Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

BACKGROUND: The specific roles of parasite characteristics and immunological factors of the host in Chagas disease progression and prognosis are still under debate. Trypanosoma cruzi genotype may be an important determinant of the clinical chronic Chagas disease form and prognosis. This study aimed to identify the potential association between T. cruzi genotypes and the clinical presentations of chronic Chagas disease. METHODOLOGY/PRINCIPAL
FINDINGS: This is a retrospective study using T. cruzi isolated from blood culture samples of 43 patients with chronic Chagas disease. From 43 patients, 42 were born in Brazil, mainly in Southeast and Northeast Brazilian regions, and one patient was born in Bolivia. Their mean age at the time of blood collection was 52.4±13.2 years. The clinical presentation was as follows 51.1% cardiac form, 25.6% indeterminate form, and 23.3% cardiodigestive form. Discrete typing unit (DTU) was determined by multilocus conventional PCR. TcII (n = 40) and TcVI (n = 2) were the DTUs identified. DTU was unidentifiable in one patient. The average follow-up time after blood culture was 5.7±4.4 years. A total of 14 patients (32.5%) died and one patient underwent heart transplantation. The cause of death was sudden cardiac arrest in six patients, heart failure in five patients, not related to Chagas disease in one patient, and ignored in two patients. A total of 8 patients (18.6%) progressed, all of them within the cardiac or cardiodigestive forms.
CONCLUSIONS/SIGNIFICANCE: TcII was the main T. cruzi DTU identified in chronic Chagas disease Brazilian patients (92.9%) with either cardiac, indeterminate or cardiodigestive forms, born at Southeast and Northeast regions. Other DTU found in much less frequency was TcVI (4.8%). TcII was also associated to patients that evolved with heart failure or sudden cardiac arrest, the two most common and ominous consequences of the cardiac form of Chagas disease.

Introduction

Chagas disease (CD) is one of the tropical neglected diseases recognized by the World Health Organization (WHO) and has a great public health and socioeconomic burden in endemic countries [1]. Around 6 to 7 million people are chronically infected by the protozoan Trypanosoma cruzi worldwide [2], from whom 5.7 million live in Latin America, mainly in Argentina, Bolivia, Brazil, Colombia, and Mexico [2, 3]. Sixty to seventy percent of the chronically infected patients do not present any clinical evidence of organ damage due to Chagas disease and present the clinical indeterminate form of the disease, but 30 to 40% present the cardiac, digestive or cardiodigestive forms of the disease [4]. The reasons pointed out for this pleiotropic presentation are various and include factors from both the host and the parasite.

Nowadays, the high genetic variability of the T. cruzi allows its classification into seven different lineages, as follows: six DTUs (Discrete Typing Units), from TcI to TcVI, and a seventh genotype, TcBat [5-7]. Initially identified in several bat species, TcBat was found in a child in Colombia [8]. Any T. cruzi lineage can infect humans, however TcI, TcII, TcV, and TcVI are the DTUs mostly associated to human infections in domicile cycles transmission in endemic areas [9, 10]. In Brazil, TcII and TcVI are the T. cruzi DTUs most frequently identified in human infections [11-14].

Regarding the association between T. cruzi genotypes and clinical presentations of chronic Chagas disease, TcI, TcII, TcIV, TcV, and TcVI were identified in patients with chronic cardiac form born in Argentina, Brazil, Bolivia, Colombia, and Venezuela [11, 15–23], while TcII, TcV, and TcVI were also identified in patients with the digestive form, particularly in Brazil, Argentina, and Bolivia [16, 22–24]. TcIV seems to have a secondary importance in patients with Chagas cardiomyopathy in Colombia and Venezuela [19-21]. On the other hand, some studies were unable to show conclusive evidence of the association between a specific DTU and Chagas heart disease [11, 17], and TcIII is usually found in sylvatic cycles and was identified in patients with the chronic indeterminate form in Brazil [25].

In this paper, we describe the T. cruzi DTU genotypes of blood culture isolates obtained from 43 patients followed at our outpatient clinic in order to correlate the DTU with the clinical presentation and the place of birth.

Methods

Patients and study design

This is a retrospective study that used a convenience sample formed by all positive T. cruzi blood culture from adult patients from both sexes regularly followed at the outpatient center of the Evandro Chagas National Institute of Infectious Diseases (INI) between July 2008 and June 2010. All patients had Chagas disease previously diagnosed by two simultaneously positive serological tests (indirect immunofluorescence and ELISA) (S1 Table). All participants who were still followed at our institution were approached during their regular medical appointments and provided written informed consent allowing the use of their blood culture samples and granting access to their medical records. The institutional ethics committee waived the requirement for informed consent for deceased participants and those who were lost to follow-up and could not be reached. Clinical, epidemiological and mortality data were obtained from medical records. Mortality data were also retrieved from registries of death certificates available at the department of justice of the Rio de Janeiro state (http://www4.tjrj.jus.br/SEIDEWEB/default.aspx). Final follow-up date was arbitrarily defined as of June 2019. Chagas disease clinical form was classified according to the II Brazilian Consensus on Chagas disease from 2015 [3] using electrocardiographic, 2D Doppler echocardiographic, upper and lower gastrointestinal endoscopic, and contrast radiographic exams available in medical records.

Ethical approval

This study was approved by the Evandro Chagas National Institute of Infectious Diseases Ethical Committee under number 62973116.6.0000.5262. All procedures followed regulatory guidelines and standards for research involving human beings as stated in the Brazilian National Health Council Resolution 466/2012 and were conducted according to the principles expressed in the Declaration of Helsinki in order to safeguard the rights and welfare of the participants.

Blood culture

Blood culture was performed in biphasic culture medium Novy-MacNeal-Nicolle medium plus Schneider's Drosophila Medium (Sigma-Aldrich, St. Louis, Missouri, USA) supplemented with 10% inactivated fetal bovine serum and antibiotics 200 IU penicillin and 200 μg/mL streptomycin, as previously described [26]. The culture tubes were incubated at 26–28°C in a biochemical oxygen demand (BOD) incubator and examined every 15 days for up to 60 days. The parasites isolated in culture were cryopreserved in liquid nitrogen (N2L). Growth of parasites was performed in sterile bottles for cell culture in the same biphasic culture medium. The total culture volume obtained was centrifuged at 7000 rpm for 10 minutes and the pellet was submitted to three washes in NaCl-EDTA buffer to obtain the parasite mass, which was stored in a freezer at –20°C until DNA extraction to carry out molecular techniques.

