Evaluation of the efficacy of chlorogenic acid in reducing small intestine injury, oxidative stress, and inflammation in chickens challenged with Clostridium perfringens type A.

The goal of the study was testing the effects of chlorogenic acid (CA) supplementation on small intestine healthiness, growth performance, oxidative stress, inflammatory response, and blood biochemical indices in specific-pathogen-free (SPF) chickens after infection with Clostridium perfringens (CP) type A. In this study, 324 1-day-old male SPF chickens were randomly distributed into 6 groups: control group; CA group; CP infection group; CA + CP group; antibiotic group; antibiotic + CP group. All 1-day-old chickens were fed with CA or antibiotic in corresponding treatment group for 13 d. On the 14 d, the chickens in corresponding infection group were challenged with CP type A for 3 d. Samples in each group were collected when the chickens were 17 and 21 d old. This study proves for the first time that CA, a Chinese herbal medicine, can effectively improve growth performance, inhibit small intestine structural damage, improve antioxidant capacity, inhibit damage to ileal mucosal layer construction and tight junctions, inhibit inflammatory cytokines, and ameliorate blood biochemical indices. Therefore, this study provides data for CA being able to effectively alleviate small intestine damage caused by CP type A infection in chickens.

Introduction

Clostridium perfringens (CP) is one of the main pathogens causing necrotizing enteritis, enterotoxemia, food poisoning, and traumatic gas gangrene in various animal species (Nowell et al., 2010). At present, 12 kinds of toxins have been found in CP, among which a, β, ε, and t are the most lethal (Rood, 1998). In addition, CP can be divided into 5 types: A, B, C, D, and E (Meer and Songer, 1997).

Chickens are very susceptible to CP (Chalmers et al., 2008). In chickens, necrotizing enteritis (necrotic enteritis) is an intestinal infectious disease caused by CP type A (occasionally CP type C) that is characterized by fibrinous necrosis and bleeding in the small intestinal mucosa (Annett et al., 2002; Olkowski et al., 2006). Clostridium perfringens is a common inhabitant in the intestinal tract of normal chickens (McCourt et al., 2005). In normal circumstances, CP lives in the ileum and usually does not cause disease, but when the bowel membrane is damaged or the composition of the intestinal microflora changes, it will multiply and proliferate in the front of the digestive tract, leading to necrotizing enteritis and death (Stanley et al., 2014). Clostridium perfringens is widely found all over the world (Craven et al., 2003; Siragusa et al., 2006; Miller et al., 2010; Zhang et al., 2018a). Clostridium perfringens infection can induce oxidative stress and cause inflammation and serious pathological changes in the intestinal mucosa (Rood et al., 2016; Liu et al., 2018). In chickens, CP type A infections are associated with necrotic enteritis and severe mortality, which causes serious economic losses to the poultry industry; therefore, CP type A has had a serious, negative impact on poultry production over the years (Van Immerseel et al., 2004). With the increasingly stringent use of antibiotics, the incidence of CP type A infections and necrotic enteritis in chickens has been increasing every year, and necrotic enteritis was responsible for annual losses of US $6 billion to the poultry industry in the United States (Li et al., 2017). Therefore, it is necessary to explore the efficacy of various nonantibiotic drugs for the treatment of necrotic enteritis caused by CP type A infections.

Chlorogenic acid (CA), also known as coffee tannic acid, is a polyphenol synthesized through the condensation of caffeic acid and quinic acid (Tajik et al., 2017). Chlorogenic acid is widely found in many plants and Chinese herbal medicines, such as green tea, coffee tea, chrysanthemum, and honeysuckle (Farah et al., 2008; Leiss et al., 2009; Yan et al., 2016; da Silveira et al., 2017). In animals, CA can improve growth performance, immunity, and intestinal barrier functioning by enhancing biological functions such as anti-inflammatory activities, bacteriostasis, antioxidant activities and by regulating lipid metabolism (Chen et al., 2018a, b; Exon et al., 1998). Studies have also showed inhibiting effects of CA on bacteria in vitro, so it might be possible that CA could partly replace antibiotics and hormone drugs (Santana-Galvez et al., 2017). Until now, little information has been available concerning the protective effects of dietary CA supplementation in chickens infected with CP type A in terms of intestinal injury, such as the small intestine structure and inflammation. It is well known that chickens infected with CP often have intestinal inflammation and oxidative stress (Liu et al., 2012). Hence, it is plausible to hypothesize that CA has the potential to improve the intestinal health of infected chickens by alleviating inflammation, enhancing antioxidant abilities, etc.

This study aimed to verify the above hypothesis by evaluating the effects of CA on small intestine injury, antioxidant capacity, changes in tight-junction-related proteins, anti-inflammatory activities, and blood biochemical indices in chickens infected with CP type A.

Materials and methods

Ethics Statement

The use of animals in this study was approved by the Animal Care Committee of South China Agricultural University (approval ID: SYXK-2014-0136).

Strains, Chlorogenic Acid, and Experimental Animals

Clostridium perfringens type A (No. ATCC13124) was purchased from the Guangdong microbial strain Preservation Center. The strain was aseptically inoculated into fluid thioglycollate medium overnight at 37°C in an anaerobic environment before being used for the challenge. Chlorogenic acid was purchased from Beijing Shengtaier Technology Co., Ltd. and supplied in the feed. Enramycin antibiotic (each 1,000 g, containing 0.125 g of 8% enramycin) in feed diets was purchased from Schering-Plough, China. About 324 healthy, 1-day-old male specific-pathogen-free (SPF) White Leghorn chickens with basically the same body weight were bred and purchased from the SPF Experimental Animal Center of Guangdong Dahuanong Animal Health Co., Ltd.

