Ankita Sindhania1, Manoj K Das2, Gunjan Sharma1, Sinnathamby N Surendran3, B R Kaushal4, Himanshu P Lohani4, Om P Singh5. 1. National Institute of Malaria Research, Sector 8 Dwarka, New Delhi, 110077, India. 2. National Institute of Malaria Research, Field Unit, Itki, Ranchi, 835301, India. 3. Department of Zoology, University of Jaffna, Jaffna, 40000, Sri Lanka. 4. Department of Zoology, Kumaun University, Nainital, India. 5. National Institute of Malaria Research, Sector 8 Dwarka, New Delhi, 110077, India. singh@nimr.org.in.
Abstract
BACKGROUND: Anopheles subpictus and Anopheles sundaicus are closely related species, each comprising several sibling species. Ambiguities exist in the classification of these two nominal species and the specific status of members of these species complexes. Identifying fixed molecular forms and mapping their spatial distribution will help in resolving the taxonomic ambiguities and understanding their relative epidemiological significance. METHODS: DNA sequencing of Internal Transcribed Spacer-2 (ITS2), 28S-rDNA (D1-to-D3 domains) and cytochrome oxidase-II (COII) of morphologically identified specimens of two nominal species, An. subpictus sensu lato (s.l.) and An. sundaicus s.l., collected from the Indian subcontinent, was performed and subjected to genetic distance and molecular phylogenetic analyses. RESULTS: Molecular characterization of mosquitoes for rDNA revealed the presence of two molecular forms of An. sundaicus s.l. and three molecular forms of An. subpictus s.l. (provisionally designated as Form A, B and C) in the Indian subcontinent. Phylogenetic analyses revealed two distinct clades: (i) subpictus clade, with a single molecular form of An. subpictus (Form A) prevalent in mainland India and Sri Lanka, and (ii) sundaicus clade, comprising of members of Sundaicus Complex, two molecular forms of An. subpictus s.l. (Form B and C), prevalent in coastal areas or islands in Indian subcontinent, and molecular forms of An. subpictus s.l. reported from Thailand and Indonesia. Based on the number of float-ridges on eggs, all An. subpictus molecular Form B were classified as Species B whereas majority (80%) of the molecular Form A were classified as sibling species C. Fixed intragenomic sequence variation in ITS2 with the presence of two haplotypes was found in molecular Form A throughout its distribution. CONCLUSION: A total of three molecular forms of An. subpictus s.l. and two molecular forms of An. sundaicus s.l. were recorded in the Indian subcontinent. Phylogenetically, two forms of An. subpictus s.l. (Form B and C) prevalent in coastal areas or islands in the Indian subcontinent and molecular forms reported from Southeast Asia are members of Sundaicus Complex. Molecular Form A of An. subpictus is distantly related to all other forms and deserve a distinct specific status.
BACKGROUND:Anopheles subpictus and Anopheles sundaicus are closely related species, each comprising several sibling species. Ambiguities exist in the classification of these two nominal species and the specific status of members of these species complexes. Identifying fixed molecular forms and mapping their spatial distribution will help in resolving the taxonomic ambiguities and understanding their relative epidemiological significance. METHODS: DNA sequencing of Internal Transcribed Spacer-2 (ITS2), 28S-rDNA (D1-to-D3 domains) and cytochrome oxidase-II (COII) of morphologically identified specimens of two nominal species, An. subpictus sensu lato (s.l.) and An. sundaicus s.l., collected from the Indian subcontinent, was performed and subjected to genetic distance and molecular phylogenetic analyses. RESULTS: Molecular characterization of mosquitoes for rDNA revealed the presence of two molecular forms of An. sundaicus s.l. and three molecular forms of An. subpictus s.l. (provisionally designated as Form A, B and C) in the Indian subcontinent. Phylogenetic analyses revealed two distinct clades: (i) subpictus clade, with a single molecular form of An. subpictus (Form A) prevalent in mainland India and Sri Lanka, and (ii) sundaicus clade, comprising of members of Sundaicus Complex, two molecular forms of An. subpictus s.l. (Form B and C), prevalent in coastal areas or islands in Indian subcontinent, and molecular forms of An. subpictus s.l. reported from Thailand and Indonesia. Based on the number of float-ridges on eggs, all An. subpictus molecular Form B were classified as Species B whereas majority (80%) of the molecular Form A were classified as sibling species C. Fixed intragenomic sequence variation in ITS2 with the presence of two haplotypes was found in molecular Form A throughout its distribution. CONCLUSION: A total of three molecular forms of An. subpictus s.l. and two molecular forms of An. sundaicus s.l. were recorded in the Indian subcontinent. Phylogenetically, two forms of An. subpictus s.l. (Form B and C) prevalent in coastal areas or islands in the Indian subcontinent and molecular forms reported from Southeast Asia are members of Sundaicus Complex. Molecular Form A of An. subpictus is distantly related to all other forms and deserve a distinct specific status.
