Mote Srinath1, Aayeti Shailaja1, Byreddi Bhavani Venkata Bindu1, Charu Chandra Giri2. 1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, Telangana, India. 2. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, Telangana, India. giriccin@yahoo.co.in.
Abstract
Andrographis paniculata 1-deoxy-D-xylulose-5-phosphate synthase (ApDXS) gene (GenBank Accession No MG271749.1) was isolated and cloned from leaves for the first time. Expression of ApDXS gene was carried out in Escherichia coli Rosetta cells. Tissue-specific ApDXS gene expression by quantitative RT-PCR (qRT-PCR) revealed maximum fold expression in the leaves followed by stem and roots. Further, the differential gene expression profile of Jasmonic acid (JA)-elicited in vitro adventitious root cultures showed enhanced ApDXS expression compared to untreated control cultures. A. paniculata 3-hydroxy-3-methylglutaryl-coenzyme A reductase (ApHMGR) gene expression was also studied where it was up-regulated by JA elicitation but showed lower expression compared to ApDXS. The highest expression of both genes was found at 25 µm JA elicitation followed by 50 µm. HPLC data indicated that the transcription levels were correlated with increased andrographolide accumulation. The peak level of andrographolide accumulation was recorded at 25 μM JA (9.38-fold) followed by 50 µM JA (7.58-fold) in elicitation treatments. The in silico generated ApDXS 3D model revealed 98% expected amino acid residues in the favored and 2% in the allowed regions of the Ramachandran plot with 92% structural reliability. Further, prediction of conserved domains and essential amino acids [Arg (249, 252, 255), Asn (307) and Ser (247)] involved in ligand/inhibitor binding was carried out by in silico docking studies. Our present findings will generate genomic information and provide a blueprint for future studies of ApDXS and its role in diterpenoid biosynthesis in A. paniculata.
Andrographis paniculata 1-deoxy-D-xylulose-5-phosphate synthase (ApDXS) gene (GenBank Accession No MG271749.1) was isolated and cloned from leaves for the first time. Expression of ApDXS gene was carried out in Escherichia coli Rosetta cells. Tissue-specific ApDXS gene expression by quantitative RT-PCR (qRT-PCR) revealed maximum fold expression in the leaves followed by stem and roots. Further, the differential gene expression profile of Jasmonic acid (JA)-elicited in vitro adventitious root cultures showed enhanced ApDXS expression compared to untreated control cultures. A. paniculata 3-hydroxy-3-methylglutaryl-coenzyme A reductase (ApHMGR) gene expression was also studied where it was up-regulated by JA elicitation but showed lower expression compared to ApDXS. The highest expression of both genes was found at 25 µm JA elicitation followed by 50 µm. HPLC data indicated that the transcription levels were correlated with increased andrographolide accumulation. The peak level of andrographolide accumulation was recorded at 25 μM JA (9.38-fold) followed by 50 µM JA (7.58-fold) in elicitation treatments. The in silico generated ApDXS 3D model revealed 98% expected amino acid residues in the favored and 2% in the allowed regions of the Ramachandran plot with 92% structural reliability. Further, prediction of conserved domains and essential amino acids [Arg (249, 252, 255), Asn (307) and Ser (247)] involved in ligand/inhibitor binding was carried out by in silico docking studies. Our present findings will generate genomic information and provide a blueprint for future studies of ApDXS and its role in diterpenoid biosynthesis in A. paniculata.
Isoprenoids are the important diverse group of bioactive compounds performing vital biological functions in plants, bacteria, and mammals. Especially in plants, they perform significant roles such as redox reactions, light harvesting, growth regulation, membrane structure, and development [1]. All isoprenoids are synthesized by two 5-carbon monomers, isopentenyl pyrophosphate (IPP), and its isomer, dimethyl allyl pyrophosphate (DMAPP). The biosynthesis of these 5-carbon monomers was achieved by the mevalonate (MVA) and the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathways [2, 3]. However, a complete understanding of these highly complex biosynthetic pathways has been elucidated in only few plants. The MVA pathway is a main biosynthetic pathway in all eukaryotes, whereas the MEP pathway is the dominant source of isoprenoids in eubacteria, algae, higher plants, and protists [4]. In photosynthetic organisms, both precursor pathways are operative in different sub-cellular compartments. The MVA pathway occurs in the cytoplasm whereas the MEP pathway operates in plastids (Fig. 1). Limited exchange of IPP and DMAPP between the plastid and cytosol was detected in several plants, but this crosstalk is not sufficient to understand the biosynthetic limitations in either pathways [5]. Isoprenoids are produced in response to external stimuli (biotic/abiotic), and/or accumulate exclusively in specialized tissues, but in small amounts due to their high degree of chemical complexities, metabolic specialization, and functional attributes [6].