Experimental Design

About 324 1-day-old male SPF chickens were randomly distributed into 6 groups with 9 replicates per group and 6 chickens per replicate. The chickens were reared in an over pressure isolator. The temperature of the isolator was maintained 32°C during the first week, and then, it was reduced 2°C each week until the third week. Chickens were exposed to 23 h of white light a day and 1 h a dark. The specific experimental groups are shown in Table 1. Plastic drinkers and plastic feeders were put in the negative pressure isolators that used for supplying water and feed. All chickens in different groups were allowed liberal feed intake and water every day. The chickens received either a basal diet or a basal diet supplemented with 500 mg/kg CA or a basal diet supplemented with 0.125 g/kg antibiotic before being infected with CP type A. The composition and nutritional level of basal feeding were shown in Table 2. In this study, after 10-fold continuous dilution of the culture medium of CP, the diluent of each dilution gradient was evenly coated on TSC agar medium and anaerobically cultured at 37°C for 24 h. The number of characteristic black presumptive CP colonies was then counted and the concentration of CP in the culture medium was determined to be 108 cfu. A round-tipped animal feeding needle attached to a repeating syringe was used to orally gavage (Fasina et al., 2016) in CP type A–infected chickens, at a dose of 1 × 108 cfu/mL, and at 14 d old, each chicken was fed 3 mL of CP type A for 3 d, whereas chickens were mock-challenged with freshly prepared fluid thioglycollate medium.

Table 1

The experimental groups in this study.

Group	Treatment	Number of chickens	The examined number of chickens
Control group	Basal diet	54	9
CA group	Basal diet and CA (500 mg/kg)	54	9
CP infection group	Basal diet, challenge at 14 d old (1 × 108 cfu/mL, total of 3 mL per chicken)	54	9
CA + CP group	Basal diet and chlorogenic acid, challenge at 14 d old (1 × 108 cfu/mL, total of 3 mL per chicken)	54	9
Antibiotic group	Basal diet and antibiotic (0.125 g/kg)	54	9
Antibiotic + CP group	Basal diet and antibiotic (0.125 g/kg), challenge at 14 d old (1 × 108 cfu/mL, total of 3 mL per chicken)	54	9

Abbreviations: CA, chlorogenic acid; CP, Clostridium perfringens.

Table 2

Ingredient composition and nutrient content of the basal diet (%, as-fed basis).

Ingredient	Proportion (kg)	Nutrient levels2	Content
Corn	59.00	Metabolic energy/(MJ/kg)	12.64
46% Soybean meal	29.50	Crude protein	21.30
Soybean oil IV	2.80	Calcium	0.83
Corn gluten meal	4.50	Available phosphorus	0.34
Calcium hydrogen phosphate	1.30	Lysine	1.15
Limestone	1.20	Methionine	0.47
Sodium chloride	0.30
L-lysine	0.25
Methionine	0.15
1Premix	1.00
Total	100

Premix is provided per kilogram of diet: Mn (MnSO4·H2O) 60 mg; Fe (FeSO4·H2O) 66.5 mg; Zn (ZnSO4·7H2O) 88 mg; Cu (CuSO4·5H2O) 8.8 mg; I (CaI2) 0.7 mg; Se (Na2SeO3) 0.288 mg; VA11 500 IU; VD33 500 IU; VE 30 mg; VK 33 mg; VB1 3.38 mg; VB2 9.00 mg; VB6 8.96 mg; VB12 0.025 mg; choline chloride 800 mg; calcium pantothenate 13 mg; niacin 45 mg; biotin 0.08 mg; folic acid 1.20 mg.

The metabolic energy and available phosphorus were calculated values and others were analyzed values.

Growth Performance

All chickens were weighed daily from day 1 to day 21 of the feeding-challenge trial per treatment group. Daily feed intake was also recorded. The average daily gain (ADG), average daily feed intake (ADFI), feed to gain ratio (F/G), and survival rate were evaluated.

The Histological Observation of the Jejunum and Histomorphological Measurements of the Small Intestine

At 17 and 21 days old, a total of 9 chickens per group were selected with one chicken randomly selected from each replicate. After carotid artery bloodletting, a 1-cm jejunum of 9 chickens in each group was collected to observe the histopathologic changes. Segment from each chicken was cut off, rinsed repeatedly with phosphate buffered saline, fixed in formalin, and used as paraffin embedding to make hematoxylin and eosin staining sections. The intestinal sections were observed using a Nikon Eclipse ci optical microscope and were analyzed and photographed using NIS-Elements F 4.00.00 software. Nine jejunum sections from 9 chickens (one jejunum section/one chicken) in different treatment groups were selected and 5-μm stained sections were observed and analyzed histopathologically.

Ten villi from each histological section were chosen to assess the histological changes. Individual segments of the duodenum, jejunum, and ileum were rinsed with 0.9% of physiological saline and then fixed in 4% paraformaldehyde and embedded in paraffin. The samples were sliced into 5-μm section that was stained with hematoxylin and eosin. Morphometric measurements were performed at a 40× magnification using a light microscope. The criterion for villus section was the presence of intact lamina propria. Villus length was measured from the tip of the villus to the villus–crypt junction, whereas crypt depth was defined as the depth of the invagination between adjacent villi (Awad et al., 2009). The ratio of villus length to crypt depth was calculated, and the average value was taken as the final measured value.

Detection of Blood Biochemical Indices and Serum Antioxidant Indexes

Venous blood from 9 chickens per treatment group was collected at 17 and 21 d old and was placed in a water bath at 37°C for 30 min without anticoagulant treatment. The serum was isolated after 2,000 r/min centrifugation for 10 min (after agglutination). Serum biochemical indices, including blood glucose, triglycerides, total cholesterol, high-density cholesterol, low-density cholesterol, total proteins, albumin, and globulin, were measured with a Mindray BS-5800M automatic biochemical analyzer.

Venous blood samples from 9 chickens per treatment group were collected at 17 and 21 d old. The collected venous blood was placed in a water bath at 37°C for 30 min without anticoagulant treatment, and the serum was isolated after 2,000 r/min centrifugation for 10 min (after agglutination). The kits used for the determination of total antioxidant capacity, Glutathione peroxidase, superoxide dismutase, and malondialdehyde were purchased from the Nanjing Jiancheng company (Nanjing, China). The procedures were performed in accordance with the instructions in the different kits.

