Literature DB >> 33235696

Survey of various carbapenem-resistant mechanisms of Acinetobacter baumannii and Pseudomonas aeruginosa isolated from clinical samples in Iran.

Leila Azimi1, Fatemeh Fallah1, Abdollah Karimi1, Mehdi Shirdoust1, Taher Azimi2, Iraj Sedighi3, Mohammad Rahbar4, Shahnaz Armin1.   

Abstract

OBJECTIVES: Pseudomonas aeruginosa and Acinetobacter baumannii resist antibiotics by different intrinsic and acquired mechanisms. This study aims to define various carbapenem-resistant mechanisms of isolated P. aeruginosa and A. baumannii from nine different provinces of Iran.
MATERIALS AND METHODS: In this cross-sectional study, all carbapenem-resistant P. aeruginosa and A. baumannii samples from nine provinces of Iran on a one-year time horizon were gathered. Modified Hedge Test (MHT) and Carba NP-Test were applied to the identification of producing-carbapenemase strains. The most important carbapenemase genes recognized by PCR and gene overexpression of the efflux pump were surveyed by efflux pump inhibitors (EPIs) and confirmed by Real-Time PCR.
RESULTS: Twenty-one percent and 43.5% of P. aeruginosa and A. baumannii isolates were resistant to carbapenem, respectively. MHT and Carba-NP tests identified 21% and 11% carbapenemase-producing strains in these Gram-negative bacteria, respectively. NDM-1 was the most prevalently detected carbapenemase in P. aeruginosa; OXA-51 and OXA-23 were the most significant genes in A. baumannii. EPIs identified active efflux pumps in 20% and 28% of P. aeruginosa and A. baumannii, respectively. Real-time PCR confirmed gene overexpression of efflux pumps in 54% and 30% of positive EPIs in P. aeruginosa and A. baumannii, respectively.
CONCLUSION: P. aeruginosa and A. baumannii may become multi-drug-resistant (MDR) and Extensively Drug-Resistant (XDR) strains and cause a high rate of mortality and morbidity. Thus, it is of necessity to prohibit the spread of antibiotic-resistant strains in hospitals.

Entities:  

Keywords:  Acinetobacter baumannii; Carbapenems; Drug resistance; Iran; Pseudomonas aeruginosa

Year:  2020        PMID: 33235696      PMCID: PMC7671419          DOI: 10.22038/IJBMS.2020.44853.10463

Source DB:  PubMed          Journal:  Iran J Basic Med Sci        ISSN: 2008-3866            Impact factor:   2.699


Introduction

Carbapenems are broad-spectrum beta-lactam antibiotic agents. They are usually considered the last choice for antibiotic therapy, especially in combatting Extended-Spectrum Beta-Lactamase (ESBL) producing microorganisms (1). Although some alternative antibiotics such as tigecycline and colistin can be used in case of carbapenem resistance, these are characterized by low effectiveness and/or high toxicity (1). The rate of carbapenem resistance to Gram-negative bacteria, especially in nosocomial pathogens such as P. aeruginosa and Acinetobacter baumannii, is high and increasing steadily (1-3). Nosocomial isolated P. aeruginosa and A. baumannii may be resistant to most of the available antibiotics and act as Multi-Drug Resistant (MDR) and Extensive Drug-Resistant (XDR) strains (3-5). The presence of carbapenem-resistant bacteria can be quite considerable because they enjoy the chance to shift to MDR strains commonly (1). P. aeruginosa and A. baumannii can become resistant to carbapenem through various mechanisms (2, 3, 6). The most important mechanism is the potential to produce carbapenemase because most of the carbapenemase genes can be found on the transferable genetic elements and they spread rapidly among bacteria (3, 5, 7). Different classes of carbapenemase can be detected in Gram-negative bacteria including Ambler classes A, B, and D β-lactamases (8). One of the inherent resistant mechanisms of carbapenems is the presence of active efflux pumps. It is important because it can cause cross-resistance to other antibiotic families (2, 9). Resistance to most of the available antibiotics in P. aeruginosa and A. baumannii can become a complex challenge for physicians due to the limited number of choices left for antibiotic therapy. This study is a multicenter research that aims to evaluate different mechanisms of carbapenem-resistant P. aeruginosa (CRPA) and A. baumannii (CRAB) through phenotypic and molecular techniques.