DNA extraction

DNA extraction from the pellet of parasite isolates was done using silica columns using the High Pure PCR Template Preparation (Roche, Germany) kit following previously published protocol [27]. At the last stage of the protocol, DNA was eluted in 100 μL of elution buffer and stored at -20°C until use.

Molecular typing

T. cruzi genotyping into DTUs from I to VI was performed as reported [28], following a combination of methodologies previously described based on multilocus conventional PCR [11, 19, 29]. As a panel of positive controls, we used T. cruzi epimastigotes from subpopulations classified as DTUs TcI to TcVI (clones/strains: Dm28c (TcI), Y (TcII), INPA 3663 (TcIII), INPA 4167 (TcIV), LL014 (TcV), and CL (TcVI)), obtained from the Protozoan Collection of the Oswaldo Cruz Foundation (Colprot), were used as reference. The PCRs targeted the intergenic region of Spliced Leader (SL-IRac) [UTCC and TCac primers], to distinguish between TcI (150 bp), TcII, V or VI (157 bp) and TcIII or TcIV (200 bp), (SL-IR I and II) [TCC, TC1 and TC2 primers] [30, 31], to distinguish between TcI (350 bp), TcII, TcV and TcVI (300 bp) and TcIII and TcIV (not amplified)], the D7 domain of the 24Sα ribosomal RNA gene [Heminested PCR: D75 and D76 (first round) and D76 and D71 (second round), to distinguish between TcII and TcVI (140 bp), TcIII (125 bp), TcIV (140/145 bp) and TcV (125 or 125+140 bp)], and the A10 nuclear fragment [Heminested PCR: Pr1 and P6 (first round) and Pr1 and Pr3 (second round), to differentiate TcII (690/580 bp) from TcVI (630/525 bp)] [32, 33] (Table 1 and Fig 1).

Table 1

Primers for Trypanosoma cruzi molecular typing.

Target	Primers	Sequence [5’– 3’]
SL–IRac	UTCC	CGTACCAATATAGTACAGAAACTG
	TCac	CTCCCCAGTGTGGCCTGGG
SL–IR I and II	TCC		CCCCCCTCCCAGGCCACACTG
	TC1		GTGTCCGCCACCTCCTTCGGGCC
	TC2		CCTGCAGGCACACGTGTGTGTG
24Sα–rDNA	D75		GCAGATCTTGGTTGGCGTAG
First round	D76		GGTTCTCTGTTGCCCCTTTT
24Sα–rDNA	D71		AAGGTGCGTCGACAGTGTGG
Second round	D76		GGTTCTCTGTTGCCCCTTTT
A10	Pr1	CCGCTAAGCAGTTCTGTCCATA
First round	P6	GTGATCGCAGGAAACGTGA
A10	Pr1	CCGCTAAGCAGTTCTGTCCATA
Second round	Pr3M	CGTGGCATGGGGTAATAAAGCA

Fig 1

Characterization targets flowchart for T. cruzi multilocus conventional PCR and expected sizes of amplified products, based in four molecular markers [28].

The amplification reactions were performed in a Veriti Thermal Cycler (Applied Biosystems), as follows: 5 μL of extracted DNA were added to a 12,5 μL GoTaq Green Master Mix 2X (Promega, Madison, USA) containing GoTaq DNA polymerase, buffer (pH 8.5), 400 μM of each dNTP and 3 mM MgCl2, 1.25 μL of each primer (stock solutions: 25 μM for the SL-IR target, 10 μM for the 24Sα and A10 targets), and 5 μL of ultrapure water. PCR products (25 μL) were separated by agarose gel electrophoresis (3.0% w/v, 90V, 1 hour), stained with Gel Red (Biotum) 0.1 X and visualized at UV light.

Map construction

Georeferencing of each patient was performed from the centroid of the municipality, using the online cartographic platform Google Earth, with the geodetic reference system WGS 84 (World Geodetic System 1984) (S1 Table). For the map construction of the distribution of the T. cruzi genotypes, points of the samples localization were visualized in a Geographic Information System (GIS) in the Quantum GIS software version 3.4 (Madeira), using the continental, national, and State boundaries, extracted from the open access (public domain) cartographic base of Brazilian Institute of Geography and Statistics (IBGE) accessed at https://www.ibge.gov.br/geociencias/downloads-geociencias.html.

Statistical analyses

All statistical analyses were performed using MedCalc 12.5.0.0. software. Continuous variables were expressed as mean ± standard deviation (sd) and categorical variables as absolute and percentage values.

Results

Patients characteristics

A total of 43 patients presented blood culture positive for T. cruzi between July 2008 and June 2010. Most of these patients were born in rural areas of the Southeast and Northeast Brazilian regions. The number of cases from Southeastern states were as follows, Minas Gerais (n = 6), Rio de Janeiro (n = 1), and São Paulo (n = 1) and the number of cases from Northeastern states were as follows, Bahia (n = 14), Pernambuco (n = 11), Paraíba (n = 5), Sergipe (n = 2), and Alagoas (n = 1). Only one patient was born in state of Mato Grosso do Sul, in Midwest Brazilian region. No patient was born in the North or South Brazilian regions. One patient was not natural from Brazil but was from the city of Santa Cruz de La Sierra, located at the Prurinacional state of Bolivia. Most patients were women (72.1%) and were infected by vector borne transmission (90.7%) (Table 2).

Table 2

Epidemiological characteristics of studied patients.

Variables	N = 43	Percentage
Sex
Female	31	72.1
Male	12	27.9
Age (years)	24–79 years (52.4±13.2)
Region of Origin
Northeast	33	76.7
Southeast	8	18.6
Midwest	1	2.3
North	-
South	-
Bolivia	1	2.3
Transmission Mode
Vector borne	39	90.7
Congenital	1	2.3
Blood transfusion	1	2.3
Unknown	2	4.6
Chagas disease clinical forms
Cardiac	22	51.1
Indeterminate	11	25.6
Cardiodigestive	10	23.3

Most patients presented the chronic cardiac form (51.1%), followed by the indeterminate form (25.6%), and the cardiodigestive (23.2%) form at the time of the blood collection for T. cruzi culture (Table 2). Except for one patient with megacolon, all patients with the cardiodigestive form presented associated megaesophagus. No patient presented isolated digestive form. Among patients with the cardiac form, six presented the stage A, seven presented the stage B1, five presented the stage C, and four presented the stage D of the cardiac form. Among patients with the cardiodigestive form, five presented the stage A, two presented the stage B1, and three presented the stage C of the cardiac form.