Detection of Ileum Immune-Related Cytokines, the Ileum Mucosal Layer Structure, and Tight-Junction–Related Factors Using Quantitative Real-Time PCR (RT-qPCR)

Nine chickens from each group were randomly selected and euthanized by cranial stunning immediately followed by cervical dislocation before necropsy. In an aseptic environment, a segment of ileum was cut off and put into a 2-mL grinding tube containing 1 mL TRIzol (Invitrogen, Carlsbad, CA). Total RNA was extracted from the ileum epithelium samples with TRIzol (Invitrogen, Carlsbad, CA). The purity and concentration of the total RNA were measured in a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific Co., Waltham, MA) using the 260/280 nm absorbance ratio and then a 1.0 μg RNA of each sample was reverse-transcribed into cDNA using the RecerTra Ace qPCR RT Master Mix with gDNA remover (TOYOBO Co., Ltd. Life Science Department, OSAKA, Japan), and the cDNA was stored at −20°C. Quantitative real-time PCR (RT-qPCR) was performed in duplicate reactions including 1.5 μL nuclease-free water, 1 μL of each forward and reverse primers of each gene (5 μmol/L), 1.5 μL cDNA (1:20 dilution) and 5 μL SYBR Premix Ex Taq II kit (Thermo Fisher Scientific Co., Waltham, MA), as a detector on an CFX96 Touch real-time PCR detection system (Bio-Rad Laboratories, Mississauga, ON, Canada). In accordance with the sequences published in GenBank, the primers for the ileum mucosal layer structure and the tight-junction–related factors, and ileum inflammation–related cytokines were designed using Primer Express 3.0 (Applied Biosystems) for RT-qPCR detection and are shown in Table 3. Each sample was analyzed in triplicate under the following PCR conditions: initial denaturation at 95°C for 3 min, followed by 40 cycles at 95°C for 5 s and at 60°C for 30 s; specificity of the PCR products was evaluated by the analysis of the melting curve; GAPDH as an internal reference gene; the relative expression of each gene was calculated using 2−△△Ct (Livak and Schmittgen, 2001).

Table 3

Primers for RT-qPCR detection of ileum mucosal barrier related indexes and inflammation-related cytokines.

Gene names	Primers	Accession no.
ZO-1	F: TATGAAGATCGTGCGCCTCCR: TGCCGGATAATAGCTGCGTT	Accession: XM_015278981
Claudin-3	F: CTATGGGGCTGGAGATCGGTR: ATGTTGTTGCCGATGAAGGC	Accession: NM_204202
TFF2	F: CTGCTTCAATGCGTCGGTGR: AGGGTAGCCACAGTTCACTC	Accession: XM_416743
MUC2	F: ATGCCCTTGCGTCCATAACAR: AGGAGCAGTGTCCGTCAAAG	Accession: NM_002457
IFN-γ	F: GATGCCACCTTCTCTCACGAR: GGATGTCGTGGGTGGTTTTG	Accession: NM_205427
IFN-β	F: CAGCCCACACACTCCAAAACR: ACGAAGCATTGCTCAAGGTG	Accession: NM_001024836
IL-1	F: CCCGCTTCATCTTCTACCGCR: GCTTGTAGGTGGCGATGTTG	Accession: NM_204524
IL-17A	F: CTCTGACCCTGCCTCTAGGAR: CTGTGTGATGGGGACGGAAT	Accession: XM_426223
IL-22	F: CATCAGGGAGAACAACCGCTR: TGCCACATCCTCAGCATACG	Accession: XM_025147965
TNF-α	F: TGTATGTGCAGCAACCCGTAR: CCACACGACAGCCAAGTCAA	Accession: NM_204267
GAPDH	F: AGGCTGAGAACGGGAAACTTGR: CACCTGCATCTGCCCATTTG	Accession: NM_204305

Statistical Analysis

The individual chicken was considered as the experimental unit for all measures, with 9 replicate individuals per treatment group. Statistical analysis was conducted using SPSS. The normality of residuals was verified using liner regression procedure. Growth performance was analyzed by one-way ANOVA. Histomorphological measurements, blood biochemical indices, serum antioxidant indexes, inflammation-related cytokines, mucosal layer structure, and tight-junction–related factors were analyzed by 2-way ANOVA to determine the main effects (stage and treatment) and their interaction using the generalized linear model procedure as a 2 × 6 factorial arranged treatment. Survival rate was analyzed by the nonparametric Kruskal-Wallis test, as the data were not normally distributed. When interactions were significant (P < 0.05), differences between means were determined using least significant difference. The results were presented as the means and SEMs.

Results

CA Improved the Growth Performance in SPF Chickens After CP Type A Infection

Effect of adding CA on the growth performance in SPF chickens after CP type A infection is shown in Table 4. At day 1 to 14, 14 to 17, 17 to 21, and the overall period of 1 to 21 d, compared with the control group, ADG in the CA group were significantly increased (P < 0.05). Besides, the ADFI and F/G in the CA group were significantly lower than that in the control group at day 17 to 21 and day 1 to 21 (P < 0.05). Compared with the control group, ADG in the CP group was significantly decreased at day 1 to 14, 14 to 17, 17 to 21, and 1 to 21. F/G in the CP group was significantly higher than that in the control group at day 1 to 14, 14 to 17, 17 to 21, and 1 to 21 (P < 0.05). Furthermore, the ADG was significantly higher in the CA + CP group than in the CP group (P < 0.05), whereas F/G was lower in the CA + CP group than in the CP group at day 1 to 14, 14 to 17, 17 to 21, and 1 to 21 (P < 0.05). The survival rate of chickens in CA + CP group was reached to 100% from 1 to 21 d old.

Table 4

Effects of different treatments on growth performance of SPF chickens.

Stage	Indicator	Control	CP	CA	CA + CP	AB	AB + CP	SEM	P-value
Day 1–14	ADG(g)	4.98c	4.36d	5.35a	5.10b	5.27a	5.13b	0.057	<0.001
	ADFI(g)	8.38b	8.43b	8.40b	8.22c	8.77a	8.41b	0.051	<0.001
	F/G	1.68b	1.93a	1.57c	1.61c	1.66b,c	1.64b,c	0.030	<0.001
	Survival rate (%)	100	94	100	100	100	100	1.000	0.416
Day 14–17	ADG(g)	9.38d	9.04e	9.77a	9.53c	9.72b	9.49c	0.022	<0.001
	ADFI(g)	20.09a,b	20.15a,b	19.81b	19.75b	20.36a	20.09a,b	0.222	0.114
	F/G	2.14b	2.23a	2.03c	2.07c	2.09b,c	2.12b,c	0.024	<0.001
	Survival rate (%)	100	98	100	100	100	100	0.333	0.416
Day 17–21	ADG(g)	12.04c	9.97f	12.36a	11.81d	12.11b	10.77e	0.016	<0.001
	ADFI(g)	27.04a	24.74b,c	24.26c	23.90c	24.25c	24.89b	0.259	<0.001
	F/G	2.26c	2.48a	1.97e	2.03d	1.99d,e	2.32b	0.027	<0.001
	Survival rate (%)	100	98	100	100	100	100	0.043	0.416
Day 1–21	ADG(g)	6.95c	6.10e	7.32a	7.01c	7.21b	6.83d	0.039	<0.001
	ADFI(g)	13.61a	13.21c	13.05e	12.85d	13.37b	13.22c	0.070	<0.001
	F/G	1.96b	2.17a	1.78d	1.83c	1.86c	1.94b	0.020	<0.001
	Survival rate (%)	100	92	100	100	100	100	1.333	0.416

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; ADFI, average daily feed intake (g/head/d); ADG, average daily gain (g/head/d); CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, Clostridium perfringens group; F/G, feed to gain ratio; specific-pathogen-free; SR, survival rate.