Fig. 1
Schematic representation of the MEP pathway for DL biosynthesis in Andrographis paniculata. G3P glyceraldehyde-3-phosphate, DXS 1-deoxy-D-xylulose 5-phosphate synthase, DXP 1-deoxy-D-xylulose 5-phosphate, DXR 1-deoxy-D-xylulose 5-phosphate reductoisomerase, MEP 2-C-methyl-D-erythritol 4-phosphate, DMAPP dimethylallyl diphosphate, IPP isopentenyl diphosphate, GGPPS geranylgeranyl diphosphate synthase, GGPP geranylgeranyl diphosphate, Ent-CPS Ent copalyl diphosphate synthase, GT glycosyl transferase
Schematic representation of the MEP pathway for DL biosynthesis in Andrographis paniculata. G3P glyceraldehyde-3-phosphate, DXS 1-deoxy-D-xylulose 5-phosphate synthase, DXP 1-deoxy-D-xylulose 5-phosphate, DXR 1-deoxy-D-xylulose 5-phosphate reductoisomerase, MEP 2-C-methyl-D-erythritol 4-phosphate, DMAPP dimethylallyl diphosphate, IPP isopentenyl diphosphate, GGPPS geranylgeranyl diphosphate synthase, GGPP geranylgeranyl diphosphate, Ent-CPS Ent copalyl diphosphate synthase, GT glycosyl transferaseIn addition, the MEP pathway is a prominent source for the effective biosynthesis of isoprenoids in plants that delivers C5 prenyl diphosphates for synthesis of monoterpenes, diterpenes, and tetraterpenes [3, 7–9]. 1-Deoxy-D-xylulose 5-phosphate (DXP) synthase (DXS) catalyzes the condensation of pyruvate and D-glyceraldehyde 3-phosphate (G3P) into DXP, a rate limiting step that controls flux in the MEP pathway [10, 11]. The role of DXS in plants and its conserved regulation among the plants signifies its importance [12]. It also suggests that the DXS expression is linked with the plant parts in a tissue-specific manner and the accumulation of the final products [13, 14]. The enhanced production of these compounds, particularly diterpene lactones can be achieved through genetic manipulation of biosynthetic pathway [15, 16]. The DXS gene has made known to be a significant target for the manipulation of terpenoids biosynthesis [17-21]. It is essential to detect the amino acid residues prerequisite to preserve the structure and function of DXS. Structural information is required to understand the molecular mechanisms of DXS conformational changes and their roles in catalysis until crystal structures are available [22].Andrographis paniculata (Family: Acanthaceae), a well-known annual medicinal herb, is native to India [23]. This plant has been used for the treatment of common cold and flu as a traditional remedy. At one point of time, it was mentioned that the plant acted as a wonder drug during the 1919 Spanish flu pandemic akin to current COVID-19 crisis [24]. It is referred to as “Indian Echinacea” by Strong [25]. The plant was evaluated for its various medicinal properties over the years such as anti-cancer [26-28], anti-viral [29, 30], cardio protecting [31], and neuro-protectant [32]. A. paniculata is one of the main ingredients in pain killer and anti-inflammatory drugs, e.g., ParActin and ArmaForce. The medicinal attributes of this plant are due to the presence of diterpene lactones (DLs) and their derivatives [33] (Fig. 2). An understanding of mechanisms that regulate IPP biosynthesis in A. paniculata is of paramount importance for the production of bioactive compounds particularly DLs. Further, the regulation of DXS gene will help in the manipulation of the biosynthesis DLs as MEP pathway provides precursor IPP. However, most of the genes in the MEP pathway have not been isolated and characterized as yet in A. paniculata particularly DXS. In our previous study, we have isolated and characterized ApHMGR gene from its cytosol counterpart MVA pathway and assessed its role in the DL biosynthesis [34].
Fig. 2
Important diterpene lactones present in A. paniculata. Andrographolide and its derivatives were represented in black, whereas the andrographolide analogs were represented in blue color. 3a–f 3,19-diacetyl-C-12-substituted-14-deoxy-andrographolide, 3A.1 19-tert-butyldiphenylsilyl-8,17-epoxy andrographolide, 5a–n 14α-O-(1,4-disubstituted-1,2,3-triazolyl) ester derivatives of andrographolide 17b 19-acetylated 14α-(5′,7′-dichloro-8′-quinolyloxy) derivative, 3 14β-(8′-quinolyloxy)-3,19-diol derivative, 3g 3,19-diacetyl-12-phenylthio-14-deoxy-andrographolide, 8m 3,19-(2-chlorobenzylidene)andrographolide, 3b 3,19-(3-chlorobenzylidene)andrographolide, AGS-30 3,19-(2-chloro-5-nitrobenzylidene)andrographolide
Important diterpene lactones present in A. paniculata. Andrographolide and its derivatives were represented in black, whereas the andrographolide analogs were represented in blue color. 3a–f 3,19-diacetyl-C-12-substituted-14-deoxy-andrographolide, 3A.1 19-tert-butyldiphenylsilyl-8,17-epoxy andrographolide, 5a–n 14α-O-(1,4-disubstituted-1,2,3-triazolyl) ester derivatives of andrographolide 17b 19-acetylated 14α-(5′,7′-dichloro-8′-quinolyloxy) derivative, 3 14β-(8′-quinolyloxy)-3,19-diol derivative, 3g 3,19-diacetyl-12-phenylthio-14-deoxy-andrographolide, 8m 3,19-(2-chlorobenzylidene)andrographolide, 3b 3,19-(3-chlorobenzylidene)andrographolide, AGS-30 3,19-(2-chloro-5-nitrobenzylidene)andrographolideKeeping in view significance of the MEP pathway in the biosynthesis of DLs, we report the isolation of full-length cDNA of ApDXS, a rate-limiting key gene of the MEP pathway from A. paniculata for the first time and its heterologous expression in E. coli. Prediction of conserved domains was performed to find the sequence similarities of ApDXS compared to other plant DXSs. Further, virtual docking was carried out to identify catalytic amino acids essential for interaction of the ApDXS enzyme with its substrates and inhibitors. These include N-terminal targeting sequence, a conserved thiamine diphosphate-binding site, and pyridine-binding DRAG domains. The present study also reports, comparative differential ApDXS expression pattern among different in vivo plant parts and andrographolide accumulation using in vitro adventitious root cultures in response to JA driven elicitation. One of the objectives of our comprehensive research program has been to make genomic information avalilable about andrographolide biosynthesis pathway genes in A. paniculata. The present findings will also help in understanding the role of ApDXS in DL biosynthetic pathway.