Anopheles subpictus and Anopheles sundaicus are closely related species belonging to Pyretophorus Series [1] and each has been reported to be comprised of several sibling members. Anopheles subpictus sensu lato (s.l.) is widely distributed species prevalent throughout Oriental and Australasian Zones; mainly in Afghanistan, Australia, Bangladesh, Cambodia, China, India, Indonesia, Iran, Malaysia, Maldives, Mariana Islands, Myanmar (Burma), Nepal, New Guinea (Island)-Papua New Guinea, Pakistan, Philippines, Sri Lanka, Thailand and Vietnam [2]. In India, An. subpictus s.l. is the most common species occurring in all the mainland zones [3] and is found up to 1900 above msl and in many parts of Himalayas, though in small numbers. Anopheles subpictus gradually declines in abundance proceeding eastwards in India [4]. Other nominal taxa, An. sundaicus., has been recorded mainly from the coastal areas of north-eastern India, Andaman & Nicobar (A&N) Islands, Peninsular Malaysia, Malaysian Borneo (Miri, Sarawak), northern Sumatra & Java, and Indonesia [5]. Currently, the distribution of An. sundaicus in India is limited to the A&N Islands and Kutch (western coast of India) [6, 7]. Anopheles sundaicus has been reported to be disappeared from Chilka (Odisha, India) [8], which has been reported earlier [9].In India, An. sundaicus is considered as a potent malaria vector, but An. subpictus has not been recognized yet as a malaria vector by the national malaria control programme [10]. However, An. subpictus is considered a potential vector in Southeast Asian countries [11-14]. In India, there are increasing evidences supporting the role of An. subpictus as a potential malaria vector, especially in coastal areas of India [15, 16] and Sri Lanka [17]. The varying vectorial potential in different geographical areas is most likely due to the presence of different biological species (cryptic species) present in An. subpictus. In India, four sibling species of An. subpictus, provisionally designated as species A, B, C and D have been recognized based on paracentric inversions present on the chromosome X [18]. However, the status of sibling species in other countries, except Sri Lanka (where species A and B were identified based on chromosomal inversions) [19], remains obscure. Though An. subpictus has been incriminated as a malaria vector in several places in India, mostly in coastal areas, the differential role of their sibling species in malaria transmission is not well understood. Apparently, species B is an efficient vector of malaria, which is prevalent in coastal areas of India [19] and Sri Lanka [20]. Anopheles sundaicus comprises of four sibling species [5], designated as An. sundaicus sensu stricto (s.s), Anopheles epiroticus s.s. (formerly, An. sundaicus species A) [21], An. sundaicus species D [22, 23] and An. sundaicus species E [24]. All of them act as predominant malaria vectors depending upon the location [25].Morphologically, An. subpictus and An. sundaicus are almost similar and are distinguished based on the presence/absence of speckling on legs [26]. However, the taxonomic status of members of An. subpictus seems to be ambiguous based on the molecular phylogenetic studies which revealed that the majority of the morphologically attributed species B of An. subpictus is closely related to An. sundaicus complex and far distantly related to other members of An. subpictus s.l. [27, 28]. Therefore, Surendran et al. [27] recognized species B of Subpictus Complex as a member of Sundaicus Complex. Interestingly, species B of Subpictus Complex [29] and members of the Sundaicus Complex are prevalent mainly in coastal areas and islands [14], although ecological plasticity in the breeding preference has also been noted [5].Molecular characterization of An. subpictus from different geographical regions is important in identifying different biological forms, their distribution and role in malaria epidemiology. Studies carried out in Sri Lanka revealed the presence of two distinct molecular forms. Very recently, three additional molecular forms in respect of ITS2 has been reported from Thailand and Indonesia [30]. However, reliable published data on molecular forms of An. subpictus in Indian territory is not available. Few published and unpublished data from GenBank showed a high degree of polymorphism in ITS2 sequences, in the Indian population, to the extent that every individual was different [31-33], which raises suspicion in the quality of sequences. The verification of such data is warranted. Therefore, a study was carried out to characterize the rDNA of An. subpictus population from wide geographical areas in the Indian subcontinent in addition to closely related species An. sundaicus.For molecular characterization, nuclear ribosomal DNA (rDNA), particularly ITS2 and 28S rDNA was selected, which have been extensively used in species identification due to their high uniformity in sequence in an interbreeding population, while differences exist between species [34]. Such uniformity of sequence in a species is believed to be due concerted evolution acting on rDNA, which tends to homogenize sequence [35]. The homogenization of rDNA is thought to be due to unequal crossing over of rDNA copies arranged in a tandem fashion, however, the phenomenon has not been fully understood [36]. On the other hand mitochondrial DNA, COI in particular has also been successfully used in barcoding of life where sufficient gap, known as ‘barcoding gap’ (an arbitrary threshold), exists between intraspecific variation and interspecific divergence. In closely related species, such gap often does not exist, but a high percentage of well-differentiated species has similar or even identical COI sequences [37], particularly in dipteran [38]. Such overlap may be due to the retention of ancestral polymorphism and introgression [36]. Moreover, rDNA is thought to be advantageous over the mtDNA in terms of the speed of lineage sorting of its multicopy rDNA array [36].
