Xiaoming Hu1, Dongzhe Zhu1. 1. Department of Neonatology, Children's Hospital of Capital Institute of Pediatrics, Beijing, China (mainland).
Abstract
BACKGROUND Infants and young children with acute respiratory distress syndrome (ARDS) have acute progressive hypoxic respiratory failure caused by a variety of extrapulmonary pathogenic factors and cardiogenic factors. Diffuse alveolar injury and pulmonary fibrosis both are pathological features of ARDS. This study investigated the effect of Rehmannia Radix extract (RRE) on pulmonary fibrosis of infants with ARDS. MATERIAL AND METHODS The human lung fibroblasts cell line HFL1 was treated with various concentrations of Rehmannia Radix extract in different groups for different times. Flow cytometry and TUNEL assay were performed to detect cell apoptosis, and CCK8 assay was utilized to analyze cell proliferation. TGF-ß1 expression was detected by real-time quantitative PCR, and protein-level expressions of Caspase3, TGF-ß1, Bcl-2, and Smad3 were measured by western blot and immunohistochemical staining in cells or tissues. TGF-ß1 was overexpressed by recombinant human TGF-ß1 (2 ng/mL) and the treated cells and culture supernatant were harvested for analysis in each step. Bleomycin was used to induce a mouse model of pulmonary fibrosis and was confirmed by HE pathological sections. RESULTS Flow cytometry and TUNEL results showed that RRE promoted the apoptosis of HFL1 cells in a concentration-dependent manner, and it inhibited the proliferation of HFL1 cells. Upregulation of TGF-ß1 reversed the effects of RRE in HFL1 cells. RRE alleviated pulmonary fibrosis in mice through downregulating Bcl-2, TGF-ß1, and Smad3 expression. CONCLUSIONS RRE promoted apoptosis and inhibited proliferation of HFL1, and then arrested the progression of pulmonary fibrosis. RRE had a significant inhibitory effect on TGF-ß1 and Smad3. These results suggest that RRE directly prevents the development of pulmonary fibrosis by affecting the expression of TGF-ß1 and Smad3.
BACKGROUND Infants and young children with acute respiratory distress syndrome (ARDS) have acute progressive hypoxic respiratory failure caused by a variety of extrapulmonary pathogenic factors and cardiogenic factors. Diffuse alveolar injury and pulmonary fibrosis both are pathological features of ARDS. This study investigated the effect of Rehmannia Radix extract (RRE) on pulmonary fibrosis of infants with ARDS. MATERIAL AND METHODS The human lung fibroblasts cell line HFL1 was treated with various concentrations of Rehmannia Radix extract in different groups for different times. Flow cytometry and TUNEL assay were performed to detect cell apoptosis, and CCK8 assay was utilized to analyze cell proliferation. TGF-ß1 expression was detected by real-time quantitative PCR, and protein-level expressions of Caspase3, TGF-ß1, Bcl-2, and Smad3 were measured by western blot and immunohistochemical staining in cells or tissues. TGF-ß1 was overexpressed by recombinant human TGF-ß1 (2 ng/mL) and the treated cells and culture supernatant were harvested for analysis in each step. Bleomycin was used to induce a mouse model of pulmonary fibrosis and was confirmed by HE pathological sections. RESULTS Flow cytometry and TUNEL results showed that RRE promoted the apoptosis of HFL1 cells in a concentration-dependent manner, and it inhibited the proliferation of HFL1 cells. Upregulation of TGF-ß1 reversed the effects of RRE in HFL1 cells. RRE alleviated pulmonary fibrosis in mice through downregulating Bcl-2, TGF-ß1, and Smad3 expression. CONCLUSIONS RRE promoted apoptosis and inhibited proliferation of HFL1, and then arrested the progression of pulmonary fibrosis. RRE had a significant inhibitory effect on TGF-ß1 and Smad3. These results suggest that RRE directly prevents the development of pulmonary fibrosis by affecting the expression of TGF-ß1 and Smad3.