Materials and Methods
Collection of Plant Material
A. paniculata plants developed in vitro were used for the isolation of total RNA. A. paniculata seeds were collected from net house-established plants at Centre for Plant Molecular Biology (CPMB), Osmania University, Hyderabad, India. Seeds were surface sterilized with 0.1% (w/v) HgCl2 for 1 min followed by washing with sterile distilled water and inoculated onto the Murashige and Skoog’s (MS) medium [35]. The MS medium was fortified with 3% (w/v) sucrose and 0.8% (w/v) agar (Fisher Scientifics, Mumbai, India). The seeds were then incubated under dark for germination.
Total RNA Isolation and cDNA Synthesis
Approximately, 100 mg leaves were collected from 2-month-old in vitro grown plants using a sterile scalpel and placed in −20 °C for 5–10 min. The leaves were then pulverized to a fine powder in liquid nitrogen using pre-cooled sterile mortar and pestle. 1.0 ml of RNAiso Plus (DSS Takara Bio India Pvt. Ltd. New Delhi, India) was added immediately. Total RNA was isolated following Trizol method and converted to cDNA using DSS Takara Prime Script First-Strand cDNA Synthesis kit (DSS Takara Bio India Pvt. Ltd. New Delhi, India) as per manufacturer’s instructions. cDNA was used as a template for further polymerase chain reactions (PCR).
Isolation of Full-Length ApDXS Gene from A. paniculata
DXS protein sequences from other closely related plants were obtained from NCBI. Conserved regions among the sequences were identified by multiple sequence alignment using the Clustal Omega tool. The primers based on highly conserved regions were designed using the primer3 tool (Table 1). The primers were designed with the help of an Oligo Analyzer web tool by avoiding primer dimer and hair pin formation. The selected primers were procured from ReGene Biologics Pvt. Ltd., Hyderabad, India. PCR reactions were carried out with gradient PCR machine (Eppendorf AG, Hamburg, Germany) using cDNA as a template. The DreamTaq DNA polymerase (Thermo Scientific, USA) was used for the amplification of a full-length gene. The PCR reaction was as follows: initial denaturation – 94 °C for 2 min; 35 cycles of denaturation – 94 °C for 1 min; annealing – 62.3 °C for 1 min; extension – 72 °C for 2.3 min; final extension – 72 °C for 5 min; and rapid cooling – 4 °C.
Table 1
Primers list used for ApDXS gene isolation
Primer
Sequence
Amplicon length
1
DXS partial forward 1
ACCGGATTATGGCATCAGTG
1000 bp
2
DXS partial reverse 1
TCTGCAGCTTTTTCAGCGTA
3
DXS partial forward 2
CGAGAAAGGCCGAGGATCTT
1130 bp
4
DXS partial forward 2
GGCTCATGCTAGGATTCATCA
5
DXS full-length forward
GTTCTCAGTCACGGCCATTT
~2500bp
6
DXS full-length reverse
TGAGGCTCATGCTAGGATTCA
Primers list used for ApDXS gene isolation
Submission of Full-Length ApDXS Gene Sequence to NCBI
The PCR amplicon was gel eluted and purified using a FavorGen PCR cleanup kit (FavorGen, Taiwan) as per manufacturer’s instructions and given for sequencing at ReGene Biologics Pvt. Ltd., Hyderabad, India. The sequence obtained was submitted to NCBI and subjected to bioinformatics analysis using the Clustal Omega and ESpript tools to find the sequence comparison with other plant DXS genes.
Cloning and Heterologous Expression of ApDXS Gene in E. coli
The full-length ApDXS gene was cloned into the pET 32 ( +) expression vector. The primers were designed with two separate restriction sites (Table 2). The PCR products cut with restriction enzymes were ligated with linearized pET 32 ( +) vector. The cloned ApDXS gene was transformed into E. coli Rosetta competent cells. Recombinant colonies were identified by screening for ampicillin resistance. The transformed recombinant colonies were then inoculated to the liquid LB medium and subjected to IPTG induction. The total protein from IPTG-induced bacterial cells was harvested at different time durations (0, 3, 6, 12, and 24 h) and analyzed by SDS-PAGE with the Coomassie Brilliant Blue staining to identify the ApDXS gene product.
Table 2
Primers used for the cloning of full coding sequence (CDS) of ApDXS
Primer
Sequence
Amplicon length
1
DXS forward with Kpn I restriction site
CACCGGTACCGTTCTCAGTCACGGCCATTT
2076 bp
2
DXS reverse with Not I restriction site
GACCGCGGCCGCTGAGGCTCATGCTAGGATTCA
Primers used for the cloning of full coding sequence (CDS) of ApDXS
Comparative Tissue-Specific Expression Profiling of ApDXS Gene Using Quantitative RT-PCR (qRT-PCR) of Various Plant Parts and Biosynthesis of Andrographolide
The different tissues such as leaf, stem, and root were collected from 2-month-old in vitro grown plants. The tissue was divided into two parts. One part was used for tissue-specific expression profiling of ApDXS gene. Another part was used for estimation of andrographolide content by the High-Performance Liquid Chromatography (HPLC). Approximately, 100 mg of fresh tissue was used for total RNA isolation by Trizol method and converted to cDNA as mentioned earlier. The primers were designed specifically for qRT-PCR using full-length ApDXS gene sequence with product size 250 bp (Table 3). The qRT-PCR was performed in Applied Biosystems 7500 Fast PCR (Applied Biosystems, Foster City, USA) machine using DyNAmoColorFlash SYBR Green qPCR master mix (Thermo Fisher Scientific, USA). The gene expression was calculated by 2 − ΔΔCt (cycle threshold) method. The normalization was carried out by Actin gene [36].
