCATCACC	TGCTGGTTCTGGGCATCTGTG
Gt_164142	rhodopsin	CTTCCATCCCAACACAGACGG	CCAAACGGTGAGACCCCAAC
Gt_164579	rhodopsin	CTTCGCCCTGCTCAAGTTCCAG	CCTCGTCGTAGTTGTATCCCGC
Gt_105242	blh	TGTGTGTGGCATTCGTGTCG	CTCGGTCTGCTCCAGTCTCA
Gt_095624	actin	CAGAAAGGGGTGATGGTGGGA	TAGGATGGGATGCTCGTCGG

Phylogenetic analysis

The amino acid sequences used for phylogenetic analysis were those registered in the NCBI Reference Sequences (RefSeq) except for Gt120390 and Gt164280. The amino acid-coding sequences of Gt120390 and Gt164280 were re-analyzed and deposited to the public database (accession numbers are MF039475 and LC591948, respectively). The evolutionary history was inferred using the neighbor-Joining method [43]. The optimal tree with the sum of branch length = 33.09495591 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method [44] and are in the units of the number of amino acid substitutions per site. The analysis involved 85 amino acid sequences. All ambiguous positions were removed for each sequence pair. There were a total of 409 positions in the final dataset (S1 Dataset). Evolutionary analyses were conducted in MEGA6 [45].

Conservation of the key amino acids for Guillardia theta rhodopsins compared with representative microbial rhodopsins in Fig 1.

The name of representative rhodopsins indicated in the legend of Fig 1. The color of cells is described below. Negatively charged residues: red, positively charged residues: blue, aromatic residues: grey, polar residues: light green, non-polar residues: pale yellow, methionine and cysteine: orange, histidine: dark green, glutamine and asparagine: light blue, glycine: pink, proline: black.

(TIF)

Click here for additional data file.

Re-analyzed sequence encoding the amino acid of Gt_164280.

a. Sequence comparison with model transcripts. b. Predicted amino acid sequence derived from re-analyzed sequence compared with that of model transcripts. MF039475: the sequence which we determined, XM_005828899.1: the model transcript of Gt_164280. Asterisks indicate that the two sequences are identical at the corresponding sites.

(TIF)

Click here for additional data file.

Re-analyzed sequence encoding the amino acid of Gt_120390.

a. Sequence comparison with model transcripts and genomic sequence. b. Predicted amino acid sequence derived from re-analyzed sequence compared with that of model transcripts. LC591948: the sequence which we determined, XM_005820365.1: the model transcript of Gt_120390, NW_005464496.1: the genomic sequence of Gt_120390. Asterisks indicate that the all sequences are identical at the corresponding sites. Dots indicate that the two of three sequences are identical at the corresponding sites.

(TIF)

Click here for additional data file.

The full length of each rhodopsin-like gene was amplified using RT-PCR.

PCR products were detected by electrophoresis on 1% agarose gel. The lane number and ID of the expressed genes are shown in the right table. The letter and numbers are described below. M: DNA marker, 1: Gt_062605, 2: Gt_085284, 3: Gt_085745, 4: Gt_086360, 5: Gt_091599, 6: Gt_092481, 7: Gt_099631, 8: Gt_099837, 9: Gt_099928, 10: Gt_106708, 11: Gt_106800, 12: Gt_107802, 13: Gt_107989, 14: Gt_109252, 15: Gt_111593, 16: Gt_120390, 17: Gt_120936, 18: Gt_122016, 19: Gt_122924, 20: Gt_135937, 21: Gt_138253, 22: Gt_139416, 23: Gt_145279, 24: Gt_146828, 25: Gt_146834, 26: Gt_148137, 27: Gt_148915, 28: Gt_148916, 29: Gt_150025, 30: Gt_150790, 31: Gt_150796, 32: Gt_151068, 33: Gt_151284, 34: Gt_152706, 35: Gt_152884, 36: Gt_159333, 37: Gt_161302, 38: Gt_162755, 39: Gt_163469, 40: Gt_164142, 41: Gt_164280, 42: Gt_164579, 43: Gt_161042, 44: Gt_162503.