T. cruzi molecular typing

The DTUs identified in the blood culture isolates included only two subtypes: TcII in samples from 40 patients (93%) and TcVI in samples from 2 patients (4.6%). The molecular characterization was not possible to be done in the isolates obtained from one patient. The panel of the molecular targets identified in the T. cruzi isolates is described in Table 3.

Table 3

Panel of the molecular targets and DTUs identified in the T. cruzi isolates from blood cultures.

Samples		Target Genes				DTUs
Code	Number	SL-IRac	SL-IR I and II	24Sα-rDNA	A10
EMT1	1175	157bp	300bp	140bp	580bp	TcII
EMT2 a	1176	Neg	Neg	Neg	Neg
EMT2 b	1177	157bp	300bp	140bp	580bp	TcII
EMT2 c	1186	157bp	Neg	Neg	Neg
EMT3	1190	157bp	300bp	140bp	580bp	TcII
EMT4 a	1178	157bp	300bp	Neg	Neg
EMT4 b	1183	Neg	300bp	140bp	525bp	TcVI
EMT4 c	1192	157bp	Neg	Neg	Neg
EMT5 a	1194	157bp	Neg	Neg	580bp	TcII
EMT5 b	1185	Neg	300bp	140bp	Neg
EMT6 a	1191	157bp	Neg	Neg	Neg
EMT6 b	1243	157bp	300bp	140bp	580bp	TcII
EMT7 a	1196	157bp	300bp	140bp	Neg
EMT7 b	1197	157bp	Neg	Neg	Neg
EMT7 c	1220	157bp	300bp	140bp	580bp	TcII
EMT8	1253	157bp	300bp	140bp	580bp	TcII
EMT9	1273	157bp	300bp	140bp	580bp	TcII
EMT10	1297	157bp	300bp	140bp	580bp	TcII
EMT11	1198	157bp	300bp	140bp	580bp	TcII
EMT12	1752	157bp	300bp	140bp	580bp	TcII
EMT13	1290	157bp	300bp	140bp	580bp	TcII
EMT14	1267	157bp	300bp	140bp	580bp	TcII
EMT15	1282	157bp	300bp	140bp	580bp	TcII
EMT16	1281	157bp	300bp	140bp	580bp	TcII
EMT17	1274	157bp	300bp	140bp	580bp	TcII
EMT18	1221	157bp	300bp	140bp	580bp	TcII
EMT19	1283	157bp	300bp	140bp	580bp	TcII
EMT20	1302	157bp	300bp	140bp	580bp	TcII
EMT21	1319	157bp	300bp	140bp	580bp	TcII
EMT22	1263	157bp	300bp	140bp	580bp	TcII
EMT23 a	1275A	Neg	300bp	Neg	Neg
EMT23 b	1275B	157bp	300bp	140bp	580bp	TcII
EMT24	1199	157bp	300bp	140bp	580bp	TcII
EMT25	1395	157bp	300bp	140bp	580bp	TcII
EMT26 a	1316	157bp	300bp	140bp	580bp	TcII
EMT26 b	1342	157bp	300bp	Neg	Neg
EMT27	1340	157bp	300bp	140bp	580bp	TcII
EMT28 a	1361	157bp	300bp	Neg	Neg
EMT28 b	1362	157bp	300bp	140bp	580bp	TcII
EMT29 a	1395	Neg	300bp	Neg	525bp	TcVI
EMT29 b	1339	157bp	300bp	140bp	Neg
EMT30	1363	157bp	300bp	140bp	580bp	TcII
EMT31 a	1364	157bp	300bp	Neg	580bp	TcII
EMT31 b	1365	157bp	300bp	Neg	Neg
EMT32 a	1396	157bp	300bp	140bp	580bp	TcII
EMT32 b	1397	157bp	Neg	Neg	Neg
EMT33	1412	157bp	300bp	140bp	580bp	TcII
EMT34	1411	157bp	300bp	140bp	580bp	TcII
EMT35	1751	157bp	300bp	140bp	580bp	TcII
EMT36	1749	Neg	Neg	Neg	Neg	ND
EMT37	1754	157bp	300bp	140bp	580bp	TcII
EMT38	1756	157bp	300bp	140bp	580bp	TcII
EMT39	1750	157bp	300bp	140bp	580bp	TcII
EMT40	1759	157bp	300bp	140bp	580bp	TcII
EMT41	1755	157bp	300bp	140bp	580bp	TcII
EMT42	1752	157bp	300bp	140bp	580bp	TcII
EMT43	1265	157bp	300bp	140bp	580bp	TcII

bp, base pairs; Neg, negative; ND, not detected.

Since DNA was extracted from the pellet of parasites from blood cultures, PCR products for all molecular targets were obtained in almost all samples. Representative images of agarose gels with amplifications for SL-IRac, SL-RI I and II, 24Sα r-DNA and A10 are shown in Fig 2. Regarding the two patients whose samples TcVI was identified, one was born in the city of Barreiras, located at the Western region of the state of Bahia, and the other was born in the city of Guimarânia, located at the state of Minas Gerais. TcII was identified in samples of patients born in Southeast and Northeast Brazilian regions and in the sample of the single case of the Midwest Brazilian region and from Bolivia (Fig 3 and Table 4).

Fig 2

Representative agarose gels showing T. cruzi target genes amplified by multilocus conventional PCR.

A) SL-IRac target (150/157bp/200bp). Lanes: 1- TcI (Dm28c), 2- TcII (Y), 3- TcIV (INPA4167), 4–15 –Patient samples; B) SL-IR I and II target (300/350bp). Lanes: 1- TcI (Dm28c), 2- TcII (Y), 3–15 –Patient samples, 16- TcI (Dm28c), 17- TcII (Y);, C) 24Sα rDNA target (125/140bp). Lanes: 1- TcII (Y), 2- TcIII (INPA3663), 3–15 –Patient samples; D) A10 target (525/580bp). Lanes: 1- TcII (Y), 2- TcVI (CL), 3–13 –Patient samples. MW, molecular weight; NC, negative control; bp, base pairs.

Fig 3

Spatial distribution of T. cruzi DTUs from INI cohort Chagas disease patients according to their place of birth, except for the case of congenital transmission that was located according to his mother place of birth (Cachoeira do Sul, RS).

This map was created using QGIS version 3.4 software and cartographic bases maps modified from open access by the Brazilian Institute of Geography and Statistics, IBGE (https://www.ibge.gov.br/geociencias/downloads-geociencias.html). ND, not detected.

Table 4

Clinical, epidemiological, follow-up, outcome, and DTU classification of studied patients.