Materials and Methods

In this cross-sectional study, P. aeruginosa and A. baumannii strains were collected from nine provinces of Iran from September 2016 up to September 2017. Carbapenem susceptibility was evaluated according to CLSI guidelines (10). P. aeruginosa ATCC 27853 was adopted as the control strain. All Carbapenems-resistant strains were included in the study. Phenotypic screening of carbapenemase-producing strains was carried out by the Modified Hodge Test (MHT) (10) and CarbaAcineto NP test according to CLSI guidelines (2016)(11). MHT was accomplished to identify carbapenemase-producing A. baumannii by using E. coli ATCC 25922 and ertapenem disc (10 µg). Strains with cloverleaf images of inhibition zone were considered as carbapenemase-producing strains according to the CLSI guidelines (2016)(10). THE CarbaAcineto NP test method has been described previously (11). In brief, one loop of a suspected strain was suspended in Tris-HCL mmol/l (5 M NaCl in CarbaAcineto NP Test) as a lysis buffer from antibiogram plates, vortexed for one min, and then incubated at room temperature for 30 min. The bacterial suspension was centrifuged at 10,000 xg at room temperature for 5 min. Next, 30 µl of the supernatant was mixed in 96 wells with 100 µl of imipenem monohydrate solution (3 mg per ml) pH 7.8, phenol red solution, and 0.1 mmol/l ZnSO4 (11). The most prevalent carbapenemase genes were detected by conventional PCR. These genes included VIM, IMP, NDM-1, SPM-1, KPC, GES, and OXA-48 in P. aeruginosa and A. baumannii and OXA-23, OXA-40, OXA-24, OXA-58, and OXA-51 only in A. baumannii. Table 1 lists primers and Table 2 shows the previously described PCR conditions (12-18).
Table 1

Primers used in this study for detection of resistance genes among P. aeruginosa and A. baumannii isolates

Gene Primer sequencing 5’ 3’PCR product size (bp)Tm (oC)Reference
kpc-F CTGTCTTGTCTCTCATGGCC 636 57.98 [12]
kpc-R CCTCGCTGTGCTTGTCATCC 61.36
ges -F GTTTTGCAATGTGCTCAACG 371 57.09 [13]
ges-R TGCCATAGCAATAGGCGTAG 57.54
vim -F GATGGTGTTTGGTCGCATA 390 55.61 [14]
vim -R CGAATGCGCAGCACCAG 59.54
imp -F TTGACACTCCATTTACDG a 139 48.56 [14]
imp-R GATYGAGAATTAAGCCACYCT a 51.92
NDM-1 -F CCCGGCCACACCAGTGACA 129 64.73 [14]
NDM-1-R GTAGTGCTCAGTGTCGGCAT 60.11
SPM-1- F GGGTGGCTAAGACTATGAAGCC 447 60.49 [14]
SPM-1-R GCCGCCGAGCTGAATCGG 63.90
oxa-48-F CCAAGCATTTTTACCCGCATCKACC 389 63.21 [15]
oxa-48-R GYTTGACCATACGCTGRCTGCG 62.30
oxa-23- F GATGTGTCATAGTATTCGTCGT 1058 55.86 [6]
oxa-23- R TCACAACAACTAAAAGCACTGT 56.69
oxa-40- F GGAATTCCATGAAAAAATTTATACTTCC 846 56.44 [17]
oxa-40 - R CGGGATCCCGTTAAATGATTCCAAGATTTTCTAGCG 68.57
oxa-24- F GGTTAGTTGGCCCCCTTAAA 246 57.39 [18]
oxa-24- R AGTTGAGCGAAAAGGGGATT 57.41
oxa-58- F AAGTATTGGGGCTTGTGCTG 598 58.45 [18]
oxa-58- R CCCCTCTGCGCTCTACATAC 59.68
oxa-51- F TAATGCTTTGATCGGCCTTG 353 56.48 [18]
oxa-51- R TGGATTGCACTTCATCTTGG 56.01
b AdeB - F AACGGACGACCATCTTTGAGTATT 84 60.32 [36]
b AdeB - R CAGTTGTTCCATTTCACGCATT 58.36
b16srRNA-F CAGCTCGTGTCGTGAGATGT 151 60.11 [37]
b 16srRNA-R CGTAAGGGCCATGATGACTT 57.67
b MexX-F TGAAGGCGGCCCTGGACATCAGC 326 69.22 [2]
b MexX-R GATCTGCTCGACGCGGGTCAGCG 69.78
b MexA-F CGACCAGGCCGTGAGCAAGCAGC 316 70. 52 [2]
b MexA-R GGAGACCTTCGCCGCGTTGTCGC 70.42
b MexC-F GTACCGGCGTCATGCAGGGTTC 164 65.93 [2]
b MexC-R TTACTGTTGCGGCGCAGGTGACT 67.14
Table 2