(TIF)

Click here for additional data file.

The amino acid sequences using phylogenetic analysis in Fig 1.

(FAS)

Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

16 Oct 2020

PONE-D-20-24671

Expression analysis of microbial rhodopsin-like genes in Guillardia theta

PLOS ONE

Dear Dr. Konno,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Two experts in the field kindly reviewed your manuscript and offered support for the work, with both stating that the paper demonstrated scientific merit. However, a number of major issues were raised that should be addressed before your manuscript will be considered further.

Also, as stated by Reviewer 2, the paper is "very poorly written and needs to be substantially revised to make it comprehensible". As such, I strongly recommend that the revised manuscript is seen/edited by a native English speaker and/or please make use of a professional editing service before resubmission.

Please ensure that your decision is justified on PLOS ONE’s publication criteria and not, for example, on novelty or perceived impact.

==============================

Please submit your revised manuscript by Oct 30 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Wayne Iwan Lee Davies, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a timely report on expression of rhodopsin genes in Guillardia theta under nitrogen depletion.

Only two remarks to the authors:

1. G. theta carries some very strange heliorhodopsin-like genes. Please clearly indicate in the manuscript that those were not looked after. Or if you did measure heliorhodopsin transcripts please report it.

2. In the tree in figure 1. please clearly mark G. theta rhodopsins for which known activity was previously reported.

Reviewer #2: The manuscript by Konno et al. entitled “Expression analysis of microbial rhodopsin-like genes in Guillardia theta” reports exactly what is stated in its title. G. theta ACRs have been widely used to control neurons with light, but little is known about their function in the alga itself, and even less is known about other rhodopsin genes in this organism. The Authors have determined expression levels of G. theta rhodopsin genes under normal and nitrogen-deficient conditions and found that nitrogen depletion promoted expression of some rhodopsin genes and inhibited expression of some other ones. This manuscript provides the evidence that G. theta rhodopsin genes are at least expressed and opens a possibility to study the encoded proteins. I believe this work can be published in PLOS One, but, unfortunately, the manuscript is very poorly written and needs to be substantially revised to make it comprehensible.

1) Major issues:

Line 182: “To investigate whether a change in pigment composition in culture occurred”

I don’t understand why the Authors measured chlorophyll a content. The fact that photosynthetic pigments are degraded in aging algal cultures is very well known (e.g. [PMID: 27057086]). All cryptophytes contain phicobilins in addition to chlorophyll; in G. theta it is phycoerythrin. As the Authors correctly note, the change of red-brown to green color that they observed in aging G. theta cultures was most likely owing to predominant degradation of phycoerythrin as compared to that of chlorophyll. To test this hypothesis, they would need to measure the contents of both, phycoerythrin and chlorophyll (as it has been done in Ref. [31] in Rhodomonas) rather than chlorophyll alone. But, as Guillardia and Rhodomonas are related organisms, it is very likely that the processes of pigment degradation in them are similar. So, the Authors could simply have hypothesized that the color change they observed under nitrogen-deficient conditions in Guillardia could be explained by preferential degradation of phycoerythrin compared with chlorophyll, as measured in Rhodomonas. In any case, measurements of chlorophyll alone do not seem to produce any relevant information.

Supplementary Figure 1:

The sequences of Gt150796, Gt107989 and Gt135937 show blanks in the residue positions in the right part of the table. Does it mean that translation of the corresponding transcripts terminated before that? In any case, as determination of the actual transcript sequences is important, the Authors should show an alignment of the entire rhodopsin domains of the encoded proteins in the supplement and deposit their RNA data to a publicly available database. Also, in the text the Authors should comment on comparison of their 29 actual transcripts with the model transcripts predicted by the G. theta genome portal. As the expression constructs used in the previous studies (Refs. [27] and [28]) were based on the latter, possible errors in intron prediction might have influenced some of the results reported therein.

2) Lesser issues:

Lines 49-50: “In 2002, two rhodopsins in green algae Chlamydomonas reinhardtii were found to act as light-gated ion channels [4].”

Ref. [4] reports channel properties of only one C. reinhardtii rhodopsin, ChR1. Also, please change "algae" to "the alga".