Case	Geographic Origin (City/State)	Age	Clinical Form (stage)	Follow-up Time (years)	Progression	Death	DTU
1	Barreiras/BA	26	Cardiac (B1)	11.5	No	No	TcVI
2	Cachoeira/BA	79	Cardiodigestive (stage C+ME II)	1.73	Yes (stage D)	Yes	TcII
3	Cachoeira/BA	77	Cardiac (A)	0.29	No	No	TcII
4	Cachoeira/BA	64	Cardiodigestive (stage A+ME I)	10.41	Yes (stage C)	No	TcII
5	Campo Formoso/BA	35	Cardiodigestive (stage A+ME I)	3.6	No	No	TcII
6	Campo Formoso/BA	49	Cardiac (B1)	9.44	No	No	TcII
7	Conde/BA	64	Cardiodigestive (stage A+MC)	11.3	No	No	TcII
8	Feira de Santana/BA	58	Cardiodigestive (stage A+ME II)	7.92	Yes (stage C)	Yes	TcII
9	Miguel Calmon/BA	61	Cardiac (D)	7.73	No	Yes	TcII
10	Mundo Novo/BA	56	Cardiodigestive (stage A+ME I)	0.61	No	No	TcII
11	São Félix/BA	63	Cardiodigestive (stage B1+ME II)	10.76	No	No	TcII
12	São Francisco do Conde/BA	56	Cardiac (A)	11.33	No	No	TcII
13	Serra Dourada/BA	31	Indeterminate	9.48	No	No	ND
14	Wanderley/BA	36	Indeterminate	0.1	No	No	TcII
15	Afogados da Ingazeira/PE	39	Indeterminate	9.56	No	No	TcII
16	Aliança/PE	71	Cardiodigestive (stage B1+MEIV)	10.96	No	No	TcII
17	Araçoiaba/PE	50	Cardiac (A)	11.25	Yes (stage B2)	No	TcII
18	Itambé/PE	60	Cardiac (B1)	4.88	No	Yes	TcII
19	Machados/PE	63	Cardiac (A)	0.57	No	No	TcII
20	Recife/PE	42	Indeterminate	0.85	No	No	TcII
21	São José do Egito/PE	54	Cardiodigestive (stage C+ME I)	10.09	No	No	TcII
22	Sertânia/PE	45	Indeterminate	9.46	No	No	TcII
23	Sertânia/PE	40	Indeterminate	9.12	No	No	TcII
24	Timbaúba/PE	59	Cardiac (B1)	4.13	Yes (stage C)	Yes	TcII
25	Timbaúba/PE	61	Cardiac (B1)	9.03	Yes (stage B2)	No	TcII
26	Araçuaí/MG	56	Cardiac (B1)	7.34	Yes (stage B2)	Yes	TcII
27	Engenheiro Navarro/MG	79	Cardiodigestive (stage C+MEIII)	0.44	No	Yes	TcII
28	Guimarânia/MG	64	Cardiac (A)	5.17	No	No	TcVI
29	Novo Cruzeiro/MG	55	Cardiac (C)	2.15	No	Yes	TcII
30	Novo Cruzeiro/MG	51	Cardiac (C)	9.58	No	No	TcII
31	Teófilo Otoni/MG	52	Cardiac (C)	9.41	Yes (stage D)	Yes	TcII
32	Desterro/PB	37	Cardiac (C)	6.82	No	Yes	TcII
33	Itabaiana/PB	62	Cardiac (A)	0.22	No	No	TcII
34	João Pessoa/PB	52	Cardiac (C)	2.92	No	Yes	TcII
35	Pedras de Fogo/PB	53	Cardiac (D)	2.36	No	Yes	TcII
36	Taperoá/PB	42	Cardiac (D)	1.27	No	Heart Transplant	TcII
37	Laranjeiras/SE	47	Cardiac (D)	0.13	No	Yes	TcII
38	Pinhão/SE	62	Cardiac (B1)	1.21	No	Yes	TcII
39	Pilar/AL	36	Indeterminate	11.45	No	No	TcII
40	Nova Iguaçu/RJ	52	Indeterminate	10.88	No	No	TcII
41	Macedônia/SP	45	Indeterminate	0.24	No	No	TcII
42	Corumbá/MS	24	Indeterminate	0.88	No	No	TcII
43	Santa Cruz de La Sierra/Bolivia	46	Indeterminate	0.08	No	No	TcII

Cardiac form stages: A, B1, B2, C, D; MC: megacolon; ME: megaesophagus; ME stages: I, II, III, IV.

Clinical characteristics and follow-up according to T. cruzi DTUs

The mean follow-up time was 5.7 ± 4.4 years. A total of 14 patients (32.5%) died and one patient underwent heart transplantation. The cause of death was sudden cardiac arrest in six patients, heart failure in five patients, not related to Chagas disease in one patient, and ignored in two patients. A total of 8 patients (18.6%) with the cardiac or cardiodigestive forms progressed during the study follow-up: one from stage A to B2, two from stage A to C, two from stage B1 to B2, one from stage B1 to C, and two from stage C to D (Table 4).

The two patients with TcVI presented the cardiac form at the time of the blood culture was collected, one was at the stage A and another at the stage B1. The patient whose DTU was not determined presented the indeterminate form and did not present any event during the follow-up. All events (deaths, heart transplant, or Chagas disease clinical progression) occurred in patients with TcII. However, the low number of patients with TcVI precluded a comparison between outcomes of patients with TcII and TcVI.

A total of eight patients (18.6%) were treated with benznidazol during the study follow-up: one had the indeterminate form and seven had the cardiac form at the time they were treated.

Discussion

The physiopathology of Chagas disease is still a mystery to be solved and the description of the different T. cruzi genotypes added a fundamental brick in the road towards the understanding of this disease. Therefore, the elucidation of which T. cruzi DTUs are associated to the different chronic Chagas disease presentations and their outcomes is necessary. In this article, we determined the DTU of parasites isolated by blood culture in 42 patients by means of multilocus conventional PCR. We found TcII to be the most common DTU among patients followed at our institution and that this DTU was associated both to patients with the indeterminate and cardiac forms and to patients that evolved with heart failure or sudden cardiac arrest, the two most common and ominous consequences of the cardiac form of Chagas disease.