PCR conditions used in this study for detection of carbapenem-resistant genes

Number of cycles Time Temperature ( o C) Cycle
11-10a min94Initial denaturation
30-4030- 45a sec94DenaturationAnnealingExtension
30- 40a sec54- 63a
30 sec-1a min72
11-7a min72Final extension

a based on each gene

Treatment of the efflux pump by inhibitor Phenotypic discovery of active efflux pumps was facilitated by detecting Minimum Inhibitory Concentration (MIC) of imipenem ranging between 2-256 µg/ml with and without Cyanide 3-Chlorophenylhydrazone (CCCP) as an EPI. The final concentration of CCCP (C2759 Sigma-Aldrich, France) was 25 µg/ml, simultaneously (19). The positive condition for the presence of active efflux pumps in the isolates was, at least, the 4-fold reduction of MIC in the presence of CCCP. A. baumannii ATCC 19606 was used as the control strain. RNA extraction was carried out by the Thermo RNA extraction kit (cat. No. K0732) according to the manual’s instructions. We used an RNeasy Mini Kit with 1 hr on-column DNase digestion (Qiagen NV, Venlo, The Netherlands) for purification of total RNA. Total RNA was quantified using a spectrophotometer (WPA Biowave II Nanospectrophotometer, USA) and ratio of absorbance at 260 nm vs 280 nm was used to assess RNA purity. Moreover, extracted RNA was screened on a 3% agarose gel. At the next step, cDNA synthesis was executed by the Thermo kit (cat. No. K1622). Finally, the gene overexpression of MexX, MexC, and MexA in P. aeruginosa and of adeB in A. baumannii from RND-type efflux systems, involved in carbapenem resistance, was prepared. 16srRNA was used as a house-keeping gene and P. aeruginosa ATCC 27853 and A. baumannii ATCC 19606 were considered as reference strains. The primers are shown in Table 1. Gene overexpression was calculated by the 2-ΔΔct formula (20). a Y=T or C; D=A or G or T b The relative gene expression was calculated for this gene by Real-Time PCR. Corbett Rotor-Gene 6000 SPSS 22.0 statistical software (IBM Corp., Armonk, USA) was utilized to conduct data analysis. Mean, Confidence Interval (CI), etc. were analyzed by the Explore test in SPSS version 22.0 software. Sensitivity and specificity of phenotypic methods were calculated through the following formula (21): Sensitivity= (a/(a+c))×100 Specificity= (d/(b+d))×100 Positive predictive value (PPV)= (a/(a+b))×100 Negative predictive value (NPV)=(d/(c+d))×100

Results

In this cross-sectional study, 675 P. aeruginosa and 869 A. baumannii remained definite throughout the study, and 140 (20.7%) and 383 (44%) of them, respectively, were resistant to carbapenem. The results of MHT and Carba NP tests used to identify carbapenemase-producing strains are shown in Table 3.
Table 3