CA Minimized the Pathological Injury to the Jejunum Structure in SPF Chickens After CP Type A Infection

Histopathological sections were performed to analyze the jejunum structure injury caused by CP type A infection and to verify whether CA could inhibit injury. A jejunum histopathology analysis showed that at 17 d of age, the epithelial cells in the jejunum mucosa of the SPF chickens infected with CP type A were exfoliated, and the villi were both damaged and exfoliated. At 21 d of age, the jejunum of CP type A infection group showed mucosal epithelial cells were degenerated and shed, and the villi were severely damaged and shed. However, there was no injury in the jejunum of the examined 20 SPF chickens (17 and 21 d old) that were fed CA and infected with CP type A, whereas there was slight exfoliation of mucosal epithelial cells in the jejunum of the group fed with antibiotics and infected with CP type A, indicating that CA could minimize the pathological injury to the jejunum caused by CP type A infection (Figure 1).

Figure 1

The addition of chlorogenic acid alleviated jejunum histopathological changes caused by CP type A infection in the jejunum of 17- and 21-day-old SPF chickens. The histological features of the jejunum mucosa in the control group, CP infection group, CA group, CA plus CP infection group (CA + CP), antibiotic group, and antibiotic plus CP group (antibiotic + CP) are shown together with the hematoxylin and eosin staining of 17- and 21-day-old SPF chickens. For histological observation, images at a lower magnification (100×) are provided. n = 9 chickens/group. Abbreviations: CA, chlorogenic acid; CP, Clostridium perfringens; SPF, specific-pathogen-free.

CA Protected the Small Intestine Morphology of SPF Chickens After CP Type A Infection

As shown in Table 5, the villus length of the duodenum and ileum at day 17 was significantly higher than that at day 21 (P < 0.05); furthermore, the villus length and villus length/crypt depth of the jejunum at day 21 was significantly higher than that at day 17 (P < 0.05). The villus length, villus length/crypt depth of the duodenum and jejunum in the CA treatment group were significantly higher than that in other treatment groups (P < 0.05). The villus length and length/crypt depth of the duodenum, jejunum, and ileum in the CP group were significantly lower than that in the control group (P < 0.05), whereas the crypt depth of the duodenum, jejunum, and ileum was significantly higher than that in the control group (P < 0.05). Furthermore, the villus length and villus length/crypt depth of the CA + CP group were significantly higher than that in the CP group and AB + CP group, respectively (P < 0.05). The effect of interaction (P < 0.05) between stage and treatments was found in the crypt depth and villus length/crypt depth of the duodenum and jejunum, also was found in villus length of the duodenum and villus length/crypt depth of the ileum. These results indicated that the addition of CA minimized small intestine structure injury in chickens after CP type A infection.

Table 5

The addition of chlorogenic acid protected small intestine morphology damaged by Clostridium perfringens type A infection in 17- and 21-day-old SPF chickens.

Interaction	Treatments	Duodenum villus length (μmol/L)	Duodenum crypt depth (μmol/L)	Duodenum villus length/crypt depth	Jejunum villus length (μmol/L)	Jejunum crypt depth (μmol/L)	Jejunum villus length/crypt depth	Ileum villus length (μmol/L)	Ileum crypt depth (μmol/L)	Ileum villus length/crypt depth	Lesion score
Day 17	Control	1,216.97b	86.06c	13.76c	476.68d	59.48b,c	8.77c	532.60b	56.78b	9.05c	0.00i
	CP	1,099.33c	171.24a	6.77e	426.44e	67.72a	6.41e	456.07c	62.32a	7.44d	2.50a
	CA	1,334.01a	78.88c	19.32a,b	560.83b,c	42.57e	12.63a	598.97a	45.83d	11.64a	0.23g
	CA + CP	1,245.07b	82.91c	14.14c	529.17c	56.73c	9.56b	539.42b	47.96c,d	10.83a,b	0.33f
	AB	1,191.25b,c	85.33c	14.15c	471.05d,e	60.02b,c	7.90d	527.75b	59.47a,b	8.90c,d	0.77d
	AB + CP	1,079.08c	89.20c	12.35c,d	455.73d,e	60.52b,c	7.59d,e	518.30b	58.64a,b	8.89c,d	0.83c
Day 21	Control	1,098.12c	84.82c	13.59c	552.81b,c	59.53b,c	9.79b	412.83d	49.71c,d	8.38c,d	0.00i
	CP	968.81d	103.08b	10.22d	464.41d,e	70.27a	6.87e	327.98e	57.31b	5.21e	1.50b
	CA	1,412.31a	65.08d	21.09a	676.60a	51.08d	12.57a	513.72b	41.81d,e	10.64b	0.12h
	CA + CP	1,109.88c	60.38d	17.41b	579.27b	49.53d	12.88a	444.70c,d	40.33e	10.34b	0.13h
	AB	1,124.52c	85.42c	13.19c	545.77b,c	57.25c	9.64b	421.15c,d	49.77c,d	8.47c,d	0.33f
	AB + CP	1,071.85c	86.24c	12.81c	545.26b,c	63.15b	8.67c,d	413.59d	50.53c	8.21d	0.37e
SEM		19.598	4.418	0.797	15.860	1.502	0.272	12.242	1.511	0.285	0.012
Stage
Day 17		1,200.02a	98.94a	13.42b	486.65b	57.84	8.81b	528.85a	55.17a	9.46a	0.78a
Day 21		1,130.92b	80.84b	14.72a	560.69a	58.47	10.07a	422.33b	48.24b	8.54b	0.40b
SEM		8.001	1.804	0.326	6.475	0.613	0.111	4.998	0.617	0.116	0.005
Treatments
Control		1,157.33b	85.44b	13.68c	514.74c	59.50b,c	9.28c	472.72b,c	53.24b	8.72b	0.00f
CP		1,034.15d	137.16a	8.50d	445.42d	69.00a	6.64e	392.02d	59.82a	6.32c	2.00a
CA		1,390.08a	71.98c	20.20a	618.72a	46.82e	12.60a	556.34a	43.82c	11.14a	0.16e
CA + CP		1,177.53b	71.64c	15.78b	554.22b	53.13d	11.22b	492.06b	44.14c	10.58a	0.23d
AB		1,157.84b	85.38b	13.67c	508.41c	58.64c	8.77c	474.45b,c	54.62b	8.68b	0.55c
AB + CP		1,075.87c	87.72b	12.58c	500.50c	61.84b	8.13d	465.94c	54.58b	8.55b	0.60b
SEM		13.858	3.124	0.564	11.215	1.062	0.192	8.657	1.069	0.201	0.009
P-values
Stage		<0.001	<0.001	0.008	<0.001	0.473	<0.001	<0.001	<0.001	<0.001	<0.001
Treatments		<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001
Stage × Treatments		<0.001	<0.001	0.040	0.204	<0.001	<0.001	0.541	0.460	0.031	<0.001