Methods
Mosquito collection
Adult female An. subpictus and An. sundaicus were collected from different parts of the Indian subcontinent, mainly from mainland India, A&N Islands (India) and Sri Lanka. From mainland India, mosquitoes were collected from Ranchi (Jharkhand, 23° 21′ N, 85° 18′ E), Nuh (Haryana, 28° 06′ N, 76° 59′ E), Goa (15° 38′ N, 73° 45′ E), Alwar (Rajasthan, 27° 37′ N, 76° 35′ E), Jodhpur (Rajasthan, 26° 18′ N, 73° 00′ E), Gadchiroli (Maharashtra, 20° 10′ N, 80° 00′ E), Delhi (28° 34′ N, 77° 01′ E), villages surrounding Chilka lake (Odisha) and Puducherry. The villages surveyed surrounding Chilka lake, which is a large brackish water lagoon covering an area of over 1100 km2 in Orrisa state, were Panasapada (19° 43′ N 85° 31′ E), Satapada (19° 40′ N 85° 26′ E), Brahmgiri (19° 47′ N 85° 36′ E), Sipakuda (19° 23′ N 85° 04′ E), Minsa (19° 18′ N 84° 47′ E), Siara (19° 44′ N 85° 32′ E) and Gambhari (19° 72′ N, 85° 46′ E). In Puducherry, mosquitoes were collected from Kaliankuppam (12° 05′ N 79° 55′ E), Munjalkuppam (12° 02 N 79° 76′ E), Sedarapet (12° 00′ N 79° 44′ E), Pillayarkuppam (11° 48′ N 79° 46′ E). From A&N Islands, mosquitoes were collected from Kimios, Car Nicobar (9° 15′ N 92° 76′ E) and Sippighat, Port Blair (11° 59′ N 92° 68′ E). In Sri Lanka, mosquitoes were collected from Kallady (7° 42′ N 81° 42′ E), Muthoor (8° 27′ N 81° 16′ E), and Chenkalady (7° 47′ N 81° 35′ E). Few An. sundaicus collected from Thanbyuzayat Township, Mon State, Myanmar (15° 58′ N 97° 44′ E) were also included in the study. The geographical location of mosquito collection sites is depicted in Fig. 1. Mosquitoes were either preserved in isopropanol or kept dried in microcentrifuge containing a piece of silica gel crystal. Where feasible, live female mosquitoes were transported to the laboratory for oviposition and identification of sibling species based on the number of float-ridges on eggs. The adult female mosquitoes were identified morphologically using keys by Christophers [26] and Reid [39].
Fig. 1
Map showing geographical locations of study sites and distribution of different molecular forms of An. subpictus s.l. and An. sundaicus s.l
Map showing geographical locations of study sites and distribution of different molecular forms of An. subpictus s.l. and An. sundaicus s.l
Egg float-ridges count
Live An. subpictus mosquitoes were transported from mainland India only. The transported mosquitoes from the field were allowed to feed overnight on a rabbit. Eggs were obtained from individual morphologically identified gravid-females in a plastic bowl with the inner side lined with blotting paper and containing a small amount of water for keeping the blotting paper moist. The mosquitoes, which successfully laid their egg, were persevered in a microcentrifuge tube containing isopropanol for molecular studies. Eggs from individual mosquitoes were transferred on to microslides and the number of ridges on egg-floats obtained were counted under a transmission microscope using 10× objective lens. At least 10 eggs from each mosquito were examined. Based on the mode number of ridges, the mosquitoes were classified for sibling species following Suguna et al. [18].
DNA extraction, PCR amplification and sequencing
DNA was extracted from individual mosquitoes following Coen et al. [40]. Two adjacent regions of rDNA, i.e., ITS2 and partial 28S rDNA (D2-to-D3 domains), were PCR-amplified separately following Singh et al. [41]. In addition, to obtain a continuous stretch of rDNA covering partial 5.8S, full ITS2 and partial 28S rDNA (up to d3 domain) an approximately 2 kb region was also amplified using primers ITS2A and D3B (Table 1) from at least two representative samples of each molecular form of An. subpictus and An. sundaicus, and one sample of An. epiroticus. The PCR conditions were as described by Singh et al. [41], except extension time, which was increased to 1.5 min. The PCR products were cleaned using Exo-Sap IT (Thermo-Scientific) and sequenced using Big Dye Terminator v3.1 (Thermo-Scientific). The products were cleaned using the vendor’s protocol and electrophoresed in ABI-Prism 3770xl DNA sequencer. The sequencing of ITS2 PCR-products was done with the primers that were used for PCR amplification, i.e., ITS2A and ITS2B. Larger PCR products were sequenced using a primer walking strategy. The primers used for primer walking sequencing were ITS2A, ITS2B, D2A, D2B, D3A and D3B (sequences are provided in Table 1).
Table 1
List of primers used for DNA sequencing
Primers’ name
Nucleotide sequence (5′-3′)
Reference
ITS2A
TGT GAA CTG CAG GAC ACA T
Beebe and Saul [60]
ITS2B
TAT GCT TAA ATT CAG GGG GT
Beebe and Saul [60]
D2A
AGT CGT GTT GCT TGA TAG TGC AG
Campbell et al. [61]
D2B
TTG GTC CGT GTT TCA AGA CGG G
Campbell et al. [61]
D3A
GAC CCG TCT TGA AAC ACG GA
Litvaitis et al. [62]
D3B
TCG GAA GGA ACC AGT TAC TA
Litvaitis et al. [62]
COIIF
TCT AAT ATG GCA GAT TAG TGC A
Sharpe et al. [63]
COIIR
ACT TGC TTT CAG TCA TCT AAT G
Sharpe et al. [63]
SP6
ATTTAGGTGACACTATAG
Universal primer
T7
TAATACGACTCACTATAGGG
Universal primer
List of primers used for DNA sequencingFive individuals of each molecular form, except An. epiroticus (n = 1), were also sequenced for cytochrome oxidase II (COII) mitochondrial DNA. An approximately 750 bp region of the COII gene was PCR-amplified in a 20 µL reaction mixture using GOTaq Master Mix (Promega), 0.5 µM of each primer COIIF and COIIR (Table 1) and 0.5 µL of DNA. The PCR thermal cycling conditions were 95 °C for 2 min followed by 35 cycles each at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and a final extension at 72 °C for 7 min. The PCR products were cleaned using Exo-Sap IT (Thermo Scientific) and sequenced using Big Dye Terminator v3.1 (Thermo Scientific).