Acute respiratory distress is a common disease in infants, with a morbidity rate of 7%. The incidence rate of acute respiratory distress is high in premature infants [1]. Although the 2015 Pediatric ALI Consensus Conference (PALICC) developed specific ARDS diagnostic criteria for children ranging in age from infants to adolescents (pARDS), preterm infants with lung disease and perinatal lung injury were excluded [2]. Clinical manifestations include apnea, cyanosis, wheezing breathing, nasal obstruction, feeding intolerance, shortness of breath or dyspnea, and inhaling depression. One of the pathological features of ARDS is diffuse alveolar injury [3]. Progressive hypoxemia and respiratory distress are the main clinical manifestations of ARDS. The alveolar capillary barrier is seriously injured, leading to highly permeable interstitial edema and alveolar edema. A transparent membrane forms on the alveolar surface, which can result in pulmonary fibrosis [4]. Therefore, inhibiting pulmonary fibrosis can help treat ARDS.Rehmannia Radix is a sweet Chinese medicinal material extracted from the perennial plant Rehmannia glutinosa, and has been used for more than 3000 years for treating diseases. For over 200 years, Rehmannia Radix and other herbs have been applied to treat osteoporosis in China and other Asian countries, and Rehmannia Radix has been shown to relieve lower back pain and increase bone density in patients with osteoporosis [5]. A previous study showed that prescription drugs containing raw ingredients such as Liuwei Dihuang Wan can effectively treat osteoporosis by activating the calcium non-specific Wnt/β-catenin signaling pathway in osteoblasts [6]. Zhang et al. showed that their formula containing Rehmannia Radix promoted skin fibroblast migration and activated genes related to the TGF-β1 pathway [7]. The above evidence shows that Rehmannia Radix has significant medicinal value for a variety of diseases, but its effect on pulmonary fibrosis in ARDS has not been previously assessed.Pulmonary fibrosis is a pulmonary interstitial disease characterized by progressively increased dyspnea, restricted ventilation dysfunction with reduced diffuse function, hypoxemia, and diffuse lung lesions on imaging [8]. Its pathogenesis remains unclear and there is no effective treatment [9]. The lung function of most patients with pulmonary fibrosis declines year by year, eventually leading to respiratory failure and death [10]. In recent years, traditional Chinese medicine showed its advantages in experimental studies of pulmonary interstitial fibrosis, and has shown obvious targets of action [11]. The main components are glycosides (such as catalpol), sugars (such as xylose), various amino acids (such as arginine), and various inorganic and trace elements. Its pharmacological effects include regulating immune function and anti-oxidative damage. The present study demonstrated the mechanism of reducing of ARDS by studying the effects of Rehmannia Radix on human lung fibrotic cells and the effect on bleomycin-induced pulmonary fibrosis.
Material and Methods
Cell culture
The human lung fibroblasts cell line HFL1 was bought from the Cell Resource Center, Shanghai Science Research Center, Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, NY, USA) with 10% fetal bovine serum (FBS, Gibco, NY, USA) and 100 units/ml penicillin/streptomycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Cells were incubated at 37°C with 5% CO2. RRE was obtained from Henan Wanxi Corp and the Pharmacy Department of Shanghai Shuguang Hospital.The RRE was dissolved by DMEM medium with 10% FBS into concentrations of 200 μg/ml, 400 μg/ml, and 800 μg/ml for the treatment of HLF1. Recombinant human TGF-β1 (R&D Systems, Minneapolis, USA, 2 ng/ml) was used to increase the expression of TGF-β1 in HFL1.