Results of MHT of carbapenem-resistant strains

MHT & Carba NP negative (%)Carba NP positive (%)MHT positive (%)Bacteria
102 (73)17 (12)21 (15) P. aeruginosa
258 (67)38 (10)87 (23) A. baumannii

MHT: Modified Hodge Test

According to the results from molecular detection of carbapenemase by PCR, NDM-1 was the most prevalent enzyme in CRPA and OXA-51 and OXA-23 were the most prevalent genes in CRAB. SPM-1, KPC, GES, and OXA-58 were not observed in any of the strains (Figures 1 and 2) (Tables 4 and 5).
Figure 1

PCR based identification of the NDM-1, imp, vim, and oxa-48 genes, using species primer pairs in P. aeruginosa and A. baumannii isolates

Figure 2

PCR based identification of the oxa-23, oxa-24, oxa-51 and oxa-40 genes, using species primer pairs in P. aeruginosa and A. baumannii isolates

Table 4

Number (%) of detected carbapenemase genes in carbapenem-resistant Pseudomonas aeruginosa

OXA_48GESKPCSPM-1NDM-1IMPVIM
6 (4) _ _ _ 10 (7)8 (6)_ P. aeruginosa
Table 5

Number (%) of detected carbapenemase genes in carbapenem-resistant Acinetobacter baumannii

OXA-58OXA-24OXA-40OXA-51OXA-23OXA_48GESKPCSPM-1NDM-1IMPVIM
_252 (65.8%)85 (22.3%)383 (91.6%)290 (76.5%)59 (15.4%) _ _ _ 36 (9.4%)1 (0.3%)7 (2%) A. baumannii
Sensitivity and specificity of MH and Carba NP tests concerning two non-fermentative Gram-negative bacteria are shown in Table 6.
Table 6

Evaluation of MH and Carba NP test in detecting carbapenemase

Carba NP test (%)
MHT (%)
AccuracyNPV**PPV*Specificity Sensitivity AccuracyNPV**PPV*Specificity Sensitivity Bacteria
99223922376895837 P. aeruginosa
163978914213988920 A. baumannii

* Positive predictive value ; ** Negative predictive value; MH: Modified Hedge Test

According to phenotypic evaluations, it was found that 28 (20%) CRPA and 108 (28%) CRAB had active efflux pumps by adding CCCP. In the process of the real-time PCR assay, 15 (54%) P. aeruginosa with positive IEPs showed overexpression of MexX, MexC, and MexA (Figure 3). The mean gene expression of MexX was 8.34 with CI 95%: 1 to 17.15. The mean gene expression of MexA was 67.91 with CI 95%: 16.33 to 119.50. The mean gene expression of MexC was 2.73 with CI 95%: 1 to 5.7. As a common efflux pump, AdeB gene overexpression was detected in 32 (30%) positive EPI tests of A. baumannii with a mean gene expression of AdeB leveled at 9.81, CI 95%: 3.37 to 16.25.
Figure 3

Results of gene expression of each efflux pump in Efflux Pump Inhibitors (EPIs) positive Pseudomonas aeruginosa

Primers used in this study for detection of resistance genes among P. aeruginosa and A. baumannii isolates PCR conditions used in this study for detection of carbapenem-resistant genes a based on each gene Results of MHT of carbapenem-resistant strains MHT: Modified Hodge Test PCR based identification of the NDM-1, imp, vim, and oxa-48 genes, using species primer pairs in P. aeruginosa and A. baumannii isolates M: marker 50bp (SMO321, Fermantas). 1: positive NDM-1: 129bp, 2: positive imp: 139bp, 3: positive vim:390bp, 4: positive oxa-48:389 bp, and 5: negative control PCR based identification of the oxa-23, oxa-24, oxa-51 and oxa-40 genes, using species primer pairs in P. aeruginosa and A. baumannii isolates M: marker 100bp (SMO321, Fermantas). 1: negative control. 2- 5: positive oxa-23: 1058 bp. 6, 7: positive oxa-24: 246 bp. 8,9: positive oxa-40: 846 bp. 10, 11: positive oxa-51: 353 bp Number (%) of detected carbapenemase genes in carbapenem-resistant Pseudomonas aeruginosa Results of gene expression of each efflux pump in Efflux Pump Inhibitors (EPIs) positive Pseudomonas aeruginosa Number (%) of detected carbapenemase genes in carbapenem-resistant Acinetobacter baumannii Evaluation of MH and Carba NP test in detecting carbapenemase * Positive predictive value ; ** Negative predictive value; MH: Modified Hedge Test