Cloning, sequencing and phasing of haplotypes
During the sequencing of ITS2 of a molecular form of An. subpictus (Form A) collected from mainland India and Sri Lanka, it was observed that the presence of mixed bases in DNA sequence chromatogram starting from a specific point due to the presence of indel in one of the two haplotypes present in the mosquito (Fig. 2). To phase out the sequence of two haplotypes, PCR product amplified for the ITS2 region of a total of five samples (three samples from mainland India, one each from Delhi, Ranchi and Kutch, and two samples from Sri Lanka) were sequenced after cloning. For cloning, briefly, PCR products were purified using Qiaquick PCR Purification Kit, cloned in pGEM-T Vector System (Promega) following vendor’s protocol and transformed into chemically competent Escherichia coli DH5α. The transformants were plated on LB-Agar containing 100 μg/ml ampicillin. White colonies were picked up and plasmid DNA was isolated by boiling them in 50 μl of TE buffer. At least five clones from each mosquito were sequenced using universal primers T7 and SP6 (sequences provided in Table 1).
Fig. 2
DNA sequence chromatograms of a portion of ITS2 (Forward and reverse) of An. subpictus form A, having indel in one haplotype. Hap_1 and Hap_2 in this figure represent haplotype 1 and 2, respectively
DNA sequence chromatograms of a portion of ITS2 (Forward and reverse) of An. subpictus form A, having indel in one haplotype. Hap_1 and Hap_2 in this figure represent haplotype 1 and 2, respectively
Sequence analyses and phylogenetic inferences
The DNA sequence chromatograms were edited using Finch TV (Geospiza, Inc.) and aligned using an online tool ClustalW 1.4 [42] available at https://www.genome.jp/tools-bin/clustalw. Since An. subpictus Form A had two haplotypes, arising due to 12 bp indel in a haplotype in ITS2 region, and sequence chromatograms were ambiguous from the point of indel, identification of two haplotypes were done on the basis of combining reads from forward sequences and reverse sequence (1X) up to the point of start of indel. The determination of sequence in the indel region was made empirically, as illustrated in Fig. 2.Phylogenetic analyses of ITS2 and 28S-D2-D3 were performed individually using software PAUP* version 4.0 beta 10 [43]. For phylogenetic analysis of ITS2, sequences of four An. sundaicus variants, i.e., An. epiroticus s.s. (variant I, GenBank accession no. AY768540), variant II (AY768541), An. sundaicus cytotype D (variant III, AY768542), An. sundaicus s.s. (variant IV, AY768543) [24], Anopheles indefinitus (GQ870332) and sequences of An subpictus variants from Thailand (MT068425 and MT068434) and Indonesia (MT068436) [30] were also used. Sequences of Anopheles fluviatilis (DQ345964) [41] and Anopheles gambiae (JN994138) were taken as outgroup taxa for ITS2, and An. gambiae (KC177663) and An. fluvialitis (DQ665846) [41] were taken as outgroup taxa for 28S-D2-D3 phylogenetic analysis. Anopheles gambiae was chosen as outgroup due to its phylogenetic proximity with An. subpictus and An. sundaicus complexes, whereas An. fluviatilis (belongs to Myzomyia series of subgenus Cellia) was chosen as it is phylogenetically relatively distant from An. subpictus and An. sundaicus complexes. ITS2 sequences of the Indian and Sri Lankan An. subpictus (published or submitted in GenBank) were not included in the analysis due to significant error in the sequences (to the extent that every individual was different [31-33]), resulting from quality issues mostly arising due to the presence of indel in one of the two haplotypes present in Form A, which is prevalent throughout mainland India and Sri Lanka. Maximum Likelihood (ML) methods were used for the construction of phylogenetic trees. The ML analyses were carried out using the heuristic searches and TBR branch-swapping algorithm with ten random taxon addition sequences. For ML-tree construction, the best evolutionary model of nucleotide substitution that fits the data were obtained using software Modeltest 3.7 [44]. The robustness of inference was calculated by the bootstrap method (1000 times) within PAUP. The estimated bootstrap values were reported as Maximum Likelihood bootstrap percentages (MLB).
Allele-specific PCR (ASPCR) for the identification of molecular forms of Anopheles subpictus in mainland India
Since the sequencing of a large number of samples was not feasible, a PCR assay was developed for the quick identification of two molecular forms, An. subpictus Form A and Form B, only forms prevalent in mainland India. A universal primer Sub F (5′-ACT GCA GGA CAC ATG AAC ACC G-3′) was designed from upstream of ITS2A sequence and two reverse primers namely SUBP-A (5′-CGT TAC ACG CAA CAA GCG AC-3′) and SPB (5′-GCC GAC ACC ACC AAC TG-3′), specific to Form A and B of An. subpictus, respectively, were designed. The expected amplicon sizes for Form A and B of An. subpictus are 563 and 444 bp, respectively. The PCR reaction (15 µl) was carried out using GOTaq Master Mix (Promega) and 0.2 µM of each primer. The PCR thermal cycling conditions were 95 °C for 2 min, followed by 35 cycles each at 95 °C for 30 s, 58 °C for 30 s, 72 °C for 45 s, and a final extension at 72 °C for 7 min. The PCR products were visualized on 2% agarose gel containing ethidium bromide under the gel documentation system. Numbers of samples on which ASPCR was performed have been given in Table 2.