Flow cytometry and TUNEL assay
HFL1 cells were treated with various concentrations of RRE. Then, cells were washed 3 times with pre-cooled phosphate-buffered saline solution (PBS) and wiped off for subsequent detection with the Annexin V-APC Apoptosis Detection Kit (Beyotime Biotechnology, Nanjing, China). Next, the cell apoptosis rate was analyzed using a flow cytometer (BD Biosciences, NJ, USA). Cell apoptosis was also assessed using a terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labeling (TUNEL) detection kit (Roche, Shanghai, China) following the manufacturer’s instructions. Finally, HFL1 was assessed with DAPI under a fluorescence microscope.
Cell viability analysis
HFL1 cells were treated with various doses of RRE and seeded in a 96-well plate. Then, cell viability was observed using the Cell Counting Kit-8 (CCK-8) Kit (Dojindo, Japan).
Real-time PCR
Fresh mouse lung tissue was cut and placed into a mortar containing liquid nitrogen and TRIzol and fully ground to extract tissue RNA. The total RNA was removed from HFL1 cells and lung tissue of rats using TRIzol reagent (Invitrogen, CA, USA), then reverse-transcribed into cDNA with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Shiga, Japan). The mRNA levels were analyzed using SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc., CA, USA). Relative expression of mRNA was normalized with β-actin expression for each detection. The human and mouse primers for real-time PCR are listed in Table 1.
Table 1
Primers sequences used for PCR.
Gene
Sense primer (5′–3′)
Antisense primer (5′–3′)
TGF-β1
CCAAGCTTATGCCGCCCTCCGGGC
GCGTCGACCAGCTGCACTTGCAGGAG
Smad3
AAACCAGGCTGGCTAAACAAGTG
ATGGTGGTGAAGACGCCAGT
Bcl-2
TTCTTTGAGTTCGGTGGGGTC
TGCATATTTGTTTGGGGCAGG
GAPDH
CGGAGTCAACGGATTTGGTCGTAT
AGCCTTCTCCATGGTGGTGAAGAC
Western blot
The fresh mouse lung tissue was cut up and ground thoroughly, and protein was extracted using the Tissue Protein Extraction Kit (BestBio Corporation, Nanjing, China). HFL1 cells were harvested and washed in pre-cold PBS and kept at 4°C in lysis buffer. Cell debris was removed by centrifugation after incubation for 15 min on ice, and protein concentrations were measured by dicaprylic acid assay. A total of 30 μg protein was added in each prepared lane of 10% SDS-PAGE gels and the protein lane was transferred to polyvinylidene fluoride membranes (Roche, USA). The membranes were blocked with 5% BSA diluted with TBST (Tris-buffered saline with 0.1% Tween-20) at room temperature for 2 h, then incubated with various target antibodies at 4°C overnight: anti-pro-Caspase 3 (sc-271759, Santa Cruz, CA), anti-TGF-β1 (sc-130348, Santa Cruz, CA), anti-Smad3 (sc-7960, Santa Cruz, CA), and anti-Bcl-2 (sc-509, Santa Cruz, CA). Membranes were then incubated with a secondary antibody (1: 2000, Beyotime Biotechnology, Nanjing, China) at room temperature for 2 h. Immunoreactive bands were assayed using an enhanced chemiluminescence (ECL) system (Thermo, USA). The anti-β-actin antibody was set as the monitor of protein loading in each lane. Image J software was used for densitometric analysis.