Discussion

In recent decades, CRPA and CRAB have been two of the most critical nosocomial pathogens threatening public health and the World Health Organization has included them in a global priority pathogens list of antibiotic-resistant bacteria (2, 4, 5, 7). Rapid horizontal spread of plasmid-borne carbapenemase in these bacteria can be one of the reasons that there is large-scale spread of carbapenem-resistant bacteria. According to the results of the conducted antibiotic susceptibility testing, 21% of the collected P. aeruginosa isolates were resistant to carbapenem. A research group from Brazil worked on P. aeruginosa isolated from blood (22). Their results confirmed that 44% of the mentioned isolates were resistant to carbapenems (22). The frequency of CRPA in the Brazilian study is higher than that in our results; therefore, the sources of collected bacteria may justify this difference in frequency. Ghasemian et al. (2019) published a review article about the frequency of CRPA and analyzed 36 studies from Iran (23). They reported the detection of CRPA in 55% of the studied isolates (22). We had access to materials and methods (the same as those of other studies) at 10 lab centers and different sorts of clinical specimens. Thus, the discrepancy between our proposed results and those in other studies may correspond to different specimens, materials, and methods (22, 23). Production of carbapenemase is one of the significantly responsible mechanisms. NDM-1 is the most frequent carbapenemase in CRPA, as confirmed by the results of PCR and sequencing in the current study. NDM-1 is found on the plasmid and can carry other antibiotic-resistant genes (24). Therefore, the presence and identification of NDM-1 positive strains are quite important and the top priority for control by the nosocomial infection committee of each hospital. The results of a published study revealed that NDM-1-producing P. aeruginosa was not detected in or reported from Iran (25). Hence, the detection of NDM-1-producing P. aeruginosa in the current study is a very alarming sign for the health care system and it needs a significant approach. Some phenotypic tests have been proposed so far to detect carbapenemase-producing organisms. MHT and Carba NP tests are two challenging methods. In the current study, the sensitivity and specificity of MHT and Carba NP tests to detecting carbapenemase in both of the bacteria under study are low and reasonable, respectively. In addition, other studies reported acceptable specificity but low sensitivity for MHT (26-28). Efflux pumps are the other important carbapenem-resistant mechanisms that can cause the appearance of MDR and XDR strains because they can reject a different family of antibiotics, simultaneously (9). In the current study, 20% of CRPA showed active efflux pumps by the EPIs method. The results obtained in other studies showed the role of active efflux pumps in 18% of CRPA by EPIs (2), similarly to our findings. The results of Real-Time PCR confirmed 54% gene overexpression of the Mex family of efflux pumps in EPIs positive CRPA in this study. However, Azimi et al. reported gene overexpression in the Mex family of efflux pumps in 100% CRPA with the CCCP positive test (29). They used different methods for detecting the MIC method and EPI, which may explain the dissimilar results. In the current study, 44% of the collected A. baumannii were resistant to at least one member of the carbapenem class. El Kettani A et al. (2017) showed that 76% of A. baumannii isolated from blood cultures were resistant to carbapenem (30). In 2018, researchers reported that 80% of A. baumannii isolated from wound burn specimens were imipenem-resistant (31). In the above two studies, strains were isolated from blood culture (30) and wounds burn (31); however, the current study evaluated the A. baumannii isolated from different clinical samples. We believe that the source of collected specimens and the use of different antibiotic discs in the brand (from different companies) can justify the divergence of our results from those in other studies. The concentration of more than one carbapenemase was observed in 1% and 2% of P. aeruginosa and A. baumannii, respectively. In addition, gene overexpression of the efflux pump was combined with carbapenemase in 1% of P. aeruginosa and all A. baumannii. According to reports of other researchers, NDM-1-producing bacterium is one of the threatening isolates, while we found that 9% of CRAB pathogens were NDM-1 positive. Unfortunately, these results should be disturbing for Iran’s health system. Obtained results show that OXA-51 and OXA-23 are the most prevalent carbapenemase in isolated A. baumannii, as confirmed by other studies (5, 17, 32). Another responsible resistance mechanism is the efflux pump. According to real-time PCR results from evaluating AdeB gene expression, 29% of CRAB pathogens use the efflux pump mechanism. In previously published studies, several researcher groups worked on CRAB’s efflux pump mechanism and reported similar results to the findings of the current study (33-35).