Table 2
Number of mosquitoes identified into molecular forms of An. subpictus and An. sundaicus based on the rDNA (ITS2 and 28S-D2-D3) sequences and AS-PCR
Locality
Molecular forms
DNA sequencing
AS-PCRa
ITS2
28S-D2-D3
Nuh, India
An. subpictus Form A
4
4
86
Ranchi, India
An. subpictus Form A
63
19
15
Borio, India
An. subpictus Form A
2
2
10
Alwar, India
An. subpictus Form A
3
3
12
Jodhpur, India
An. subpictus Form A
2
7
7
Gadchiroli, India
An. subpictus Form A
4
4
25
Chilka, India
An. subpictus Form A
3
3
62
An. subpictus Form B
8
8
618
Goa, India
An. subpictus Form B
2
2
5
Puducherry, India
An. subpictus Form A
8
8
59
An. subpictus Form B
5
5
73
Sri Lanka
An. subpictus Form A
22
13
16
An. subpictus Form B
6
6
44
Portblair, A&N Island
An. subpictus Form C
5
5
ND
Carnicobar, A&N Island
An. subpictus Form C
5
5
ND
An. sundaicus D (variant IIIb)
12
12
ND
An. sundaicus (TK)
1
1
ND
Myanmar
An. epiroticus (variant Ib)
4
4
ND
ND not done
a Assignment of Form B or C of An. subpictus in a specific locality was done on the basis of molecular form present in the area as determined by DNA sequencing
b Designation of variants as per Dusfour et al. [24]
Number of mosquitoes identified into molecular forms of An. subpictus and An. sundaicus based on the rDNA (ITS2 and 28S-D2-D3) sequences and AS-PCRND not donea Assignment of Form B or C of An. subpictus in a specific locality was done on the basis of molecular form present in the area as determined by DNA sequencingb Designation of variants as per Dusfour et al. [24]
Results
DNA sequences analyses
Details of samples sequenced for 28S-D2-D3 and ITS2 are provided in Table 2. Analysis of sequences revealed a total of five distinct molecular forms (in respect to ITS2 and 28S rDNA combined), of which three forms were from morphologically identified An. subpictus and two from An. sundaicus. Sequences obtained from representative samples of each molecular forms (and haplotypes) after amplifying complete stretch of partial 5.8S rRNA, complete ITS2 and partial 28S rRNA (D1-D3 domain) have been shown in the aligned form in Additional file 1: Fig. S1. The sequences are also available from GenBank (accessions numbers: MW078484 to MW078490). The three forms of An. subpictus have been designated as molecular forms A, B and C. Form A of An. subpictus were recorded from mainland India and Sri Lanka, form B was found restricted to the coastal areas of mainland India (Chilka, Goa, Puducherry) and Sri Lanka island while form C from A&N Islands (Port Blair and Car Nicobar). The two molecular forms of An. sundaicus were identified as An. epiroticus s.s. and An. sundaicus species D based on homology with published ITS2 sequences [21, 23, 24]. The characterization of species was done based on the polymorphism at three nucleotide positions of ITS2, i.e., 479 (T/C), 538 (G/T) and 603 (C/indel) (nucleotide position as described by Linton et al.(2005) [21]). Nucleotide bases at these three sites for An. epiroticus, An. sundaicus D and An. sundaicus s.s. were TGC, CGC and CT- (dash denotes indel), respectively. The An. epiroticus s.s was recorded from Myanmar and Car Nicobar (A&N Island) and An. sundaicus species D from Port Blair and Car Nicobar (A&N Island). The sequence of An. epiroticus s.s. recorded from Myanmar had 100% homology to An. epiroticus s.s. [21] (variant I [24]). One sample of An. sundaicus from Car Nicobar also had 100% homology with An. epiroticus, but had mixed nucleotide bases (G+T) at the nucleotide position 538 (nucleotide position as per Linton et al. [21], where ‘G’ peak was substantially prominent as compared to ‘T’ (Fig. 3). This molecular form was identical to haplotype ‘TK’ designated by Zarowiecki et al. [57] and referred hereafter as An. sundaicus (TK). The ITS2 of An. sundaicus D was identical to variant III [24]. However, there was no difference in the 28S-D1-D3 sequence among all molecular forms of An. sundaicus.
Fig. 3
Portion of DNA chromatogram of ITS2 sequence of An. sundaicus (TK) from Car Nicobar island showing mixed bases (highlighted) at nucleotide base position 518 (base position as per Zarowiecki et al. 2014 [57])
Portion of DNA chromatogram of ITS2 sequence of An. sundaicus (TK) from Car Nicobar island showing mixed bases (highlighted) at nucleotide base position 518 (base position as per Zarowiecki et al. 2014 [57])
Intragenomic sequence variation in Anopheles subpictus molecular Form A
DNA sequencing of ITS2 of An. subpictus (Form A) resulted in mixed nucleotide peaks from a specific position of nucleotide sequence (from base position 450 in Additional file 1: Fig. S1) resulting in an ambiguous sequence (Fig. 2) from this point due to the presence of mixed haplotypes where one haplotype had indel. Phasing of haplotypes through sequencing of cloned PCR product revealed the presence of two haplotypes (referred to as haplotype 1 and haplotype 2 in Additional file 1: Fig. S1), which differ by indel/insert of 12. The presence of these two haplotypes was found fixed in Form A throughout its distribution from northern India to Sri Lanka.