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, Clostridium perfringens group; SPF, specific-pathogen-free.

CA Improved the Antioxidant Capacity of SPF Chickens After CP Type A Infection

As shown in Table 6, the total serum antioxidant capacity, serum glutathione peroxidase, and the content of serum malondialdehyde at day 21 were significantly higher than that at day 17 (P < 0.05). The total serum antioxidant capacity, serum superoxide dismutase, and serum glutathione peroxidase in the CA treatment group were significantly higher than that in other treatment groups (P < 0.05); however, serum malondialdehyde in the CA treatment group was significantly lower than that in other treatment groups (P < 0.05). The total serum antioxidant capacity, serum superoxide dismutase, and serum glutathione peroxidase in the CP group were significantly lower than that in the control group (P < 0.05), whereas the serum malondialdehyde in the CP group was significantly higher than that in the control group (P < 0.05). Furthermore, the total serum antioxidant capacity, serum superoxide dismutase, and serum glutathione peroxidase in the CA + CP group were significantly higher than that in CP group and AB + CP group (P < 0.05), whereas serum malondialdehyde in the CA + CP group was significantly lower than that in the CP group and AB + CP group (P < 0.05). The effect of interaction (P < 0.05) between stage and treatments was found in total serum antioxidant capacity, serum glutathione peroxidase, and serum malondialdehyde. These results indicated that the addition of CA improved the antioxidant capacity of SPF chickens after CP type A infection.

Table 6

The addition of chlorogenic acid improved the antioxidant capacity affected by Clostridium perfringens type A infection in 17-and 21-day-old SPF chickens.

Interaction	Treatments	Total antioxidant capacity (mmol/L)	Superoxide dismutase (U/mL)	Glutathione peroxidase (μmol/L)	Malondialdehyde (nmol/mL)
Day 17	Control	6.56d	67.44c	1,024.90d	18.15d
	CP	3.32e	59.31d	800.29e	28.22a
	CA	10.77b	78.56a	1,319.53b	12.69e
	CA + CP	7.44d	69.88b,c	1,191.34c	16.81d
	AB	6.60d	66.42c,d	1,017.16d	18.70c,d
	AB + CP	6.36d	66.77c	1,049.87d	18.37d
Day 21	Control	9.83b,c	66.91c	1,140.70c,d	23.63b
	CP	1.66f	59.15d	570.73f	30.06a
	CA	19.20a	79.46a	1,533.56a	13.80e
	CA + CP	9.68b,c	73.60b	1,351.62b	21.01c
	AB	9.74b,c	64.16c,d	1,083.82c,d	23.50b
	AB + CP	8.96c	61.90d	1,040.70d	25.77b
SEM		0.472	1.642	39.716	0.825
Stage
Day 17		6.84b	68.06	1,067.18b	18.82b
Day 21		9.84a	67.53	1,120.19a	22.96a
SEM		0.193	0.670	16.214	0.337
Treatments
Control		8.20b	67.18c	1,082.80c	20.89b
CP		2.49c	59.23d	685.51d	29.14a
CA		14.98a	79.01a	1,426.54a	13.24d
CA + CP		8.56b	71.74b	1,271.48b	18.91c
AB		8.17b	65.29c	1,050.49c	21.10b
AB + CP		7.66b	64.34c	1,045.28c	22.07b
SEM		0.334	1.161	28.083	0.584
P-values
Stage		<0.001	0.577	0.027	<0.001
Treatments		<0.001	<0.001	<0.001	<0.001
Stage × Treatments		<0.001	0.196	<0.001	0.005

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, Clostridium perfringens group; SPF, specific-pathogen-free.

CA Inhibited Damage to the Ileal Mucosal Layer Construction and Tight Junctions of SPF Chickens After CP Type A Infection

As shown in Table 7, the mRNA expression of Claudin-3 and ZO-1 at day 17 was significantly higher than that at day 21 (P < 0.05). The mRNA expression of Claudin-3, MUC-2, TFF-2, and ZO-1 in the CP group was significantly lower than that in the control group (P < 0.05). The mRNA expression of Claudin-3 and ZO-1 in the CA + CP group was significantly higher than that in the CP group (P < 0.05). Furthermore, the mRNA expression of ZO-1 in the CA + CP group was significantly higher than that in the AB + CP group (P < 0.05). Besides, the mRNA expression of TFF-2 in the CA + CP group was significantly higher than that in the CP group (P < 0.05). Moreover, the mRNA expression of MUC-2 in the CA group was significantly higher than that in the AB group (P < 0.05). The effect of interaction (P < 0.05) between stage and treatments was found in Claudin-3 and ZO-1. These results indicated that the addition of CA inhibited damage to the ileal mucosal layer construction and tight junctions of SPF chickens after CP type A infection.

Table 7

The addition of CA affected the mRNA expression levels of TFF2, MUC2, ZO-1, and Claudin-3 in the ileal epithelial cells of 17- and 21-day-old SPF chickens, which had been affected by CP type A infection (as found by RT-qPCR).