Table 3
Primers used for the differential expression of ApDXS and ApHMGR in different plant plants and JA-elicited in vitro adventitious root cultures using qRT-PCR analysis
Primer
Sequence
Amplicon length
1
DXS-qRT-PCR forward
GATCCAGCAACGGGTAGAC
~200bp
2
DXS-qRT-PCR reverse
GTGCGACTTAGCTAAGCTG
3
HMGR-qRT-PCR forward
TGGAGGGCTTCAATTACGAC
217 bp
4
HMGR-qRT-PCR reverse
TCTCTGAGAACTGCGCTGAA
5
Actin-qRT-PCR forward
TCTCCTTGCTCATCCTGTCC
200 bp
6
Actin-qRT-PCR reverse
AAGAACTATGAGCTGCCCGA
Primers used for the differential expression of ApDXS and ApHMGR in different plant plants and JA-elicited in vitro adventitious root cultures using qRT-PCR analysis
Estimation of Andrographolide In Different Plant Parts by HPLC
About 50 mg of dried plant tissue powder from different plant parts was subjected to methanol extraction as per Zaheer and Giri [37] with minor modifications. Dried powder was added to 5 m of HPLC grade methanol (Fisher Scientifics, India) and incubated at room temperature for 24 h followed by 1 h sonication in Ultrasonic Cleaning Bath (Spectralabs Instruments Pvt. Ltd, Mumbai, India). The methanol extract was filtered through Whatman No.41 filter paper first and then through 0.2 µm Millex GV Durapore PVDF filter (Merck, Germany). The filtered sample (500 µl) was used for analysis in the Waters HPLC system (Waters, USA) using a C18 column. The methanol (100%) was used as an isocratic solvent system. The samples were run for 15 min with 20 µl injection volume and 1 mL/min flow rate at 25 °C. The pressure was maintained in the range of 2000–6000 psi. The andrographolide content was detected with the PDA detector. The authentic andrographolide (98%) procured from Sigma-Aldrich (USA) was used as a standard. Andrographolide content was estimated by calculating peak areas and comparing with the authentic standard.
Comparative Differential Gene Expression Analysis of ApDXS and ApHMGR Using JA-elicited in vitro Adventitious Root Cultures
Induction of Adventitious Root Cultures, Elicitation with JA and HPLC Analysis
The seeds collected from net house-grown A. paniculata plants were germinated in vitro as mentioned earlier. The cotyledon explants from these in vitro germinated plantlets were inoculated onto MS semisolid medium containing 1.0 mg/l naphthalene acetic acid (NAA) for the induction of adventitious roots. The three-week-old actively growing adventitious roots were subsequently transferred to the same MS + NAA medium supplemented with different concentrations of JA viz.1.0, 10, 25, 50, and 100 µM as per Zaheer and Giri [37]. The growth indices (GI) of the elicited adventitious roots were conducted by harvesting the adventitious roots and measuring fresh and dry weight for a duration of 4 weeks. The adventitious roots harvested were weighed, dried, and powdered using mortar and pestle. The dried powder (50 mg) was subjected to methanol extraction as mentioned earlier. The standard andrographolide procured from Sigma-Aldrich, USA was prepared in 1.0 mg/mL concentration with HPLC grade methanol and estimated in samples by comparing its UV absorbance and retention time. The induction of adventitious roots and elicitation experiments were conducted thrice with minimum of 6 replicates each, and the data were expressed as mean ± SE.
qRT-PCR Analysis of JA-elicited in vitro Adventitious Root Cultures
The differential expression analysis of ApDXS along with ApHMGR was investigated by qRT-PCR in A. paniculata JA-elicited in vitro adventitious root cultures. The RNA was isolated by Trizol method from the adventitious root culture samples elicited with different concentrations of JA. The RNA was quantified by NanoDrop (Eppendorf, Humbarg, Germany) and converted to cDNA. Consequently, the cDNA of all the samples was used for qRT-PCR reactions in 7500 Fast Real-Time PCR (Applied Biosystems, USA) using the DyNAmoColorFlash SYBR Green qRT-PCR kit (Thermo Scientifics, USA). The actin gene was used as an endogenous control for normalization of gene expression. The relative gene expression was calculated following the 2 − ΔΔCt (cycle threshold) method [36]. The qRT-PCR analysis was performed with 3 experimental replicates.
Bioinformatics analysis
Generating 3D Model of ApDXS Protein and Validation
The 3D model of ApDXS was generated using the Swiss model web server (https://swissmodel.expasy.org/). The E. coli DXS (SMTL ID: 2o1s.1) was used as a template which has 47% sequence identity with ApDXS. The 3D model was further validated using the Structure Analysis and Verification Server (Saves) v5. 0 (https://servicesn.mbi.ucla.edu/SAVES/), a metaserver (consisting Procheck, Verify 3D, Errat, etc.) for protein structures during and after model refinement. The evaluation of amino acid residues present in the most favored regions of the designed 3D model of ApDXS was checked using RAMPAGE Ramachandran plot assessment web tool (http://mordred.bioc.cam.ac.uk/~rapper/rampage.php).
Selection of Substrates and Inhibitor Structure
The DXS catalyzes the condensation of pyruvate and G3P to produce DXP using thiamine pyrophosphate (TPP) and Mn2 + . Hence, the structures of pyruvate (PubCID-107735), G3P (PubCID-4391668), and TPP (PubCID-1132) were obtained from the PubChem. The potential inhibitors of DXS were identified from the literature searches. The Ketoclomazone (PubCID-12811046), fluoropyruvate (PubCID-67946), methylacetyl phosphonate (PubCID-656481), clomazone (PubCID-54778), and isopentenyl pyrophosphate (IPP) (PubCID-1195) were selected as inhibitors and used for docking studies.