Mouse model of pulmonary fibrosis
The mice (n=55) were reared adaptively for 1 week at room temperature (20°C) with a 12-h/12-h light cycle. The mousepulmonary fibrosis model was reproduced by intratracheal injection of bleomycin (Japan Chemical Co., Ltd, Japan). Diazepam (20 mg/kg, Shanghai Xudong Haipu Pharmaceutical Co., Ltd, Shanghai, China) was injected intraperitoneally, and then ketamine hydrochloride (20 mg/kg, Shanghai Zhongxi Pharmaceutical Co., Ltd., Shanghai, China) was injected intraperitoneally. After anesthetization, the mice were fixed on their backs and we disinfected and cut the skin of the neck, bluntly separated the soft tissue layer by layer, and exposed the trachea. A 1-ml syringe of bleomycin solution (8 mg: 2 ml) was drawn through the tracheal cartilage space into the trachea and the needle was inserted about 0.75 cm. After withdrawal without resistance, we quickly injected 0.3 ml of the medicinal solution and immediately rotated the mouse, so that the medicinal solution was evenly distributed in the lungs. The incision was sutured, and the local skin was disinfected. Mice in the normal group (n=5) were not modeled. Mice in the sham operation group (n=5) were modeled in the same manner as the model group, but bleomycin was followed by physiological saline for intratracheal injection.The RRE injection group was injected intraperitoneally with 10 ml/kg daily. Mice in the methylprednisolone group (methylprednisolone sodium succinate for injection, Pfizer Manufacturing Belgium NV, Belgium) were injected intraperitoneally with methylprednisolone 2 mg/kg, while the normal group and model group mice were injected with saline daily. The mice in all groups received treatment from the first day after modeling until the day on which they were killed. The mice were treated 24 h before being killed. On the 7th day, 14th day, and 28th day, 5 mice in each group were killed. Mice were anesthetized with 10% chloral hydrate and killed, then the left and right lungs were removed.
Hematoxylin-eosin staining and immunohistochemical staining
The lung tissues of mice were fixed in 4% paraformaldehyde for 24 h, then dehydrated, embedded in paraffin, and stained with HE after sectioning. This step was mainly completed in the Pathology Department of our hospital. In addition, the sections were deparaffinized, dehydrated, and hydrated, and then hydrogen peroxide was added to block endogenous peroxidase for antigen retrieval. We added primary antibody anti-TGF-β1 or anti-Smad3, incubated at 4°C overnight, and added the corresponding secondary antibody the next day at room temperature, followed by incubation at 37°C for 1 h. DAB solution was used for color development, and the time of color development was controlled by microscope observation. After dehydration, the slides were sealed with neutral resin.
Ethics approval and consent to participate
The study protocol was approved by the Research Ethics Committee of Children’s Hospital of Capital Institute of Pediatrics (20180001-20182021, dated 2017.12.11).
Statistical analysis
Statistical analysis was performed using one-way ANOVA and Student-Newman-Keuls with SPSS 17.0 (IBM, Armonk, NY, USA) statistical software. The t test was used to assess differences between 2 groups. Values are represented as mean±standard. A P value less than 0.05 indicated statistical significance.
Results
RRE promotes apoptosis of HFL1 cells
With the different concentrations of RRE, cell apoptosis of HFL1 in each group was detected through flow cytometry and TUNEL method. Flow cytometry showed the cell apoptosis rates of HFL1 at the concentrations of 0 μg/ml, 200 μg/ml, 400 μg/ml, and 800 μg/ml were 4.3%, 33.5%, 45.3%, and 59.2%, respectively (Figure 1A, 1B). Cell apoptosis in the 200 μg/ml group and 400 μg/ml group was significantly higher than in the 0 μg/ml group (P<0.05), and apoptosis rates in the 800 μg/ml group and 400 μg/ml group were significantly different. TUNEL analysis also showed that compared with the 0 μg/ml group, with the increase of RRE concentration, the apoptosis rate of HFL1 cells increased markedly (Figure 1C). Western blot analysis showed that as the RRE concentration increased, Caspase3 expression increased and Bcl-2 decreased (Figure 1D).
Figure 1
RRE promoted apoptosis of HFL1 cells. (A, B) Flow cytometry showed increased apoptosis rates of HFL1 after treatment with RRE. (C) TUNEL results showed that the apoptosis increased with the increase of RRE concentration. (D) Western blot showed that the expression of proteins involved in apoptosis changed. * P<0.05 vs. 0 μg/ml group; ** P<0.01 vs. 0 μg/ml group. Data are shown as means±SD.