Interaction	Treatments	Claudin-3	MUC-2	TFF-2	ZO-1
Day 17	Control	1.00a,b	1.02a,b	0.99a,b	1.00a,b
	CP	0.95a,b	0.51e	0.51c	0.59c
	CA	1.00a,b	1.05a,b	0.95a,b	1.05a
	CA + CP	0.99a,b	0.92b,c	0.89b	1.04a
	AB	0.99a,b	0.98b	0.99a,b	0.99a,b
	AB + CP	0.93b	0.83c	0.81b	0.97a,b
Day 21	Control	0.99a,b	0.99b	1.00a	1.03a
	CP	0.63c	0.70d	0.49c	0.14d
	CA	1.03a	1.11a	0.95a,b	0.99a,b
	CA + CP	0.93b	0.98b	0.88b	1.06a
	AB	1.02a	0.98b	1.01a	0.99a,b
	AB + CP	1.00a,b	0.86c	0.87b	0.91b
SEM		0.03	0.037	0.037	0.04
Stage
Day 17		0.98a	0.88b	0.86	0.94a
Day 21		0.93b	0.94a	0.87	0.85b
SEM		0.012	0.015	0.015	0.016
Treatments
Control		1.00a	1.00a,b	1.00a	1.02a,b
CP		0.79b	0.60d	0.50c	0.36c
CA		1.02a	1.08a	0.95a,b	1.02a,b
CA + CP		0.96a	0.95b	0.88b	1.05a
AB		1.00a	0.98b	1.00a	0.99a,b
AB + CP		0.96a	0.84c	0.84b	0.94b
SEM		0.021	0.026	0.026	0.028
P-values
Stage		0.017	0.021	0.639	0.001
Treatments		<0.001	<0.001	<0.001	<0.001
Stage × Treatments		<0.001	0.088	0.910	<0.001

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, Clostridium perfringens group; SPF, specific-pathogen-free.

CA Alleviated the Inflammatory Response in the Ileum of SPF Chickens After CP Type A Infection by Inhibiting the mRNA Expression of the Proinflammatory Cytokines IFN-β, IFN-γ, IL-1, IL-17A, IL-22, and TNF-α

As shown in Table 8, the mRNA expression of IFN-β and IFN-γ at day 17 was significantly higher than that at day 21 (P < 0.05), the mRNA expression of IL-22 at day 21 was significantly higher than that at day 17 (P < 0.05). Furthermore, the mRNA expression of the proinflammatory cytokines IFN-β, IFN-γ, IL-1, IL-17A, IL-22, and TNF-α in the CP group was significantly higher than that in the control group; however, the adding of CA in the CP group could significantly decrease the mRNA expression of the IFN-β, IFN-γ, IL-1, IL-17A, IL-22, and TNF-α compared with the CP group (P < 0.05). Besides, the mRNA expression of IFN-β, IFN-γ, IL-22, and TNF-α in the CA + CP group was significantly lower than that in the AB + CP group (P < 0.05). The effect of interaction (P < 0.05) between stage and treatments was found in the proinflammatory cytokines IFN-β, IFN-γ, IL-1, IL-17A, IL-22, and TNF-α. These results indicated that the addition of CA alleviated the inflammatory response in the ileum of SPF chickens after CP type A infection.

Table 8

The addition of CA alleviated the inflammatory response induced by CP type A infection in 17- and 21-day-old SPF chickens by inhibiting the mRNA expression of the proinflammatory cytokines IFN-β, IFN-γ, IL-1, IL-17A, IL-22, and TFN-a in the ileal epithelial cells (as found by RT-qPCR).

Interaction	Treatments	IFN-β	IFN-γ	IL-1	IL-22	IL-17A	TNF-α
Day 17	Control	1.00e	1.00e	0.98f	0.98d	1.01c	0.99e
	CP	2.90a	2.94a	1.58d	2.12b	2.35a	1.47c
	CA	1.01e	0.99e	0.97f	1.00d	1.02c	0.98e
	CA + CP	1.81d	1.25d	1.67c	0.96d	0.99c,d	1.07d
	AB	1.01e	1.02e	1.02f	1.00d	0.99c,d	1.01d,e
	AB + CP	2.10c	2.10c	1.85b	1.36c	0.94d	2.03b
Day 21	Control	1.00e	0.99e	0.99f	1.00d	1.01c	1.00d,e
	CP	2.51b	2.22b	2.77a	2.84a	2.23b	2.70a
	CA	0.99e	1.02e	0.98f	0.96d	0.98c,d	0.98e
	CA + CP	1.06e	1.01e	1.12e	0.99d	1.00c,d	1.02d,e
	AB	0.99e	0.98e	0.99f	0.98d	1.01c	1.02d,e
	AB + CP	1.04e	1.02e	1.02f	1.06d	1.01c	0.99e
SEM		0.036	0.033	0.031	0.048	0.024	0.025
Stage
Day 17		1.64a	1.55a	1.34	1.24b	1.22	1.26
Day 21		1.26b	1.21b	1.31	1.30a	1.21	1.28
SEM		0.015	0.014	0.013	0.019	0.010	0.01
Treatments
Control		1.00d	1.00d	0.98c	0.99c	1.01b	1.00c,d
CP		2.70a	2.58a	2.18a	2.48a	2.29a	2.08a
CA		1.00d	1.01d	0.98c	0.98c	1.00b	0.98d
CA + CP		1.44c	1.13c	1.40b	0.98c	1.00b	1.04c
AB		1.00d	1.00d	1.00c	0.99c	1.00b	1.02c,d
AB + CP		1.57b	1.56b	1.44b	1.21b	0.98b	1.51b
SEM		0.026	0.024	0.022	0.034	0.017	0.018
P-values
Stage		<0.001	<0.001	0.071	0.02	0.474	0.073
Treatments		<0.001	<0.001	<0.001	<0.001	<0.001	<0.001
Stage × Treatments		<0.001	<0.001	<0.001	<0.001	0.009	<0.001

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, Clostridium perfringens group; SPF, specific-pathogen-free.