The epidemiological characteristics of the studied sample of the present article were representative of the group of patients followed at the outpatient clinic of our institution, as a recent paper of our group that included 619 Chagas disease patients found similar clinical and epidemiological characteristics, including an elevated mean age and women predominance [34]. The urban cohorts are usually composed by patients that migrated from rural areas of the states of Bahia, Pernambuco, Paraíba, and Minas Gerais [34, 35]. Regarding to clinical forms, there was a predominance of the cardiac form, associated or not to digestive complications (cardiodigestive form), similar to the findings of other studies [34, 36]. The predominance of patients with cardiac form in this study can be attributed to two facts: the Chagas disease referral role of our institution and the higher adherence to treatment and follow-up among symptomatic patients than among patients with the indeterminate form. Other group of patients that compose our cohort are those referred by blood banks, who are usually younger and asymptomatic [37]. The most common mode of transmission was vector borne, which reflects the pattern of migration from rural area that compose our cohort.

The predominance of the TcII DTU is in accordance to other studies that enrolled patients from rural endemic areas from the Northeast and Southeast Brazilian regions where domiciliary vector borne is the main mode of transmission [11, 13, 14, 23]. In fact, TcII is the most found DTU in genotyping studies performed in Brazil and is associated to severe chronic cardiac forms and chronic digestive forms [7, 14, 23]. The TcII and TcVI were found in patients with the chronic cardiac form of Chagas disease in Brazil and in other South American countries, such as Argentina, Bolivia, and Chile [11, 14, 15, 22, 23, 38, 39]. However, most T. cruzi genotyping studies focused on the association between specific DTU genotypes and the cardiac form of the disease and there are few studies that addressed such associations with the digestive form of the disease. In our study, one quarter of the patients presented the cardiodigestive form, which points to the association of TcII and digestive complications of Chagas disease. The prevalence of the cardiodigestive form in our studied sample is higher than expected [3]. On the other hand, in Argentina, TcV and TcVI were significantly associated with the digestive form of Chagas disease [24].

Our study showed that infections by TcII in Brazil can be associated to several types of chronic Chagas disease clinical presentations, including indeterminate, cardiac and cardiodigestive forms. Other study not only confirmed the association of TcII with different chronic Chagas disease forms, but also indicated that genetic variability within TcII is not associated with a specific clinical manifestation [23]. Our study also showed that important Chagas disease complications, such as heart failure and sudden cardiac arrest, and a high mortality occur in patients infected by TcII. All progressions that we observed occurred within the cardiac form, from an initial stage to a more advanced one. No patient with the indeterminate form progressed to the cardiac form during the study period. However, Chagas disease progression rate from indeterminate to the cardiac form of our cohort is low, 1.48 cases/100 patient years [35], and probably the low number of patients with the indeterminate form and their relatively short period of follow-up in the present study is not appropriated to address Chagas disease progression.

On the other hand, both patients of the present study infected by TcVI T. cruzi genotype presented the cardiac form and none of them progressed or died. However, the number of TcVI patients is too low for any conclusion to be drawn. Other studies that enrolled patients of our institution also identified TcVI genetic material in the blood drawn from patients born in the Southeast and Northeast Brazilian regions [11, 40]. TcVI was found to be associated to both cardiac and indeterminate forms of chronic Chagas disease in Brazil [11, 40, 41]. It is highly likely that immunologic factors of the host together with parasite genetic variations contribute to the diversity of Chagas disease clinical presentation [6]. Patients with the cardiac form present an inflammatory profile that may be related to disease progression [42]. For instance, serum TNF levels are reported to be higher among patients with the chronic cardiac form than in patients with the indeterminate form [43, 44].

Although a few reports have shown that the parasite population infecting specific organs can be genetically distinct from the population found in the patients’ blood [29, 45, 46], it is unlikely that this occurs in the cohort of patients here analyzed due to the high prevalence of TcII found by us, which is in accordance to other studies that enrolled Brazilian patients [11, 13, 14, 23].

The analysis of the DTUs spatial distribution revealed that TcII is largely distributed in endemic Brazilian areas from Northeast, and Southeast regions, with a higher concentration in the East region of the states of Bahia, Paraíba, Pernambuco, Alagoas, and Sergipe. Patients infected with TcII were also born in semiarid areas of Northeastern states, mainly Bahia, Pernambuco, and Paraíba. In the Southeast region, patients infected with TcII were born mainly in the mid-north area of Minas Gerais state, but were also located in the West of the state of São Paulo. This TcII spatial distribution is in accordance with previous findings of other studies [11, 13, 14, 40]. There was only one case of TcII in the Mid-West region which limits our discussion. The case from Bolivia was identified as TcII and, although this is not the most frequently DTU identified in that country, other studies confirmed the presence of TcII in Bolivia [17, 22]. One case of congenital transmission was located in the South region, municipality of Cachoeira do Sul, as that was the place of birth of the mother of this case.

The two TcVI cases were original to central Brazilian areas, West of the states of Bahia and Minas Gerais. T. cruzi TcVI had already been identified in the same TcII spatial distribution, either as an isolated infection or as a mixed infection (TcII/TcVI) [11, 13, 40, 41].

Study limitations

Although TcII is also associated to patients with chronic digestive form [10, 22, 23, 40], in our sample we did not identify any patient with the digestive form among those with TcII. This is possibly due to the low prevalence of patients with the digestive form in our cohort, around 5% [34], and the small sample of the present study. Therefore, we could not evaluate association between DTU genotypes and chronic digestive form.

Only TcII and TcVI were detected among the studied patients. The DTU identification was not possible in one of the studied patients as none of the PCR targets could be amplified in any of the two samples of this case. We believe that this occurred due to parasite degradation during the storage period or the presence of PCR inhibitors or DNA loss in this sample. Also, patients’ samples were not genotyped at more than one time point during their follow-up and we could not analyze if there were changes in parasite DTU genotypes over time.

The absence of mixed infections in the present paper may be due to the blood culture method that could select a specific T. cruzi subpopulation more adapted to the selected medium, as previously observed [14, 24, 38]. New approaches based on deep sequencing could have overcome this limitation as this technique was able to identify in a group of 17 patients from Mexico, 8 patients (47%) harboring infections with multiple DTUs [47]. However, the multilocus PCR used by us is also able to identify mixed infections directly from patient’s blood and is recommended by experts’ consensus statement to be used in clinical samples [9].

Conclusions

The TcII was the main T. cruzi DTU genotype isolated from blood culture samples obtained from chronic Chagas disease Brazilian patients with either cardiac, indeterminate or cardiodigestive forms born at Southeast and Northeast regions. Other DTU genotype found in much less frequency was TcVI. T. cruzi TcII was also associated to patients that evolved with heart failure or sudden cardiac arrest, the two most common and ominous consequences of the cardiac form of Chagas disease.

Patients list with positive blood cultures samples, age, gender, transmission mode, serological results, DTUs, geographical origin and coordinates.