RRE inhibits proliferation and TGF-β1 expression of HFL1
The effect of RRE on the cell proliferation of HFL1 was observed by CCK-8 assay. The results showed that there was a significant difference in the proliferation of HFL1 cells in distinct concentrations of RRE-treated groups (Figure 2A). The RRE concentration of 800 μg/ml had the strongest inhibitory effect of the 4 groups. However, HFL1 cells exposed to RRE also had lower levels of TGF-β1 and Smad3 at both mRNA (Figure 2B, 2C) and protein (Figure 2D) levels.
Figure 2
RRE inhibited proliferation of HFL1. (A) The CCK8 assay showed that the proliferation of HLF1 was inhibited by RRE. (B) RRE inhibited the expression of mRNA of TGF-β1. (C) RRE inhibited the expression of mRNA of Smad3. (D) The expression of TGF-β1 and Smad3 protein were inhibited by RRE. * P<0.05 vs. 0 μg/ml group; ** P<0.01 vs. 0 μg/ml group. Data are shown as means±SD.
RRE reversed the apoptosis and proliferation caused by TGF-β1
In this study, recombinant human TGF-β1 was used to upregulate the expression of TGF-β1 in HFL1 (Figure 3A), and the mechanism of RRE on ARDS was explored. When the level of TGF-β1 in HFL1 was increased, the decrease in cell proliferation due to the presence of RRE was reversed (Figure 3B), and the effect of RRE-induced apoptosis was also suppressed according to the increased expression of TGF-β1, as analyzed by TUNEL assay (Figure 3C). In addition, due to the upregulation of TGF-β1, the levels of Smad3, Caspase 3, and Bcl-2 changed by RRE reversed to varying degrees as well (Figure 3D). The sign “+” means that the condition of TGF-β at 0 μg/ml was included in the treatment of cells, and the sign “−” means TGF-β at 0 μg/ml was not included. Moreover, we suggest that the “+” or “−“ in the figure should be linked vertically in Figure 3D.
Figure 3
RRE reversed the apoptosis and proliferation caused by TGF-β1. (A) TGF-β1 gene was significantly overexpressed (** P<0.05 vs. NC group). (B) CCK8 assay showed that RRE alleviated TGF-β1-induced cell growth (* P/# P<0.05 vs. control group). (C) TUNEL assay showed RRE returned TGF-β1 induced cell growth. (D) RRE reversed the protein expression of Smad3, Caspase3, and Bcl-2. NC, negative group; control group, RRE (0 μg/ml)+TGF-β1 (2 μg/ml). Data are shown as means±SD.
RRE alleviates the progression of bleomycin-induced pulmonary fibrosis
We assessed the histopathological changes in lung tissue to determine bleomycin-induced changes in pulmonary fibrosis in mice. As expected, compared with the normal saline control group, mice treated with bleomycin showed significant changes in lung parenchyma, including increased fibrotic lesions, significantly altered alveolar walls, increased septal thickness, inflammatory cell infiltration, and alveolar epithelial cell proliferation (Figure 4A), and fibrotic lesions become more pronounced as the RRE concentration increases. Immunohistochemical results showed that TGF-β1 expression in the lungs of mice treated with bleomycin increased as the fibrosis increased, but this trend was reversed by RRE (Figure 4B), and Smad3 showed the same characteristics (Figure 4C).
Figure 4
RRE alleviates bleomycin-induced pulmonary fibrosis. (A) Hematoxylin-eosin staining showed different progress of pulmonary fibrosis in rats with bleomycin or RRE. (B) The expression of TGF-β1 protein was studied by immunohistochemistry. (C) Immunohistochemistry confirmed the expression of Smad3 was reversed by RRE.