Line 55-56: “Moreover, a new group of rhodopsin named heliorhodopsin also found in nature [8].”

Nowadays “new groups of rhodopsins” are found in nature almost every month. I believe the Authors should briefly explain here what is so new about heliorhodopsins that merits mentioning them in the introduction.

Lines 57-58: “…microbial rhodopsins are widely distributed in not only bacteria but also cyanobacteria, algae, protozoa, and giant viruses [9].”

Ref. [9] reviews only prokaryotic rhodopsins, whereas algae and protozoa are eukaryotes. Moreover, to the best of my knowledge, there are no published reports of rhodopsins in protozoa. The attribution of a rhodopsin transcript to the marine ciliate Tiarina fusus [PMID: 31320556] was erroneous; in fact, this rhodopsin was derived from a cryptophyte alga used to feed Tiarina in culture.

Line 64: “photosensor for phototaxis in H. salinarum”

Phototaxis is the ability to track the direction of light, of which H. salinarum is not capable. Please change “phototaxis” to “photomotility”. Please also change the past tense to the present tense in the entire paragraph, i.e. “Sensory rhodopsins (SR) and channel rhodopsins act as …”, not “acted”.

Line 74: “flabobacteria Doktonia sp. MED134”

This genus name is spelled Dokdonia.

Line 76-77: “These results suggest that microbial rhodopsins are related to primary metabolisms”

This conclusion can only be drawn about rhodopsins in Dokdonia, not about the entire superfamily. Furthermore, this paragraph needs to be rewritten for clarity. Start with “Nitrogen is important nutrition as a source of metabolites including amino acids” and then describe the results in Dokdonia. Delete the sentence “Algae contribute suppressing an increase in CO2 concentration in the ocean by fixing CO2 by photosynthesis” as trivial and not relevant for this paragraph.

Lines 252-253: “which have been reported in the past as sensory rhodopsin related to the phototaxis”

Please change “reported” to “suggested”. The Authors apparently mean Ref. [26], in which it has been shown that the absorption maximum of heterologously expressed and purified GtR1 lies within the broad spectral region to which G. theta motility is sensitive. This result at best justifies only a suggestion that GtR1 might contribute to phototaxis, but by no means can be considered as a “report” of its function as the receptor for phototaxis! Such conclusion would require e.g. gene knockdown studies. Also, since 2005 both CCRs and ACRs have been discovered in G. theta, and these proteins are much more likely candidates for phototaxis receptors than GtR1.

3) Some of the style and grammar problems (but there are many more throughout the manuscript – please take care of them as well):

Lines 40-42: “Microbial rhodopsins are the light-receiving membrane proteins, which act as a light-driven ion pump, a light-driven ion channel, light-driven enzyme, and photosensor [1].”

Please consistently use either plural or singular in this sentence and throughout the entire paragraph.

Line 58: “On the other hand, there are about 600 genes”

The expression “on the other hand” is unsuitable here; please change to “in addition” and add “known” after “there are”.

Lines 59-60: “As physiological roles, they are related in energy production…”

This sentence follows immediately after the sentence about Rh-noK, so the reader assumes that it describes their functions! To avoid this confusion, please move the sentence about Rh-noK to the end of this paragraph.

Lines 66-67: “Proteorhodopsin (PR) contributed with phototrophy on some species of flavobacterium”

Please change to “Proteorhodopsin (PR) mediate phototrophy in some species…”.

Line 68: “…there were many kinds of research on the molecular properties of microbial rhodopsin …”

Please change to “…molecular properties of microbial rhodopsins are studied by many approaches…”

Line 86-87: “Cryptophytes are unicellular algae living in ubiquitously from marine to freshwater environments”

Change to “Cryptophytes are unicellular algae ubiquitously found in marine and freshwater habitats”.

Lines 88-89: “…a secondary plastid that had been laterally transferred from…”

The term “lateral transfer” refers to genes, not entire organelles. Please change to “acquired”.