(DOCX)

Click here for additional data file.

(PDF)

Click here for additional data file.

6 Oct 2020

PONE-D-20-26324

Association between Trypanosoma cruzi genotypes and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

PLOS ONE

Dear Dr. Roberto M Saraiva:

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by 12/5/2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Claudia Patricia Herrera, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as: a) the recruitment date range (month and year),  b) a description of how participants were recruited, and c) descriptions of where participants were recruited and where the research took place. Please also describe the methods used to collect patient samples.

3. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

4. Thank you for including your ethics statement:

"This study was approved by the Institutional Review Bord under number 62973116.6.0000.5262. All procedures followed regulatory guidelines and standards for research involving human beings as stated in the Brazilian National Health Council Resolution 466/2012 and were conducted according to the principles expressed in the Declaration of Helsinki in order to safeguard the rights and welfare of the participants. ".

i) Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

ii) Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

5. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

7. We note that Figure 3 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

7.1.    You may seek permission from the original copyright holder of Figure 3 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

7.2.    If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

8. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is an interesting study that sought to evaluate a possible association between the infective T. cruzi genotype and the clinical manifestation of Chagas disease in Brazilian patients. Although the results confirm data from other authors that TcII is prevalent in patients from various regions of Brazil and that DTU TcII promotes the indeterminate, cardiac and cardiodigestive forms in the chronic phase, the study deserves to be published not only because it expands knowledge on the subject, but also because it is a well-conducted study that also analyzes the progression of the disease in some patients.

To supplement the MS, this reviewer raises some relevant points that must be taken into account before the final acceptance. These points are listed below:

- Title: Association between Trypanosoma cruzi genotypes and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

The title is very assertive. The reader is induced to think that the authors found this association, when, in fact, TcII is responsible for cardiac, indeterminate and cardiodigestive forms. Therefore, the following title is suggested:

Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentations and outcome in an urban cohort in Brazil.

Background

Line 32: Substitution: This study aimed to identify the potential association between T. cruzi genotypes and the clinical presentations of chronic Chagas disease.

Methodology/Principal Findings

Suggestion: Start by describing the characteristics of the patients. Then, describe the DTU typing method and the data obtained.

Conclusions/Significance

Provide percentages:

Line 49 - TcII was the main T. cruzi DTU identified in chronic Chagas disease Brazilian patients (45.2%)….

Line 51 - Other DTU found in much less frequency (4.7%) was TcVI.

Introduction

Line 82 -…… Latin America, mainly in Argentina, Brazil, Mexico, Bolivia and Colombia [2,3].

Why are countries mentioned in this order? Is it in decreasing order of prevalence? If not, quote in alphabetical order: Argentina, Bolivia, Brazil, Colombia and Mexico

Line 101 – Reassess the sentence: “Therefore, TcII, TcV, and TcVI are the T. cruzi genotypes with the highest pathogenic potential as they are related both to cardiac and digestive chronic clinical Chagas disease forms [6]”.

This reviewer does not agree with the statement that these DTUs have the highest pathogenic potential BECAUSE they cause cardiac and digestive forms. TcI is also highly pathogenic and causes severe cardiomyopathy in chronic chagasic patients in Argentina (Burgos et al. Clin Infect Dis. 2010; 51: 485–495) and Colombia (Ramírez et al. PLoS Negl Trop Dis. 2010 doi: 10.1371 / journal.pntd.0000899) as well as Venezuela.

Methods. Patients and Study Design:

Briefly inform the tests used for clinical evaluation of the cardiac, digestive and cardiodigestive forms.

Results

Line 208 – Inform percentage: Most patients were women (72.2%) and were infected by vector borne transmission (Table 2).

Line 260 – Rephrase: A total of 8 patients (18.6%) with the cardiac or cardiodigestive forms progressed during the study follow-up,

Discussion

Some relevant aspects should be included in the Discussion to make it more comprehensive and hypotheses should be raised by the authors to explain some observations.

- In the cohort, there were no patients with only the digestive form. On the other hand, 23% of the patients had the cardiodigestive form. Since several authors show that TcII promotes the digestive form (cite references). To what factors do the authors attribute the findings of the present study? (see Lines 322-331).

- Comment on a possible criticism:

Although a few reports have shown that the parasite population infecting specific organs can be genetically distinct from the population found in the patients’ blood (cite references), it is unlikely that this occurs in the cohort of patients here analyzed.

- A clear conclusion of the study is that TcII promotes different clinical presentations of ChD. The studies by Lages-Silva et al. (Ref. 23), which indicate that the genetic variability within TcII is not associated with the clinical manifestation, should be cited.

- On Line 346 the authors mention that “immunologic factors of the host together with parasite genetic variation contribute to the diversity of Chagas disease clinical presentation [6]”. Authors should further develop this hypothesis by presenting some studies that can support it.

The sentences below can be improved

Line 282 Therefore, it is needed to describe which T. cruzi DTUs are found in patients with Chagas disease in Brazil and which clinical presentations and outcomes can be associated to those DTUs.

Line 299 Our (?) predominance of patients with cardiac form can

Move Fig. 2 to Supplemental data.

Reviewer #2: This study aims at identifying T. cruzi parasite genotypes and correlate these with clinical manifestations in a convenience sample of patients. It is an important topic and the study is overall well performed and well presented. The major limitation is the methodological approach used, which is not the most appropriate for such studies. Indeed, genotyping by PCR from isolated parasites generates bias as in vitro culture selects for strains growing faster in the selected medium, and genotyping by PCR only detects the dominant strains in potential mixtures of strains. More sensitive approaches based on direct genotyping by sequencing, and particularly deep sequencing, have shown that infections with multiple strains/DTUs can be frequent in some regions (see for example Villanueva-Lizama et al., J Infect Dis, 2019. 219(12): 1980-1988) and may have been overlooked in this study. These aspects should at least be discussed.

Minor comments:

Follow-up time should be indicated for each patient in Table 4. Also, were any patient’s samples genotyped at more than 1 time point during their follow-up? If yes, were there any changes in parasite genotypes over time as seen in some studies? Has parasitemia been quantified in these patients? Were the patients treated? If yes, how did they respond to treatment? These aspects would enrich the study.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Eric Dumonteil

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

30 Oct 2020

Question: If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Answer: In the original manuscript, all protocols used are described in the cited references in sufficient details to allow replication of experiments. Please, see page 5, line 139; page 6, line 160; and references 11, 19, 26, and 29 of the revised manuscript.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Question: 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Answer: All changes necessary for our manuscript to meet PLOS ONE’s style requirements were done.