RRE reversed TGF-β1 expression in tissues of pulmonary fibrosis mice
We treated pulmonary fibrosismice induced by bleomycin using RRE, and mice were killed after specified durations of feeding. We then extracted the nucleic acids and proteins after obtaining their lung tissue for the next assay. Real-time PCR showed that RRE treatment inhibited the expression of TGF-β1, Smad3, and Bcl-2 (Figure 5A–5C). In addition, western blot assay showed that RRE decreased the expression of TGF-β1, Smad3, and Bcl-2 in the mouse model of pulmonary fibrosis (Figure 5D).
Figure 5
RRE reversed TGF-β1 expression in the tissue of pulmonary fibrosis rats. (A–C) Real-time PCR showed that the expression of TGF-β1, Smad3, and Bcl-2 was decreased under the influence of RRE after being induced by bleomycin. (D) The protein level of TGF-β1, Smad3, and Bcl-2 induced by bleomycin was decreased by RRE. * P<0.05/** P<0.01 vs. control group; # P<0.05/## P<0.01 vs. bleomycin group. Data are shown as means±SD.
Discussion
Acute respiratory distress syndrome (ARDS) is a distinct type of acute respiratory failure. It belongs to severe acute lung injury (acute lung injury, AU) and is a major factor that threatens the life of infants. Although the application of many supportive therapies has improved its prognosis, the mortality rate remains high [12], which is the main cause of death in children. Surviving critically illchildren also often have restrictive lung disease due to persistent pulmonary fibrosis, and there are other serious abnormal lung functions that seriously affect the quality of life of these children. The pathological features of ARDS have been described as 3 overlapping stages: inflammation or exudation stage (0–7 days), hyperplasia stage (7–21 days), and fibrosis stage (after 10 days). A study has shown that the stages of inflammation and fibrosis almost overlap, and within 24 h of acute lung injury, collagen transformation and fibrosis appear in the lung tissue, which constitutes the heterogeneous feature of the inflammatory response and repair process [13]. A study showed that excessive fibroproliferative reactions can impair the ventilation function of the lungs, and the formation of pulmonary fibrosis in ARDSpatients may be one of the principal factors leading to death [14].The TGF-β family is a class of heterodimeric polypeptides of structurally related proteins, including at least 3 subtypes of TGF-β1–3, of which TGF-β1 is the main form in the human body [15]. TGF-β1 has multiple biological functions, controlling cell growth, differentiation, and extracellular matrix (ECM) deposition, participating in fibrosis, activating fibroblasts (FC), and accelerating wound healing. It plays a major role in embryonic development, immune regulation, and apoptosis, but its overexpression can cause fibrosis of tissues and organs. There is a small amount of TGF-β1 mRNA and protein expression in normal lung tissue, mainly distributed in lung epithelial cells (AEC), alveolar macrophages, fibroblasts, microvascular endothelial cells, and bronchial mucosal epithelial cells. The damage caused by ARDS often leads to fibrosis [16]. TGF-β1 may be involved in the formation of pulmonary fibrosis. The results show that excessive fibroproliferative response can damage the ventilation function of the lung, and the formation of pulmonary fibrosis may be one of the important factors leading to death in ARDSpatients. Animal experiments showed that the level of TGF-β1 in ARDS model rats increased significantly, indicating that it may be involved in the early inflammatory response and suggesting that TGF-β1 plays an important role in pulmonary dysplasia and ARDS interstitial fibrosis [17]. Recent studies have found that TGF-β1 induces collagen-soluble protein gene expression, leading to collagen curling and fibroplasia, indicating that TGF-β1 plays an important role in the early lung injury and fibroplasia of ARDS [18]. In infants with infantile respiratory distress syndrome, who may develop chronic lung