CA Affected Blood Biochemical Indices that Had Been Affected by the CP Type A Infection Including Blood Glucose and Triglyceride, Whereas Did Not Affect Total Cholesterol, Density Cholesterol, Low-Density Cholesterol, Total Protein, Albumin, and Globulin

As shown in Table 9, the triglyceride, total cholesterol, high-density cholesterol, total proteins, albumin, globulin, and albumin/globulin at day 21 was significantly higher than that at day 17 (P < 0.05). The blood glucose and triglyceride in the CP group were significantly lower than that in the control group (P < 0.05); however, the adding of CA in the CP group could significantly increase the blood glucose and triglyceride compared with the CP group (P < 0.05). Clostridium perfringens type A infection had no significant effect on total cholesterol, high-density cholesterol, low-density cholesterol, total protein, albumin, and globulin (P > 0.05). Similarly, the adding of CA in the CP group could not significantly affect the total cholesterol, high-density cholesterol, low-density cholesterol, total protein, albumin, and globulin (P > 0.05). The effect of interaction (P < 0.05) between stage and treatments was found in blood glucose and triglyceride. These results indicated that the addition of CA affected blood biochemical indices that had been affected by the CP type A infection including blood glucose and triglyceride.

Table 9

The addition of chlorogenic acid inhibited injury in 17- and 21-day-old SPF chickens infected with Clostridium perfringens type A by affecting blood biochemical indices (as found by RT-qPCR).

Interaction	Treatments	Glucose	Triglyceride	Total cholesterol	High-density cholesterol	Low-density cholesterol	Total proteins	Albumin	Globulin	Albumin/Globulin
Day 17	Control	11.23a,b	1.21d	19.64b	2.09b,c	1.26a	19.64b	11.20c	11.62b	0.97b,c
	CP	9.01c	1.23d	19.92b	2.00c	1.22a,b	19.92b	11.96b,c	12.04b	0.99b,c
	CA	11.20a,b	1.28d	19.70b	2.14b,c	1.23a,b	19.70b	11.64b,c	11.76b	0.99b,c
	CA + CP	10.35b	1.25d	19.91b	2.11b,c	1.22a,b	19.91b	12.24b	12.00b	1.02a,b
	AB	11.01a,b	1.23d	19.54b	2.20b	1.28a	19.54b	11.52c	12.04b	0.96b,c
	AB + CP	9.32c	1.09e	17.36c	1.87c	1.09b	17.36c	10.46d	10.46c	0.88c
Day 21	Control	11.24a,b	2.13b	20.44a,b	2.43a	1.23a,b	20.44a,b	12.66a,b	12.62a,b	1.00b
	CP	8.03d	1.78c	19.98b	2.49a	1.26a	19.98a,b	13.10a	12.08b	1.09a
	CA	10.54b	2.25a	20.40a,b	2.52a	1.23a,b	20.40a,b	12.72a,b	12.40a,b	1.03a,b
	CA + CP	11.41a	2.19a,b	20.58a	2.44a	1.24a,b	20.58a	12.96a	12.78a	1.02a,b
	AB	10.77b	2.17a,b	20.02a,b	2.48a	1.27a	20.02a,b	12.66a,b	12.10b	1.05a,b
	AB + CP	9.29c	1.85c	17.83c	2.17b	1.10b	17.83c	11.29c	10.98c	0.91c
SEM		0.205	0.030	0.208	0.049	0.027	0.227	0.245	0.189	0.029
Stage
Day 17		10.35	1.22b	19.34b	2.07b	1.22	19.34b	11.50b	11.65b	0.97b
Day 21		10.21	2.06a	19.88a	2.42a	1.22	19.88a	12.56a	12.16a	1.02a
SEM		0.084	0.012	0.085	0.020	0.011	0.093	0.100	0.077	0.012
Treatments
Control		11.24a	1.67b	20.04a,b	2.26a	1.24a	20.04a,b	11.93b	12.12a	0.98a
CP		8.52c	1.50c	19.95a,b	2.24a	1.24a	19.95a,b	12.53a,b	12.06a	1.04a
CA		10.87a	1.76a	20.05a,b	2.33a	1.23a	20.05a,b	12.18a,b	12.08a	1.01a
CA + CP		10.88a	1.72a,b	20.24a	2.28a	1.23a	20.24a	12.60a	12.39a	1.02a
AB		10.89a	1.70b	19.78b	2.34a	1.28a	19.78b	12.09b	12.07a	1.00a
AB + CP		9.30b	1.47c	17.60c	2.02b	1.10b	17.60c	10.88c	10.72b	0.90b
SEM		0.145	0.021	0.147	0.035	0.019	0.160	0.173	0.133	0.020
P-values
Stage		0.245	<0.001	<0.001	<0.001	0.747	<0.001	<0.001	<0.001	0.006
Treatments		<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001	<0.001
Stage × Treatments		<0.001	<0.001	0.555	0.345	0.835	0.643	0.724	0.086	0.494

In the same line, the same letter superscripts mean no significant difference (P > 0.05), and the different letter superscripts mean significant difference (P < 0.05).

Abbreviations: AB, antibiotic group; AB + CP, antibiotic + C. perfringens group; CA, chlorogenic acid group; CA + CP, chlorogenic acid + C. perfringens group; CP, C. perfringens group; SPF, specific-pathogen-free.

Discussion

In this study, CA was chosen to test its effect on CP type A infection in chickens. Production performance measured as ADG was improved, whereas ADFI and F/G were decreased by adding CA in the CP infection group compared with the CP infection group at the overall period of 1 to 21 d. Small intestine structural was damaged by CP infection, while dietary CA could inhibit this damage. Besides, CA could improve antioxidant capacity, inhibit damage to ileal mucosal layer structure and tight -junction–related factors, inhibit inflammatory cytokines, and ameliorate blood biochemical indices that had been affected by CP type A infection in chickens. These results indicate a beneficial effect on reducing negative effects of CP infection which causing necrotic enteritis in chickens.

Chlorogenic acid is present in various plants and Chinese herbal medicines and has been proved to improve the production performance of animals under different treatment conditions. Study showed that CA had positive effect on growth performance of Litopenaeus vannamei under normal and stress conditions (Wang et al., 2015). Dietary CA could improve growth performance of weaned pigs through maintain intestinal digestion and absorption function (Chen et al., 2018b). In 2019, researchers showed that dietary CA-enriched extract supplementation could alleviate the adverse effects of heat stress on growth performance and improve oxidative stability and fatty acid profile of breast meat in heat-stressed broilers (Zhao et al., 2019a). So far, it has not been reported that dietary CA can improve the production performance of chickens infected with CP. Hence, this study reveals for the first time that dietary CA could reduce F/G, while increasing the survival rate that had been affected by CP type A infection. This may be because CA not only could improve the function of enhancing the intestinal barrier and immune function, but also could improve the ability to digest and absorb nutrients in chickens infected with CP.