Genetic distance and phylogenetic analyses
The genetic distances and number of nucleotide substitutions, considering ITS2 and 28S-D2-D3 sequences, between three molecular forms of An. subpictus (A, B and C), An. epiroticus and An. sundaicus D are shown in Table 3. It was observed that An. subpictus Form A is distantly related to all other molecular forms of An. subpictus and An. sundaicus, with nucleotide substitutions 100 to 106 and genetic distances 0.063 to 0.066 (Kimura-2-parameter). However, two molecular forms of An. subpictus, i.e., Form B and C, An. epiroticus and An. sundaicus species D are closely related (nucleotide substitution 1 to 10; Kimura-2-parameter genetic distance 0.001 to 0.006).
Table 3
Pairwise distances (Kimura-2 parameter model) (below diagonal) and nucleotide substitution (above diagonal) between different molecular forms of An. subpictus and An. sundaicus based on ITS2 and 28S-D2-D3
Sub_A
Sub_B
Sub_C
Epi
Sun_D
Sub_A
–
104
106
100
101
Sub_B
0.065
–
9
9
10
Sub_C
0.066
0.005
–
8
9
Epi
0.063
0.005
0.005
–
1
Sun_D
0.063
0.006
0.005
0.001
–
Sub_A: An. subpictus Form A; Sub_B: An. subpictus Form B; Sub_C: An. subpictus Form C; Epi: An. epiroticus (variant I); Sun_D: An. sundaicus D (variant III)
Pairwise distances (Kimura-2 parameter model) (below diagonal) and nucleotide substitution (above diagonal) between different molecular forms of An. subpictus and An. sundaicus based on ITS2 and 28S-D2-D3Sub_A: An. subpictus Form A; Sub_B: An. subpictus Form B; Sub_C: An. subpictus Form C; Epi: An. epiroticus (variant I); Sun_D: An. sundaicus D (variant III)Recently two new molecular forms of An. subpictus have been reported from Thailand and Indonesia with respect to ITS2 [30]. Therefore, a separate genetic distance analysis was performed, after including molecular forms reported from Thailand and Indonesia (representative GenBank sequences MT068425 and MT068436) [30] and An. indefinitus (GQ870332). The genetic distance and number of nucleotide substitutions are displayed in Table 4. It was observed that there is no genetic distance between Form C (India) and MT068436 (Indonesia) Table 4, but these sequences differed by 2 bp indel (Additional file 1: Fig. S1). Anopheles subpictus Forms B, C, molecular forms from Thailand and Indonesia (MT068425, MT068434, MT068436), An. epiroticus s.s., An. sundaicus species D and An. indefinitus are closely related (nucleotide substitution 0 to 10; Kimura-2-parameter genetic distance 0.0 to 0.018) and are distantly related to Form A (nucleotide substitution 48 to 52; Kimura-2-parameter genetic distance 0.094 to 0.105).
Table 4
Nucleotide substitution (above diagonal) and pairwise distances (Kimura-2 parameter model) (below diagonal) and between different molecular forms of An. subpictus and An. sundaicus based on ITS2 sequences
Sub_A
Sub_B
MT068425
Sub_C
MT068436
Epi
Sun_D
Ind
Sub_A
–
51
49
52
52
47
48
48
Sub_B
0.103
–
2
4
4
5
6
3
MT068425
0.099
0.004
–
4
4
3
4
1
Sub_C
0.105
0.008
0.008
–
0
7
8
5
MT068436
0.105
0.008
0.008
0
–
7
8
5
Epi
0.094
0.010
0.006
0.013
0.013
–
1
4
Sun_D
0.097
0.011
0.008
0.015
0.015
0.002
–
5
Ind
0.097
0.006
0.002
0.009
0.009
0.008
0.010
–
Sub_A: An. subpictus Form A; Sub_B: An. subpictus Form B; MT068425 (Thailand), Sub_C: An. subpictus Form C, MT068436 (Indonesia); Epi: An. epiroticus (variant I); Sun_D: An. sundaicus D (variant III); Ind: An. indefinitus
Nucleotide substitution (above diagonal) and pairwise distances (Kimura-2 parameter model) (below diagonal) and between different molecular forms of An. subpictus and An. sundaicus based on ITS2 sequencesSub_A: An. subpictus Form A; Sub_B: An. subpictus Form B; MT068425 (Thailand), Sub_C: An. subpictus Form C, MT068436 (Indonesia); Epi: An. epiroticus (variant I); Sun_D: An. sundaicus D (variant III); Ind: An. indefinitusThe phylogenetic analysis of all molecular forms of An. subpictus and An. sundaicus from the Indian subcontinent along with four variants in An. sundaicus, An. indefinitus and An. subpictus variants from Thailand and Indonesia were performed using ITS2 sequences. The best-fit model inferred for ITS2 sequences with outgroup taxa TPM2uf + G was taken for maximum likelihood (ML) analysis. Construction of phylogenetic tree resulted in two distinct monophyletic clades supported by high bootstrap value (100), i.e., subpictus clade comprising of the single molecular form of An. subpictus (Form A) and sundaicus clade comprising of An. subpictus Form B, An. subpictus Form C, molecular forms of An. subpictus from Thailand and Indonesia, all variants of An. sundaicus and An. indefinitus (Fig. 4).