Question: 2. In your Methods section, please provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as: a) the recruitment date range (month and year), b) a description of how participants were recruited, and c) descriptions of where participants were recruited and where the research took place. Please also describe the methods used to collect patient samples.

Answer: The research took place at the Evandro Chagas National Institute of Infectious Diseases, Fiocruz, Rio de Janeiro, Brazil. This was a retrospective study based on parasites isolated from blood cultures collected between July 2008 and June 2010. Participants were approached during their regular medical appointment at our outpatient clinic in order to give written informed consent to allow the use of the archived parasites isolates. The demographic details of the study participants are described in Table 2. All methods are described in detail. Please see page 4, lines 107 to 112 for changes in the revised manuscript.

Question: 3. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Answer: We have copyedited the revised version of our manuscript.

Question: 4. Thank you for including your ethics statement:

"This study was approved by the Institutional Review Bord under number 62973116.6.0000.5262. All procedures followed regulatory guidelines and standards for research involving human beings as stated in the Brazilian National Health Council Resolution 466/2012 and were conducted according to the principles expressed in the Declaration of Helsinki in order to safeguard the rights and welfare of the participants. ".

i) Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

Answer: We have included the full name of the ethics committee. Please, see page 5, lines 128 and 129 of the revised manuscript.

Question: ii) Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

Answer:We made the requested correction.

Question: 5. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

Answer:This is a retrospective study using archived samples. All participants who were still followed at our institution provided written informed consent allowing the use of their archived parasites isolated from their blood culture and granting access to their medical records. The institutional ethics committee waived the requirement for informed consent for deceased participants and those who were lost to follow-up and could not be reached. Please see page 4, lines 107 to 112 for changes in the revised manuscript.

Question: 6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Ansewer: All original uncropped and unadjusted gel images used in Figure 2 were uploaded as Supporting Information file named S1_raw_images as a pdf file.

Question: 7. We note that Figure 3 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

Answer: The map presented in Figure 3 was created using cartographic bases maps modified from open access (public domain) by the Brazilian Institute of Geography and Statistics, IBGE (https://www.ibge.gov.br/geociencias/downloads-geociencias.html). Therefore, the maps used are not copyrighted. This information was added to the Methods section and Figure 3 legend. Please see page 8, lines 208 to 210; and page 13 lines 310 to 313 for changes in the revised manuscript.

Question: 8. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Answer: The captions for the supporting information files were included at the end of the revised manuscript. Please, see page 31 of the revised manuscript.

Reviewers' comments:

Comments to the Author

Reviewer #1: This is an interesting study that sought to evaluate a possible association between the infective T. cruzi genotype and the clinical manifestation of Chagas disease in Brazilian patients. Although the results confirm data from other authors that TcII is prevalent in patients from various regions of Brazil and that DTU TcII promotes the indeterminate, cardiac and cardiodigestive forms in the chronic phase, the study deserves to be published not only because it expands knowledge on the subject, but also because it is a well-conducted study that also analyzes the progression of the disease in some patients.

To supplement the MS, this reviewer raises some relevant points that must be taken into account before the final acceptance. These points are listed below:

Question:- Title: Association between Trypanosoma cruzi genotypes and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

The title is very assertive. The reader is induced to think that the authors found this association, when, in fact, TcII is responsible for cardiac, indeterminate and cardiodigestive forms. Therefore, the following title is suggested:

Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentations and outcome in an urban cohort in Brazil.

Answer: The title was changed according to the reviewer’s suggestion.

Background

Question: Line 32: Substitution: This study aimed to identify the potential association between T. cruzi genotypes and the clinical presentations of chronic Chagas disease.

Answer: The text was changed according to the reviewer’s suggestion. Please, see page2, line 33 of the revised manuscript.

Methodology/Principal Findings

Question: Suggestion: Start by describing the characteristics of the patients. Then, describe the DTU typing method and the data obtained.

Answer: The text was changed according to the reviewer’s suggestion. Please, see page 2, lines 36 to 41 of the revised manuscript.

Question: Conclusions/Significance

Provide percentages:

Line 49 - TcII was the main T. cruzi DTU identified in chronic Chagas disease Brazilian patients (45.2%)….

Line 51 - Other DTU found in much less frequency (4.7%) was TcVI.

Answer:The percentages were provided. Please, see page 2, lines 51 and 52 of the revised manuscript.

Question:Introduction

Line 82 -…… Latin America, mainly in Argentina, Brazil, Mexico, Bolivia and Colombia [2,3].

Why are countries mentioned in this order? Is it in decreasing order of prevalence? If not, quote in alphabetical order: Argentina, Bolivia, Brazil, Colombia and Mexico

Answer: The text was changed according to the reviewer’s suggestion. Please, see page 3, line 72 of the revised manuscript.

Question: Line 101 – Reassess the sentence: “Therefore, TcII, TcV, and TcVI are the T. cruzi genotypes with the highest pathogenic potential as they are related both to cardiac and digestive chronic clinical Chagas disease forms [6]”.

This reviewer does not agree with the statement that these DTUs have the highest pathogenic potential BECAUSE they cause cardiac and digestive forms. TcI is also highly pathogenic and causes severe cardiomyopathy in chronic chagasic patients in Argentina (Burgos et al. Clin Infect Dis. 2010; 51: 485–495) and Colombia (Ramírez et al. PLoS Negl Trop Dis. 2010 doi: 10.1371 / journal.pntd.0000899) as well as Venezuela.

Answer: The sentence was excluded.

Question: Methods. Patients and Study Design:

Briefly inform the tests used for clinical evaluation of the cardiac, digestive and cardiodigestive forms.

Answer: The tests used to evaluate the cardiac and digestive forms were included in the Methods section. Please, see page 5, lines 123 to 125 of the revised manuscript.

Question: Results

Line 208 – Inform percentage: Most patients were women (72.2%) and were infected by vector borne transmission (Table 2).

Answer: The percentage were included in the text. Please, see page 9, line 237 of the revised manuscript.

Question: Line 260 – Rephrase: A total of 8 patients (18.6%) with the cardiac or cardiodigestive forms progressed during the study follow-up,

Answer: The text was changed according to the reviewer’s suggestion. Please, see page 15, lines 345 to 348 of the revised manuscript.

Question: Discussion

Some relevant aspects should be included in the Discussion to make it more comprehensive and hypotheses should be raised by the authors to explain some observations.

- In the cohort, there were no patients with only the digestive form. On the other hand, 23% of the patients had the cardiodigestive form. Since several authors show that TcII promotes the digestive form (cite references). To what factors do the authors attribute the findings of the present study? (see Lines 322-331).