Line 90-91: “The reason for the importance of the evolution of plastid…”

Please change to “Owing to the importance…”

Lines 92-93: “The nuclear genome of G. theta codes many genes similar to microbial rhodopsins in its nuclear genome”.

Please delete “in its nuclear genome” at the end of this sentence.

Lines 94-95: “many of them were revealed neither their molecular functions nor physiological functions”

Please change to “Molecular properties and physiological functions of many G. theta rhodopsins are currently not known”.

Line 109: Please change “phylogenic” to “phylogenetic” here and throughout the manuscript.

Line 131: “The name of representative rhodopsins indicated as follows”.

Please change to “Abbreviations:”or delete this sentence altogether.

Line 195: Change “predicting” to “predicted”.

Line 211: “While there were 15 genes decreased the expression level in N depletion”

Please change to “The expression level of 15 genes decreased upon N depletion”.

Line 254: Please substitute the word “ref” with the corresponding reference number.

Lines 278-283: Please move these sentences to Introduction.

Lines 284-285: Please delete the words “In a similar case”. There is nothing similar between the rest of the sentence and the preceding text. The similar case is that some GAF domains have no critical cysteine, as some rhodopsin-like proteins have no critical lysine; please change the text accordingly.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Elena G. Govorunova

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

2 Nov 2020

Response to editor's comment.

To improve the manuscript written in English, we made use of a professional editing service (Editage: www.editage.com) before resubmission.

All responses to the reviewers' comments are listed in the "Response to Reviewers" document.

I corrected the affiliation link to symbol #b.

Submitted filename: Konno_et_al_Response to reviewers.docx

Click here for additional data file.

17 Nov 2020

PONE-D-20-24671R1

Expression analysis of microbial rhodopsin-like genes in Guillardia theta

PLOS ONE

Dear Dr. Konno,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Your revised manuscript is much improved; however, there are a few minor changes suggested by Reviewer 2 that should be addressed before a final decision may be taken.

==============================

Please submit your revised manuscript by Jan 01 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Wayne Iwan Lee Davies, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The Authors have much improved the manuscript during revision. They have answered all my questions and also corrected most of stylistic problems. I recommend the revised version for publication in PLOS One, although I still have a few comments, as indicated below. I am sure the Authors will agree to make these suggested changes, so I do not think there is a need to send the manuscript to me again.

Lines 50-52: “In 2002, two rhodopsins in the green alga Chlamydomonas reinharditii were found to act as light-gated ion channels [4]”.

As I have already indicated in my review of the original version, Ref. [4] reports only ONE channelrhodopsin from C. reinhardtii. The second one from this organism was described in a different paper in 2003 (PMID: 14615590). The Authors state in their response letter that they have corrected this error, but in fact they have not. Please change the plural in this sentence to singular (“a rhodopsin” and “was found”), or keep the plural and add the above-mentioned paper to the reference list.

Lines 106-107: “In G. theta, some of the rhodopsin-like genes are related to the regulation of N-assimilation by energy production”.

If this is the conclusion that the Authors draw from their present study (as I understand it is), this sentence should be moved to the next paragraph, e.g. “In this study, we investigated the expression pattern of rhodopsin-like genes in G. theta under various growth conditions. We show that some of the rhodopsin-like genes are related to the regulation of N-assimilation by energy production in this organism.” If this is a conclusion from some earlier studies, a proper reference should be given.

Lines 222-223: “Guillardia theta has a predicting beta-carotene 15,223 15'-monooxygenase gene”

Please change “predicting” to “predicted”.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

17 Nov 2020

To editor

We completely agreed the reviewer’s comments, so we reply to the comments of reviewer #2 in the 'Response to Reviewers” file.

Submitted filename: Konno_et_al_Response to reviewer#2.docx

Click here for additional data file.

20 Nov 2020

Expression analysis of microbial rhodopsin-like genes in Guillardia theta

PONE-D-20-24671R2

Dear Dr. Konno,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Wayne Iwan Lee Davies, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

24 Nov 2020

PONE-D-20-24671R2

Expression analysis of microbial rhodopsin-like genes in Guillardia theta

Dear Dr. Konno:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Wayne Iwan Lee Davies

Academic Editor

PLOS ONE