Conclusion

The existence of different antibiotic-resistant mechanisms of P. aeruginosa and A. baumannii can cause cross antibiotic resistance, lead to the appearance of MDR and/or strains, and make the treatment difficult. The increasing number of NDM-1-producing bacteria is a very serious problem to combat in terms of antibiotic resistance. Therefore, finding a way to inhibit efflux pumps is quite essential for controlling the cross-resistance and appearance of MDR strains of bacteria.
  29 in total

1.  Multidrug efflux pumps: expression patterns and contribution to antibiotic resistance in Pseudomonas aeruginosa biofilms.

Authors:  T R De Kievit; M D Parkins; R J Gillis; R Srikumar; H Ceri; K Poole; B H Iglewski; D G Storey
Journal:  Antimicrob Agents Chemother       Date:  2001-06       Impact factor: 5.191

2.  Molecular screening of carbapenemase-producing Gram-negative strains in Romanian intensive care units during a one year survey.

Authors:  Irina Gheorghe; Ilda Czobor; Mariana Carmen Chifiriuc; Elvira Borcan; Camelia Ghiţă; Otilia Banu; Veronica Lazăr; Grigore Mihăescu; Dan Florin Mihăilescu; Zong Zhiyong
Journal:  J Med Microbiol       Date:  2014-07-24       Impact factor: 2.472

3.  Evaluation of the modified carbapenem inactivation method for the detection of carbapenemase-producing Enterobacteriaceae.

Authors:  Tomokazu Kuchibiro; Masaru Komatsu; Katsutoshi Yamasaki; Tatsuya Nakamura; Hisaaki Nishio; Isao Nishi; Keigo Kimura; Makoto Niki; Tamotsu Ono; Noriyuki Sueyoshi; Machiko Kita; Kaneyuki Kida; Masanobu Ohama; Kaori Satoh; Hirofumi Toda; Tetsu Mizutani; Nozomi Fukuda; Kana Sawa; Isako Nakai; Tomomi Kofuku; Tamaki Orita; Hideo Watari; Satoshi Shimura; Saori Fukuda; Akihiro Nakamura; Yasunao Wada
Journal:  J Infect Chemother       Date:  2017-12-14       Impact factor: 2.211

4.  Involvement of the Multidrug Efflux Pumps in Betalactams Resistant Pseudomonas aerugionsa Clinical Isolates Collected from Burn Patients in Iran.

Authors:  Aslan Bijari; Leila Azimi; Fatemeh Fallah; Abdollah Ardebili; Elnaz Rastegar Lari; Abdolaziz Rastegar Lari
Journal:  Infect Disord Drug Targets       Date:  2016

5.  Warning: spread of NDM-1 in two border towns of Iran.

Authors:  Shahnaz Armin; Fatemeh Fallah; Leila Azimi; Hossein Samadi Kafil; Kiarash Ghazvini; Sepide Hasanzadeh; Abdollah Karimi
Journal:  Cell Mol Biol (Noisy-le-grand)       Date:  2018-07-30       Impact factor: 1.770

6.  Dissemination of imipenem-resistant Acinetobacter baumannii strains carrying the ISAba1 blaOXA-23 genes in a Chinese hospital.