Answer: The prevalence of patients with only the digestive form is low in our cohort: around 5% [34]. As the studied sample was relatively small, the absence of patients with only the digestive form was probably due by chance and the we cannot evaluate the association between DTU and the digestive form in the present study. Please, see page 19, lines 479 to 484 for changes in the revised manuscript.

Question: - Comment on a possible criticism:

Although a few reports have shown that the parasite population infecting specific organs can be genetically distinct from the population found in the patients’ blood (cite references), it is unlikely that this occurs in the cohort of patients here analyzed.

Answer: The comment suggested by the reviewer was added to the text. Please, see page 18, lines 454 to 458 of the revised manuscript.

Question: - A clear conclusion of the study is that TcII promotes different clinical presentations of ChD. The studies by Lages-Silva et al. (Ref. 23), which indicate that the genetic variability within TcII is not associated with the clinical manifestation, should be cited.

Answer: The comment suggested by the reviewer was added to the text. Please, see page 17, lines 421 to 423 of the revised manuscript.

Question: - On Line 346 the authors mention that “immunologic factors of the host together with parasite genetic variation contribute to the diversity of Chagas disease clinical presentation [6]”. Authors should further develop this hypothesis by presenting some studies that can support it.

Answer: We added references that support the hypothesis that immunology factors contribute to Chagas diseases different presentations. Please, see page 18, lines 450 to 453 of the revised manuscript.

Question: The sentences below can be improved

Line 282 Therefore, it is needed to describe which T. cruzi DTUs are found in patients with Chagas disease in Brazil and which clinical presentations and outcomes can be associated to those DTUs.

Answer: The sentence was improved. Please, see page 15, line 363 to page 16, line 367 of the revised manuscript.

Question Line 299 Our (?) predominance of patients with cardiac form can

Answer: The sentence was improved. Please, see page 16, line 373 of the revised manuscript.

Question Move Fig. 2 to Supplemental data.

Answer: We highly appreciated all the reviewer’s comments but we prefer to keep Fig 2 in the main manuscript.

Reviewer #2: This study aims at identifying T. cruzi parasite genotypes and correlate these with clinical manifestations in a convenience sample of patients. It is an important topic and the study is overall well performed and well presented. The major limitation is the methodological approach used, which is not the most appropriate for such studies. Indeed, genotyping by PCR from isolated parasites generates bias as in vitro culture selects for strains growing faster in the selected medium, and genotyping by PCR only detects the dominant strains in potential mixtures of strains. More sensitive approaches based on direct genotyping by sequencing, and particularly deep sequencing, have shown that infections with multiple strains/DTUs can be frequent in some regions (see for example Villanueva-Lizama et al., J Infect Dis, 2019. 219(12): 1980-1988) and may have been overlooked in this study. These aspects should at least be discussed.

Answer: We agree with the reviewer regarding this limitation and we had already pointed out in the original submission that the blood culture method could select a specific T. cruzi subpopulation more adapted to the culture medium. We acknowledge that new sequencing methods could identify a higher percentage of mixed infections. However, the multilocus PCR used by us is also able to identify mixed infections and is recommended by experts’ consensus statement to be used in clinical samples [9]. In the revised manuscript, we created a limitations subheading in order to deepen this discussion, as suggested by the reviewer. Please, see page 19, line 485 to page 20, line 499 of the revised manuscript.

Minor comments:

Question Follow-up time should be indicated for each patient in Table 4.

Answer: The requested information was added. Please, see Table 4 of the revised manuscript.

Question: Also, were any patient’s samples genotyped at more than 1 time point during their follow-up? If yes, were there any changes in parasite genotypes over time as seen in some studies?

Answer: Patients’ samples were not genotyped at more than 1 time point. This limitation was added to the revised manuscript. Please, see page 19, line 489 to page 20, line 491 of the revised manuscript.

Question: Has parasitemia been quantified in these patients?

Answer: Parasitemia has not been quantified.

Question:Were the patients treated? If yes, how did they respond to treatment? These aspects would enrich the study.

Answer: Few patients (eight) were treated with benznidazole during the study follow-up and the patients did not collect a new blood culture sample after treatment. Therefore, we could not study how specific treatment influenced the outcome of the studied patients.

The low number of treated patients in our study is due to the fact that most patients presented the chronic cardiac or cardiodigestive forms at the time of Chagas disease diagnosis and specific Chagas disease treatment would not be indicated in these cases. Also, the indication for specific Chagas disease treatment in patients with the indeterminate form was controversial at the time these patients were diagnosed and only recently there was a consensus towards specific Chagas disease treatment for chronic patients with the indeterminate form under 50 years old [3].

Most of the patients referred for treatment with benznidazole in the present study did so because they were enrolled in a research protocol (BENEFIT) that was underway during the study follow-up at our institution. BENEFIT recruited patients with the chronic cardiac form to test the clinical efficacy of benznidazol treatment. Therefore, most of the patients treated with benznidazol in our paper had the cardiac form.

Please, see page 15, lines 356 to 358 for changes in the revised manuscript.

Submitted filename: response to reviewers PONE-D-2-26324R1.docx

Click here for additional data file.

10 Nov 2020

PONE-D-20-26324R1

Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

PLOS ONE

Dear Dr. Roberto Saraiva,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit for publication with a couple of minor edits. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Editor Comments:

The authors well addressed the reviewers' comments. For the final acceptance of the article, I'm asking authors make a couple of minor edits on page 22, line 434, change "Limitations" by "Study limitations," and on page 18, line 349, replace "in the present article" with " in this study. "

Please submit your revised manuscript by 11/11/2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Claudia Patricia Herrera, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10 Nov 2020

Editor Comments:

The authors well addressed the reviewers' comments. For the final acceptance of the article, I'm asking authors make a couple of minor edits on page 22, line 434, change "Limitations" by "Study limitations," and on page 18, line 349, replace "in the present article" with " in this study. "

- Answer: We made the requested changes. Please, see page 16 lines 294 to 295; and page 19, line 366 of the revised manuscript.

Submitted filename: response to reviewers PONE-D-2-26324R2.docx

Click here for additional data file.

13 Nov 2020

Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

PONE-D-20-26324R2

Dear Dr. Saraiva,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Claudia Patricia Herrera, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

20 Nov 2020

PONE-D-20-26324R2

Association between Trypanosoma cruzi DTU TcII and chronic Chagas disease clinical presentation and outcome in an urban cohort in Brazil.

Dear Dr. Saraiva:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Claudia Patricia Herrera

Academic Editor

PLOS ONE