In silico Ligand/Inhibitor-Receptor Docking Studies
The ApDXS protein sequence was multiple sequences aligned with closely related plant DXS protein sequences to find out the conserved substrate-binding regions using the Clustal Omega tool. The molecular docking program, the Molegro Virtual Docker (MVD), was used for molecular docking which provides flexible platform. The optimized clean 3D structures prepared using Marvin tools (Marvin View 5.6.0.2, Marvin space, and Marvin sketch) were docked into two substrate-binding clefts in ApDXS protein, Region-I-VIGDGAMIAGQAYEAMNNAGYLDSDMIVILND at 186–217-and Region-II-AMDRAGLVGADGP at 468–480. The substrate-binding cavities were identified at these regions before setting up the grid parameters. The grid center was set to X: −35.15, Y: −6.61, and Z: 59.82 for first docking position, i.e., Region-I and X: −10.23, Y: −24.58, and Z: 33.22 for second docking position, i.e., Region-II. The energy minimization and hydrogen bonds were optimized after the docking. The binding affinity and interactions of inhibitor with protein were evaluated on the basis of the internal ES (Electrostatic Interaction), internal hydrogen bond (H-bond) interactions and sp2–sp2 torsions. The interactions were visualized using Discovery Studio 3.5. Visualizer.
Results
The gene-specific primers designed from the conserved regions of other plant DXSs, amplified a partial ApDXS sequence of 1014-bp initially (GenBank: MG271750.1). Later the full-length cDNA of ApDXS (NCBI Accession Number-MG271749.1) of 2,453-bp containing 322-bp 5′ un-translated region (UTR), 2076-bp open reading frame (ORF) and 55-bp 3′ UTR was amplified (Fig. 3). It encoded a protein of 691 amino acids with a deduced molecular weight of 74.4 K Da and a theoretical pI of 6.01.
Fig. 3
Isolation of full-length ApDXS (2,453-bp) gene from A. paniculata. L1 ApDXS full-length gene corresponding to 2.5 kb length, L2 1 kb DNA ladder; L3 open reading frame of ApDXS corresponding to 2 kb length in size
Isolation of full-length ApDXS (2,453-bp) gene from A. paniculata. L1 ApDXS full-length gene corresponding to 2.5 kb length, L2 1 kb DNA ladder; L3 open reading frame of ApDXS corresponding to 2 kb length in size
Cloning, Heterologous Expression of ApDXS in E. coli, and Identification of Gene Product by IPTG Induction
According to restriction site analysis, the ORF of the ApDXS gene of A. paniculata was inserted into expression vector pET-32a ( +) between Not I and Kpn I restriction sites. The verification of recombinant prokaryotic expression vector in IPTG-induced bacteria through SDS-PAGE showed a specific band of 74.4 KDa-expressed protein (Supplementary File-1. S1).
Tissue-Specific Expression Profiling of ApDXS Gene Using qRT-PCR
The qRT-PCR results revealed that ApDXS gene was expressed in all examined tissues, namely leaves, stems, and roots. ApDXS gene expression levels were significantly higher (16-fold) in leaves followed by stem and roots. The expression level of ApDXS gene in stem was observed to be fourfold higher than that in roots (Fig. 4).
Fig. 4
Tissue-specific expression analysis of ApDXS using qRT-PCR (Bars represent standard error). ApDXS gene expression was observed high in leaves followed by stem and root explants
Tissue-specific expression analysis of ApDXS using qRT-PCR (Bars represent standard error). ApDXS gene expression was observed high in leaves followed by stem and root explants
Differential Gene Expression Analysis of ApDXS, ApHMGR, and Stimulation of Andrographolide Accumulation in JA-elicited in vitro Adventitious Root Cultures
The highest level of ApDXS gene expression was observed in 25 µM JA treatment followed by 50 µM JA in all week (Fig. 5a). The highest HMGR expression was observed in 25 µM followed by 50 µM JA concentrations. Rapid elevation in HMGR expression was observed in 25 µM from the second week to third week and enhanced even in the fourth week, unlike in the other concentrations of JA. Substantial enhanced expression was observed in all other JA concentrations at the fourth week (Fig. 5b). Adventitious root biomass was enhanced only at 3rd week in 50 μM JA (Fig. 6a). The highest level of andrographolide accumulation was recorded at 25 μM JA (9.38-fold) followed by 50 µM JA (7.58-fold) treatment. The accumulation was more profound in the case of 25 μM JA treatment (Fig. 6b). All the experiments were resulted with ≤ 0.05 standard error. Raw data of differential expression analysis of ApHMGR and ApDXS in JA-elicited in vitro adventitious root cultures of A. paniculata are supplemented to authenticate Fig. 5a, b (Supplementary File-2).