A study showed that CA could attenuate cadmium-induced intestinal injury in Sprague-Dawley rats (Xue et al., 2019). Another study showed that dietary CA supplementation can affect gut morphology in weaned piglets (Zhang et al., 2018b); however, whether dietary CA supplementation has the similar effect, such on improving the intestine morphology in chickens, was unknown. Previous study has been reported that in broiler chickens infected with CP, the jejunal villi lamina propria was increased and severely congested, and the inflammatory reaction was dramatic in the lamina propria and included the infiltration of heterophilic granulocytes and lymphocytes (Zhao et al., 2019b). Subclinical CP infection in chickens also manifests as macroscopic lesions in the small intestine (Van Immerseel et al., 2004). Similarly, in this study, CP type A infection could cause serious pathological changes in the jejunum of infected chickens, causing degeneration and exfoliation in the mucosal epithelial cells at 17 and 21 d old. The villus length and crypt depth are considered to be important parameters in evaluating intestinal health and recovery (Zhao et al., 2019b). Shorter villi and a deeper crypt may lead to decreased resistance to disease, lower growth performance, poor nutrient absorption, and increased secretion in the gastrointestinal tract (Mohammadagheri et al., 2016). The present study showed that CA can alleviate the intestine injury caused by CP type A infection in chickens by decreasing crypt depth while increasing villus length and villus length/crypt depth of the jejunum, ileal, and duodenum. These results indicate that CA can protect the small intestine structure from the damage caused by CP type A infection.

Studies have shown that CA has good antioxidative stress effects: CA protects against liver fibrosis in vivo and in vitro through the inhibition of oxidative stress (Shi et al., 2016); it can protect against injury to the liver and kidneys induced by D-galactose via antioxidation and anti-inflammatory effects (in mice) (Feng et al., 2016); and it can relieve oxidative stress injury in retinal ganglion cells through IncRNA-TUG1/Nrf2 (Gong et al., 2019). However, it is unknown whether CA can alleviate the oxidative stress induced by CP type A infection. This study showed that CA can effectively alleviate the oxidative stress caused by CP type A infection by increasing serum antioxidant capacity, superoxide dismutase activity, glutathione peroxidase activity, and inhibiting malondialdehyde content. In addition, this study found that dietary CA has good antioxidant effects, indicating that it is a good feed additive.

In intestinal epithelial cells, tight junction proteins play an important role in the intestinal mucosal barrier, and damage to these proteins will lead to an increase in cell-to-cell permeability (Chasiotis et al., 2012). Chlorogenic acid has been reported to have the effect on decreasing intestinal permeability and increasing expression of intestinal tight junction proteins in weaned rats challenged with LPS (Ruan et al., 2014), improving intestinal barrier functions by suppressing mucosa inflammation and improving antioxidant capacity in weaned pigs (Chen et al., 2018a). However, it is unknown whether CA can inhibit damage to the ileal mucosal layer construction and tight junctions of SPF chickens after CP type A infection. Previous study showed that CP infection affects the ileal gene expression of Claudin-1, Occluding, and Mucin-2 in broilers (Du et al., 2016); the results of our study first shed light on the effects of CA on repairing the ileal tight junction through increasing the mRNA level of Claudin-3, MUC-2, TFF-2, and ZO-1 of chickens infected with CP type A.

Cytokines play an important role in the immune response. During the occurrence of a disease, the expression of proinflammatory cytokines in the body is abnormal, resulting in low immune functioning and/or pathological damage (Yockey and Iwasaki, 2018). Studies have shown that oxidative stress can cause inflammation (Hald and Lotharius, 2005); besides, bacteria can enter the portal vein and lymphatic system through the damaged intestinal mucosa, and even cause systemic inflammation in severe cases (Gosain and Gamelli, 2005). Because we have proven that CP type A infection can induce oxidative stress and damage the intestinal mucosa, we speculated that CP type A infection has the effect on inducing proinflammatory cytokines. Our results supported our hypothesis that CP type A infection could induce an increase in proinflammatory factors in intestinal epithelial cells, including IL-1, IL-17A, IL-22, INF-β, IFN-γ, and TNF-α. Furthermore, we found that dietary CA could significantly inhibit the expression of these proinflammatory cytokines in ileal epithelia; this is consistent with the conclusions of other studies that CA has good anti-inflammatory effects (dos Santos et al., 2006; Hwang et al., 2014). Our results may lead to new ideas for the treatment of inflammation induced by CP infection in chickens.

Serum biochemical indices generally include blood glucose, liver function indicators, kidney function indicators, and other indices: changes in various components in sera can help determine the health status of a body, which is important in clinical diagnosis and treatment (Liao et al., 2007). Researchers showed that lower blood sugar content and triglyceride are common with impaired liver disease (Nishikawa et al., 2016; Soohoo et al., 2019). High-density lipoprotein cholesterol can transport cholesterol to the liver and then be excreted by bile, whereas low-density lipoprotein cholesterol can transport cholesterol to extrahepatic tissue (Ayonrinde et al., 2019). The total serum protein level is a reflection of a body's protein metabolism and immune functioning: it is mainly composed of albumin and globulin, and its contents can indicate the strength of protein synthesis metabolism (Stohl et al., 2019). The ratio of albumin to globulin reflects the state of the immune system in the body, and if the ratio decreases, this indicates that globulin synthesis is increased and that immune performance in the body is improved (Yoshino et al., 2019). In this study, we confirmed that CP type A infection could decrease blood glucose and triglyceride. Abnormalities in blood glucose and triglycerides are closely related to liver disease, suggesting that CP type A infection also has a damaging effect on the livers of SPF chickens. Interestingly, the addition of CA could upregulate the content of blood glucose and triglycerides after it was affected by CP type A, illustrating that CA has a certain protective effect in livers damaged by CP type A infection.

Conclusions

This study showed for the first time that CA minimizes the pathological damage to the small intestine structure, improves antioxidant capacity, inhibits damage to ileal mucous layer construction and tight junctions, and inhibits the transcriptional activity of inflammatory cytokines to alleviate the inflammatory response and ameliorate harmful blood biochemical indices in chickens infected with CP type A. This study provides new data for the clinical prevention and control of necrotic enteritis caused by CP type A infections.