Fig. 4
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon ITS2 sequence data. Numbers at nodes are ML bootstrap values (only > 80 are shown). The sequence name with astricks (*) are the sequences generated in this study
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon ITS2 sequence data. Numbers at nodes are ML bootstrap values (only > 80 are shown). The sequence name with astricks (*) are the sequences generated in this studyPhylogenetic tree was also constructed for 28S rDNA (D2-D3) sequences of all molecular forms of An. subpictus (Forms A, B and C), An. sundaicus D and An. epiroticus s.s. prevalent in the Indian subcontinent. The best-fit model of nucleotide substitution TIM3 + G was implemented in the construction of ML trees. Cladogram derived from 28S rDNA sequences also resulted in the generation of two distinct monophyletic clades similar to ITS2, supported with high bootstrap value (100) (Fig. 5).
Fig. 5
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon 28S-D2-D3 sequences. Numbers at nodes are ML bootstrap values (only > 80 are shown)
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon 28S-D2-D3 sequences. Numbers at nodes are ML bootstrap values (only > 80 are shown)Analysis of limited numbers of COII sequences of all representative molecular forms (based on rDNA sequences) revealed the presence of multiple haplotypes in each form. A total of 3/5 (number of haplotypes/number sequenced) haplotypes in An. subpictus Form A, 3/5 in Form B, 1/5 in Form C, 2/5 in An. sundaicus D and 1/1 in An. epiroticus were recorded. The Maximum Likelihood phylogeny estimate based on COII data for all molecular forms of Indian An. subpictus and An. sundaicus complex was constructed using software PAUP 4.0 beta. The best fit model used was GTR + I+G, as estimated by the Modeltest 3.7 [44] (Fig. 6). ML bootstrap values based on 1000 replicates were calculated. ML tree generated two distinct monophyletic clades similar to the phylogenetic tree based on rDNA. Based on COII phylogeny, An. subpictus form C was much closer to An. epiroticus than any members of An. subpictus.
Fig. 6
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon COII sequences. Numbers at nodes are ML bootstrap values (only > 80 are shown)
Maximum Likelihood (ML) rooted tree of different molecular forms of An. subpictus and An. sundaicus complex based upon COII sequences. Numbers at nodes are ML bootstrap values (only > 80 are shown)
Allele-specific PCR
Though this PCR was developed with an intension to differentiate the two forms of morphologically identified An. subpictus (An. subpictus Form A and Form B) in the Indian mainland and Sri Lanka, but upon discovery of additional species under the sundaicus clade (i.e., An. subpictus Form C) from A&N Islands, it was found that this PCR cannot differentiate An. subpictus Form B from An. subpictus Form C. However, this PCR can discriminate members of subpictus clade (An. subpictus A) and sundaicus clade (An. subpictus Form B, C, An. sundaicus D and An. epiroticus) (Fig. 7). This PCR was, therefore, used to differentiate molecular forms A and B of An. subpictus in areas where Form C or An. sundaicus was absent (mainland India and Sri Lanka).
Fig. 7
Gel photograph of allele-specific PCR used for the identification of molecular forms A and B in mainland India where only form A and B are prevalent. Lanes L: 100 bp DNA ladder, lane 1: An. subpictus Form B, lane 2: An. subpictus Form C, lane 3: An. subpictus Form A, lane 4: An. sundaicus D, lane 5: An. epiroticus, lane 6: negative control
Gel photograph of allele-specific PCR used for the identification of molecular forms A and B in mainland India where only form A and B are prevalent. Lanes L: 100 bp DNA ladder, lane 1: An. subpictus Form B, lane 2: An. subpictus Form C, lane 3: An. subpictus Form A, lane 4: An. sundaicus D, lane 5: An. epiroticus, lane 6: negative control
Distribution of different molecular forms of An. subpictus and An. sundaicus
The distribution of different molecular forms of An. subpictus and An. sundaicus in different localities as determined by DNA sequencing as well as by AS-PCR has been shown in Table 2 and Fig. 1. It was observed that An. subpictus Form A is prevalent throughout mainland India (found exclusively in inland areas) and Sri Lanka, whereas Form B was prevalent only in coastal areas or A&N islands. Anopheles subpictus Form C is prevalent only in the A&N Islands. Anopheles sundaicus D and An. epiroticus were found in Car Nicobar of A&N Islands.
Assignment of sibling species based on the mode number of float-ridges on eggs
The designation of sibling species of An. subpictus collected from mainland India was assigned based on the mode number of ridges on their egg’s float following Suguna et al. [18]. The distribution of sibling species based on the number of ridges and their molecular forms have been provided in Table 5. It was observed that all individuals (n = 51) belonging to molecular Form B were correctly assigned to species B based on the mode number of float-ridges. All molecular Form A (n = 97) which were identified as species A, C or D based on the mode number of float-ridges, of which majority (80%) fall under the species C category (Fig. 8). The mode number of float-ridges on eggs for form B ranged between 15 and 19, and for Form A between 22 and 33 (Fig. 9a). The number of float-ridges on individual eggs for Form B ranged between 14 and 20, and for Form A ranged between 21 and 35 (Fig. 9b).