Fig. 5
Differential expression of ApDXS (a) and ApHMGR (b) using in vitro adventitious root cultures elicited with different concentrations of JA by qRT-PCR analysis (Bars represent standard error). Different concentrations of JA elicited both the genes in different quantities. JA in 25 and 50 µM was observed effective in inducing the gene expression
Fig. 6
Elicitation of adventitious roots with JA, (a) Growth study of elicited in vitro adventitious root cultures. (b) HPLC analysis of elicited adventitious roots harvested at different time durations (Bars represent Standard Error). JA-elicited adventitious root cultures did not show any biomass enhancement
Differential expression of ApDXS (a) and ApHMGR (b) using in vitro adventitious root cultures elicited with different concentrations of JA by qRT-PCR analysis (Bars represent standard error). Different concentrations of JA elicited both the genes in different quantities. JA in 25 and 50 µM was observed effective in inducing the gene expressionElicitation of adventitious roots with JA, (a) Growth study of elicited in vitro adventitious root cultures. (b) HPLC analysis of elicited adventitious roots harvested at different time durations (Bars represent Standard Error). JA-elicited adventitious root cultures did not show any biomass enhancement
Homology Search and Bioinformatics Analysis of ApDXS
The nucleotide sequence of ApDXS submitted to the NCBI GenBank database and was assigned with the Accession No. MG271749.1. The deduced amino acid sequence of ApDXS has shown a high degree of homology with other plant DXS sequences, e.g., Lavandula aungustifolia (Ac. No. AGQ04153.1, 90.03% identity), Heveabrasiliensis (BAF98288.1, 88.67%), Bixa orellana (AMJ39459, 88.67%), Salvia miltiorrhiza(ACF21004.1, 88.5%), Oryza sativa (XP_015640505.1, 88.05%), Catharanthusroseus (CAA09804.2, 87.46%), Solanum lycopersicum(NP_001234672.1, 86.87%), Zea mays (AQK85916.1, 86.56%), Withaniasomnifera(AFI98878.1, 86.27%), Arabidopsis thaliana (NP_193291.1, 84.80%), and Gingko biloba(AAS89341.1, 82.99%). The comparison of the deduced amino acid sequence of ApDXS and the above organisms revealed highly conserved regions (Fig. 7).
Fig. 7
Identification of conserved domains and motifs in ApDXS using Multiple Sequence Alignment with other known plant DXS proteins. Red star—highly conserved catalytic residues; green triangles—presumed transit peptide cleavage site; hollow circles—Glyceraldehyde-3-phosphate binding sites; pink star—Transketolase TPP-binding domain; blue star—N-terminal highly conserved target sequence; green star-essential catalytic regions. The figure is prepared using the ESpript web server (Color figure online)
Identification of conserved domains and motifs in ApDXS using Multiple Sequence Alignment with other known plant DXS proteins. Red star—highly conserved catalytic residues; green triangles—presumed transit peptide cleavage site; hollow circles—Glyceraldehyde-3-phosphate binding sites; pink star—Transketolase TPP-binding domain; blue star—N-terminal highly conserved target sequence; green star-essential catalytic regions. The figure is prepared using the ESpript web server (Color figure online)A highly consensus fingerprint structural transketolase TPP-binding motif GDG-X26-NDN was found in residues 188–217. A cluster of amino acids known to be (glyceraldehyde-3-phosphate) substrate-binding motifs (GGHLGS, VSIHVVTEKG, KPFCAIYSSFLQ, AND AMDRAGLVGADGP) were identified in the ApDXS proteins, corresponding to the residues 84–90, 327–336, 437–448, and 468–480, respectively. Towards the N-terminal, another highly conserved target sequence VAIHYVFNA was found at residues 98–106. The N-terminal ends of all plant DXSs were not identical, but share a common feature of the chloroplast transit peptide (cTP) sequence. The predicted cTP cleavage site (EYFSEKPPTP) and was positioned between amino acids 37 and 46. TheApDXS was cleaved between ‘S’ and ‘E’ at residues 40 and 41 in the processing sites, and the putative mature ApDXS was deduced. In addition, a conserved landmark pyrimidine-binding motif DRAG was found at residues 470–473, transit peptide RRF at 409–411 along with essential catalytic regions GIAEQHAVTF (418–427), SSFLQRAYD (444–452), and PSCFRYPRGNG (522–532) (Fig. 7).
3D Structure Assessment and in silico Molecular Docking of ApDXS
The 3D structure of ApDXS generated by the Swiss model server was represented in ribbons (Fig. 8). Structural assessment through Ramachandran plot revealed 98% expected amino acid residues in the favored and 2% in the allowed regions with 92% structural reliability. The Ramachandran plot can be found in the Supplementary material-1 (S.2). The in silico molecular docking studies revealed that pyruvate and G3P, substrates of DXS, were binding at Region-I (VIGDGAMIAGQAYEAMNNAGYLDSDMIVILND) and Region-II (AMDRAGLVGADGP), respectively. The co enzyme TPP was observed to bind at Region-II more efficiently than at Region-I. Clomazone, ketoclomazone inhibitors, and intermediate compound IPP were effective to bind Region-II. The other inhibitor fluoropyruvate was observed to bind more efficiently at Region-I than to a Region-II. Among all the molecules, methyl acetyl phosphonate was observed as a week binder at both the regions. Binding of molecules to their respective binding sites and the hydrogen bonds between molecules and DXS active sites can be established in the Supplementary material-file1 S.3. Binding energies and H-bond score and interacting amino acid residues are given in Table 4.