disease, the level of TGF-β1 activity is 6 times that of other children, and those with high levels of TGF-β1 are associated with higher mortality and shorter survival time [19].Rehmanniae (Rehmanniae Radix, RR) is derived from the roots of the perennial plant Rehmannia glutinosa, which is a famous herbaceous plant recorded in the Pharmacopoeia of the People’s Republic of China (2015). Used in combination with other herbs, it has been used in China and other Asian countries to treat a variety of diseases for more than 2000 years [5]. RRP has been shown to reduce low back pain and increase bone mineral density (BMD) in patients with osteoporosis [5]. Its efficacy is supported by in vivo and in vitro studies, demonstrating the ability to attenuate BMD loss in the proximal tibial metaphysis and increase the thickness of cortical bone in ovariectomized (OVX) rats, and promote osteoblast formation and inhibit osteoclast activity [20]. In addition, some studies have shown that drugs containing RRE can alleviate the damage caused by pulmonary fibrosis by limiting activity of the TGF-β1 signaling pathway [21]. However, the role and mechanism of RRE in the formation of lung fibers during the development of ARDS remain unclear.This study explored the effect of RRE on apoptosis and proliferation of HFL1 lung fibroblasts, and whether RRE has a mitigating effect on bleomycin-induced pulmonary fibrosis. Our results confirmed that with the increase of RRE concentration, the effect of RRE in promoting HFL1 cell apoptosis and inhibiting its proliferation is more obvious, and the expression of Caspase3 was increased and Bcl-2 was further reduced, and the expression of TGF-β1 and Smad3 was downregulated as well. In subsequent experiments, we found that RRE induced altered cell proliferation, and apoptosis was reversed or relieved by TGF-β1. Further assessment of the role of RRE in animal experimental models showed that the HE staining results indicated that the fibrosis level of the fibrosisrats treated with RRE improved significantly, and the immunohistochemical staining results also showed TGF-β1 and Smad3 levels were reduced by RRE. The above results indicate that TGF-β1 may be one of the pathways by which RRE alleviates pulmonary fibrosis in ARDS.
Conclusions
The results of our animal experiments suggest that TGF-β1 participates in the process of RRE treatment of pulmonary fibrosis. These results also indicated that RRE had a good therapeutic effect on the animal models with ARDS, and the effect was more significant with increased concentration, such as 800 μg/ml, but whether there was a more suitable concentration still needs further study. However, whether RRE has medicinal value for infants and young children and the appropriate concentration still needs to be explored. This study provides an important theoretical basis for the treatment of infants and young children with ARDS.
Authors: J W Ren; K M Chan; Patrick K K Lai; Clara B S Lau; H Yu; P C Leung; K P Fung; Walter F X Yu; C H Cho Journal: Phytother Res Date: 2012-02-23 Impact factor: 5.878
Authors: Jan Máca; Ondřej Jor; Michal Holub; Peter Sklienka; Filip Burša; Michal Burda; Vladimír Janout; Pavel Ševčík Journal: Respir Care Date: 2016-11-01 Impact factor: 2.258
Authors: Qi Zhang; Chi Chun Fong; Wai Kin Yu; Yao Chen; Fan Wei; Chi Man Koon; Kit Man Lau; Ping Chung Leung; Clara Bik San Lau; Kwok Pui Fung; Mengsu Yang Journal: Phytomedicine Date: 2012-10-17 Impact factor: 5.340
Authors: Shivanand S Medar; Sindy Villacres; Shubhi Kaushik; Ruth Eisenberg; Melvin E Stone Journal: J Intensive Care Med Date: 2019-11-11 Impact factor: 3.510
Authors: Lizzy Peix; Iona C Evans; David R Pearce; Juliet K Simpson; Toby M Maher; Robin J McAnulty Journal: Sci Rep Date: 2018-01-30 Impact factor: 4.379
Authors: Leigh R Sweet; Cheryl Keech; Nicola P Klein; Helen S Marshall; Beckie N Tagbo; David Quine; Pawandeep Kaur; Ilia Tikhonov; Muhammad Imran Nisar; Sonali Kochhar; Flor M Muñoz Journal: Vaccine Date: 2017-12-04 Impact factor: 3.641