Authors:  Hua Zhou; Bo-Rui Pi; Qing Yang; Yun-Song Yu; Ya-Gang Chen; Lan-Juan Li; Shu-Sen Zheng
Journal:  J Med Microbiol       Date:  2007-08       Impact factor: 2.472

7.  First report of OXA-143-lactamase producing Acinetobacter baumannii in Qom, Iran.

Authors:  Zohreh Sarikhani; Razieh Nazari; Mahmoud Nateghi Rostami
Journal:  Iran J Basic Med Sci       Date:  2017-11       Impact factor: 2.699

Review 8.  Prevalence of Clinically Isolated Metallo-beta-lactamase-producing Pseudomonas aeruginosa, Coding Genes, and Possible Risk Factors in Iran.

Authors:  Abdolmajid Ghasemian; Kobra Salimian Rizi; Hassan Rajabi Vardanjani; Farshad Nojoomi
Journal:  Iran J Pathol       Date:  2018

Review 9.  The threat of carbapenem-resistant gram-negative bacteria in a Middle East region.

Authors:  Effat Davoudi-Monfared; Hossein Khalili
Journal:  Infect Drug Resist       Date:  2018-10-17       Impact factor: 4.003

10.  Prevalence of Acinetobacter baumannii bacteremia in intensive care units of Ibn Rochd University Hospital, Casablanca.

Authors:  Assiya El Kettani; Fakhreddine Maaloum; Idrissa Diawara; Khalid Katfy; Nadia Harrar; Khalid Zerouali; Houria Belabbes; Naima Elmdaghri
Journal:  Iran J Microbiol       Date:  2017-12
View more
  5 in total

1.  Phenotypic and molecular characterization of extended-spectrum β-lactamase/AmpC- and carbapenemase-producing Klebsiella pneumoniae in Iran.

Authors:  Forough Babazadeh; Roghayeh Teimourpour; Mohsen Arzanlou; Hadi Peeridogaheh; Mehdi Yousefipour; Jafar MohammadShahi
Journal:  Mol Biol Rep       Date:  2022-06-03       Impact factor: 2.742

2.  Identification of Novel PhoP-PhoQ Regulated Genes That Contribute to Polymyxin B Tolerance in Pseudomonas aeruginosa.

Authors:  Baopeng Yang; Chang Liu; Xiaolei Pan; Weixin Fu; Zheng Fan; Yongxin Jin; Fang Bai; Zhihui Cheng; Weihui Wu
Journal:  Microorganisms       Date:  2021-02-09

3.  Molecular characterization of NDM-1-producing Pseudomonas aeruginosa isolates from hospitalized patients in Iran.

Authors:  Mojtaba Shahin; Ali Ahmadi
Journal:  Ann Clin Microbiol Antimicrob       Date:  2021-11-03       Impact factor: 3.944

4.  Phenotypic and Molecular Characterization of Carbapenems Resistant Escherichia coli Isolated from Patients with Urinary Tract Infections in Ardabil Province, Iran.

Authors:  Shabnam Khavandi; Mohsen Arzanlou; Roghayeh Teimourpour; Hadi Peeridogaheh
Journal:  Iran J Pathol       Date:  2022-08-11

5.  Evaluation of phenotypic and genotypic patterns of aminoglycoside resistance in the Gram-negative bacteria isolates collected from pediatric and general hospitals.

Authors:  Leila Azimi; Shahnaz Armin; Hossein Samadi Kafil; Nafiseh Abdollahi; Kiarash Ghazvini; Sepide Hasanzadeh; Shahram Shahraki Zahedani; Sedigheh Rafiei Tabatabaei; Fatemeh Fallah
Journal:  Mol Cell Pediatr       Date:  2022-02-04
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.