Fig. 8
3D model of ApDXS generated using Swiss model server. 3D structure was represented in ribbon style
Table 4
Docking values of ligands/inhibitors and ApDXS protein interactions
Name
Pose
Plants score
MolDock score
Rerank score
RMSD
H-Bond
Region
No. of H-bonds
Interacting residues
1
Thiamine Pyro Phosphate
[01]
−59.7814
−109.514
−89.9173
0
−10.0818
II
7
Leu, Arg, Lys, His, Glu
2
Ketoclomazone
[00]
−56.5446
−75.245
−60.475
0
−6.30396
II
4
Arg, Ser
3
Clomazone
[02]
−50.5434
−70.4547
−60.4716
0
−2.75397
II
2
Asn, Arg
4
Glyceraldehyde 3-Phosphate
[02]
−49.7005
−71.4311
−59.5474
0
−10.6222
II
7
Arg, Asp, Asn, Ser, Leu
5
Isopentenyl pyrophosphate
[02]
−53.9431
−67.276
−55.2386
0
−5.06213
II
5
Arg, Asn, Asp
6
Pyruvate
[00]
−39.6717
−41.7127
−38.4488
0
−4.1919
I
3
Asn, Asp, Ser
7
Fluoropyruvate
[02]
−45.0379
−52.1835
−45.783
0
−5.75898
I
3
Leu, Ala, Thr
8
Methylacetyl phosphonate
[03]
−31.9122
−35.3584
−32.8289
0
−2.40263
Not effective
1
Asn
3D model of ApDXS generated using Swiss model server. 3D structure was represented in ribbon styleDocking values of ligands/inhibitors and ApDXS protein interactionsThe pyruvate was bound to its substrate-binding pocket by forming hydrogen bonds with Ser (247 position), Asn (307), and Asp (304) whereas G3P was interlinked with Arg (252) by one H-bond, Asp (304, 310) via two H-bonds, Asn (248, 307) with two hydrogen bonds, and Ser (247) and Leu (251) with one H-bond. The TPP was bound to its pocket via 7 H-bonds with Leu (254), Arg (255), Lys (66), His (306), Arg (337 and 73), and Glu (95). The clomazone has formed only single H-bond with each of Arg (249) and Asn (307), whereas the ketoclomazone was found to have two H-bonds with each of Arg (249) and Ser (247), respectively. The IPP formed 2 hydrogen bonds with each of Arg (255) and Asp (304), and one H-bond with Asn (307). The fluoropyruvate was also observed to form single hydrogen bonds with each of Leu (228), Ala (226), and Thr (225). Methyl acetyl phosphonate was interlinked with DXS protein at Asn (307) by forming a single hydrogen bond.
Discussion
Despite the intensive study of genes and proteins contributing for diterpene biosynthesis in A. paniculata plant, a meager information is available for the isolation and characterization of the MEP pathway genes. However, in our laboratory, we have ongoing comprehensive research programs to decipher both MVA and MEP pathway genes using genomic and proteomic approaches [34, 38]. In the present study, we have isolated, cloned, and carried out in silico functional characterization of DXS gene from A. paniculata for the first time. Further, we have done its tissue-specific expression in different plant parts. The effect of JA elicitation on the expression levels of rate-limiting enzymes HMGR and DXS from MVA and MEP pathways, respectively, was carried out in JA-elicited in vitro adventitious root cultures correlating with andrographolide production to understand the synergy within elicitation vis-à-vis the cross talk between metabolic networks.Although the DXS gene from other plants has been isolated and analyzed, isolation of DXS gene from A. paniculata was not reported earlier. Here, the successful isolation of full-length cDNA of DXS gene from A. paniculata and its heterologous expression in E. coli provides a basis for a genetic resource for its exploitation. In earlier studies, the cloning, characterization, and overexpression of DXS gene showed increased abietane diterpenes and steviol glycosides synthesis in Salvia sclarea and Stevia plants, respectively [18, 21]. ApDXS encoded a protein of 691aa long which is in the range of plant DXSs. In general, the plant DXS protein ranged from 691 to 738aa long [19, 20, 39–41]. The deduced amino acid sequence upon BLAST showed high similarities with plant DXS super family genes, indicating its close proximity to other functional DXS proteins. Further, the main objective of our study was to generate and provide the genomic information of DXS as a genetic resource from A. paniculata for the first time, and it fulfills our goal giving an indication that ApDXS gene is active in transcription stage. Here, in our study, qRT-PCR was employed to investigate the expression profiles of ApDXS gene in different tissues, including leaves, stems, and roots. Gene expression profiling revealed differences in expression pattern as observed in Populus trichocarpa and Artemisia annua plants earlier. The tissue-specific expression of DXS suggested its elevated expression levels in leaves compared to the stem and roots [19, 42]. Our initial studies have shown that the andrographolide content was highest in the leaves, followed by stem and roots. High-expression levels of ApDXS in leaves were observed similar to findings in other plants such as Arabidopsis thaliana [43], Amomum villosum [44], Aquilaria sinensis [45], and Tripterygium wilfordii [46]. In our previous report, we found ApHMGR of the MVA pathway was highly expressed in roots than the stem and leaves. It was identified that HMGR expression was higher in roots (2.5 fold) followed by stem (twofold) and leaf tissues (1.5 fold) [34]. Hence, we could draw a conclusion that DXS from MEP and HMGR from MVA pathway have prominent roles for the production of andrographolide and other DLs. Therefore, the tissue-specific expression could be used for the manipulation of biosynthetic pathways localized in these plant parts for the biosynthesis of specific secondary metabolites.The findings on tissue-specific expression imply that, the ApDXS gene expression was relatively low in the roots in comparison to that in the leaves in vivo. Although its expression is low in roots, the potential of in vitro adventitious root cultures cannot be apparently overruled for andrographolide biosynthesis. In order to deduce the underlying molecular mechanism and regulation of the rate limiting genes of MEP and MVA pathways for the biosynthesis of andrographolide, we categorically carried out in depth study involving JA mediated elicitation using in vitro adventitious root cultures. Differential expression of ApDXS from MEP pathway and ApHMGR from MVA pathway was studied. The mechanism of action of JA elicitation has already been discussed earlier [47]. The influence of both in vitro culture conditions and JA elicitation was considered. The relative expression levels of the ApDXS and ApHMGR genes in elicited in vitro adventitious root cultures showed different degrees of gene expression patterns over the course of JA treatments for 4 weeks. Further, a significant increase in andrographolide accumulation was recorded after JA elicitation treatment. The expression of ApDXS increased gradually from the second week, whereas ApHMGR was enhanced from first week to fourth week in all the concentrations. The elicitation with JA in all concentrations except 100 µM (at 3rd week) did not promote biomass enhancement of adventitious roots. Although biomass was not enhanced, biosynthesis of andrographolide was observed to be elevated from HPLC and qRT-PCR experiments. The results of these experiments indicated that ApDXS and ApHMGR played significant roles in the biosynthesis of DLs (andrographolide) in JA-elicited adventitious roots. The transcription levels of both the genes in JA-treated adventitious roots were enhanced gradually with increased JA concentrations and maintained levels well above compared to untreated control. Maximum expression level of ApDXS and ApHMGR was observed at 25 µM followed by 50 µM of JA. Compared to ApDXS expression, ApHMGR gene expression was low but significantly enhanced than untreated controls. Upregulation of ApHMGR was started after the first week and gradually increased till the fourth week in all the concentrations. Evidently, the higher expressions of ApDXS and ApHMGR genes at 25 µM and 50 µM with higher andrographolide synthesis indicated the crucial role of these two genes and the synergy between MVA/MEP pathways. Singh et al. [48] reported that untreated control, in vitro adventitious root cultures of A. paniculata have shown high-expression levels of MVA pathway genes (HMGR1/2) and low expression of MEP pathway genes (DXS1/2 and HDR1/2). However, in our study, an external stimulus JA not only enhanced the MEP pathway-related gene expression, but also significantly influenced MVA pathway genetic. Several studies from plants, e.g., maize, rice, barley, and Medicago roots [49, 50], Ginkgo biloba [51], Picea abies [52], and Pinus densiflora [53], have shown that, DXS gene displayed a consistent expression pattern when subjected to external stimuli (electors: MeJA, MeSA, Chitosan, Arbuscular mycorrhizal fungi, etc.) for isoprenoid-derived secondary metabolites.A search with the BLASTp program indicated that the ApDXS was highly homologous to DXS sequences from other plants signifying its lineage to the DXS gene and protein family. 3D model of ApDXS was generated, validated, and reported earlier by Srinath et al. [54] and was used for in silico docking studies. Our study finds significance, since plant DXS has no inhibitor-bound co-crystal structure known which makes a structure-based ligand optimization difficult [55, 56]. The ever-demanding need for the regulation of biosynthetic pathway for the enhancement of DLs requires more efforts to identify new molecular scaffolds in ApDXS. Studies of these enzyme–substrate/ligand interactions are relatively more important in molecular interventions to find the regulatory role of DXS and subsequent MEP pathway engineering for the enhanced biosynthesis of DLs [57, 58]. In silico molecular docking analysis brought in focus some important interactions of ApDXS enzyme to its ligands. In turn, these evidences could guide a rational design of new potential inhibitors for DXS. The docking studies from the present work in A. paniculata that revealed Arg (249, 252, 255), Asn (307), and Ser (247) amino acid residues are important and play a vital role in forming interactions. These amino acid residues and their interactions are expected to provide useful insights for the in vitro enzyme inhibition studies.Our present finding may be attributed to the JA mechanism of action in inducing genes and transcription factors in adventitious root cultures of A. paniculata [38, 47]. Such observation further highlighted the combo action of in vitro adventitious root cultures, and JA elicitation can contribute towards understanding the gene expression pattern and biosynthesis of andrographolide and other DLs. Previous studies on elicitation and identification of gene regulation pattern for secondary metabolite production give credence to the present findings [59-62].
Conclusion
Although the MEP pathway was discovered two decades ago, the key genes are not fully characterized yet. Isolation of the genes responsible for the rate-limiting enzymes is a positive step towards pathway manipulation. Due to the central role of this MEP pathway, identification of the major regulatory steps is of paramount importance for the growth and development of plants and their exploitation in human health care. In conclusion, we isolated full-length gene-encoding ApDXS which is involved in the biosynthesis of DLs in A. paniculata. Heterologous expression of the ApDXS was carried out in E. coli. The present study with the isolation and characterization of ApDXS contributed towards generating genetic resources in A. paniculata for its further exploitation. We analyzed the differential expression patterns of ApDXS in various tissues and identified the differential expression levels of ApDXS along with ApHMGR under JA elicitation using in vitro adventitious root cultures. The correlation between differential gene expression and andrographolide biosynthesis further confirmed that ApDXS and ApHMGR, the key regulatory enzymes of MEP and MVA pathways, were responsible for the biosynthesis of DLs in A. paniculata. These observations are useful in studying how the plastidial MEP pathway complements the cytosolic MVA pathway in different plant parts such as leaves, stem, and roots for producing the C5 units of andrographolide and other DLs. The given information on gene isolation, heterologous expression, and differential gene expression from our study will contribute to the understanding of andrographolide biosynthesis using elicitation of in vitro cultures as an experimental model. This study provides objective to explore possibilities for manipulating DXS and HMGR enzymes in onjunction with other downstream enzymes specific for the diterpene lactone biosynthesis. The present study indicated that the JA has substantially influenced the expression of DXS and HMGR from both MVA and MEP pathways and ultimately controlled the regulation of andrographolide biosynthesis in A. paniculata. This finding also suggests that the over expression of isolated gene and application of external stimuli such as JA can modulate the biosynthetic pathways to enhance the production of andrographolide and will be advantageous in pathway engineering using in vitro culture systems. The state-of-the-art bioinformatics and in silico docking findings from the present study have added valuable information about the essential structural attributes of the ApDXS protein needed for its function until experimental models become available in A. paniculata. Further, the present study with the isolation and characterization of ApDXS contributed towards generating genetic resources in A. paniculata for its manipulation.Below is the link to the electronic supplementary material.Supplementary file1 (DOCX 4381 KB)Supplementary file2 (XLSX 52 KB)
Authors: Elizabeth Cordoba; Helena Porta; Analilia Arroyo; Carolina San Román; Luis Medina; Manuel Rodríguez-Concepción; Patricia León Journal: J Exp Bot Date: 2011-01-03 Impact factor: 6.992