Table 5
Distribution of An. subpictus sibling species based on number of float-ridges on eggs and their molecular forms
Localities
Assigned sibling species based on mode number of float-ridges (shown in parenthesis) and their molecular forms
Species B (16–20)
Species D (21–24)
Species C (25–29)
Unassigned (30)
Species A (31–36)
Form A
Form B
Form A
Form B
Form A
Form B
Form A
Form B
Form A
Form B
Nuh
–
–
7
–
46
–
1
–
–
–
Delhi
–
–
1
–
5
4
–
4
–
Jodhpur
–
–
–
–
4
–
2
–
–
–
Ranchi
–
–
–
–
1
–
–
–
–
–
Chilka
–
49
4
–
11
–
–
–
–
–
Puducherry
–
2
4
–
10
–
–
–
–
–
Fig. 8
Classification of An. subpictus collected from mainland India as sibling species based on mode number of float-ridges [18] and their molecular forms. Details of locations and number of samples have been provided in Table 5
Fig. 9
The frequency distribution of mosquitoes with mode number of floats-ridges (a) and eggs with number of float-ridges (b), among molecular form A and B prevalent in mainland India
Distribution of An. subpictus sibling species based on number of float-ridges on eggs and their molecular formsClassification of An. subpictus collected from mainland India as sibling species based on mode number of float-ridges [18] and their molecular forms. Details of locations and number of samples have been provided in Table 5The frequency distribution of mosquitoes with mode number of floats-ridges (a) and eggs with number of float-ridges (b), among molecular form A and B prevalent in mainland IndiaThe frequency distribution of mode number of float-ridges from individual mosquito progeny and number of float-ridges counts from individual egg (pooled data) for molecular Form A and B are shown in Fig. 9a and b, respectively. The figures clearly depict two independent curves, each showing normal distribution, one corresponding to molecular Form B (species B) and another for Form A (comprising of species A, C and D). Based on the distribution pattern of the number of floats-ridges that correlate with molecular forms, it is suspected that species A, C and D might be conspecific while species B is a distinct species.
Seasonal prevalence of An. subpictus Form A and B in areas surrounding brackish water lagoon and near coastal area
A survey was carried out in areas surrounding Chilka lake (a brackish water lagoon) and Puducherry (a coastal area) in monsoon and post-monsoon season, to know the relative prevalence of An. subpictus Form A and B in monsoon and post-monsoon season. In the Chilka lake area, only An. subpictus Form B was found in the dry season (post-monsoon) when there is no freshwater breeding source available except a large brackish water lagoon. In the monsoon season, when fresh water breeding habitat is prevalent beside brackish water lagoon, Form A was also present (4.7 to 7.6%) alongside Form B. In another area, Puducherry (a coastal area), the proportion of species B was much higher in post-monsoon as compared to autumn. The relative proportion of An. subpictus Form A and B in the area surrounding Chilka Lake and coastal area of Puducherry in monsoon and post-monsoon season has given in Table 6. The data indicate that the prevalence of Form A of An. subpictus determined by the availability of freshwater breeding sources.
Table 6
Relative prevalence of An. subpictus Form A and B in monsoon and post-monsoon season in areas surrounding Chilka Lake (brackish water lagoon) and Puducherry (coastal area)
Location
Season
Date of collection
Number of samples identified as
Form Aa
Form Ba
Chilka Lake, Odisha, India
Post-monsoon
Feb 2017
0
84 (100)
Feb 2018
0
94 (100)
Monsoon
Sept–Oct 2017
4 (4.76)
80 (95.24)
Sept 2018
16 (6.58)
227 (93.42)
July–Aug 2019
11 (7.64)
133 (92.36)
Puducherry, Tamil Nadu, India
Post-monsoon
Feb–Mar 2020
8 (11.76)
60 (88.24)
Autumn
Nov 2019
51(79.68)
13 (20.31)
a Figures in parenthesis represent percentage proportion
Relative prevalence of An. subpictus Form A and B in monsoon and post-monsoon season in areas surrounding Chilka Lake (brackish water lagoon) and Puducherry (coastal area)a Figures in parenthesis represent percentage proportion
Discussion
Correct identification of anophelines and their sibling species is crucial for the success of any malaria control programme because of possible inherent variations in the epidemiologically-important biological characteristics among sibling species, e.g., vectorial competence [45, 46], insecticide resistance [47-50] and host preference [51, 52]. In India, An. sundaicus is considered as an efficient malaria vector, whereas An. subpictus has not been recognized so far as a malaria vector by the national malaria control programme [10]. However, published evidences suggest that at least coastal form of An. subpictus is a malaria vector [15, 16]. On the other hand, An. subpictus is considered as an important malaria vector in coastal Malaysia [14] and Indonesia [12, 13]. These geographically isolated populations differ in breeding preference, where the Malayan population prefers to breed in brackish water, unlike the majority of Indian An. subpictus populations that prefer to breeds in freshwater [14]. In view of the presence of such difference in biological characteristics, recognition of sibling species or ‘fixed’ molecular forms in geographically widely distributed An. subpictus population is an important consideration in understanding their relative epidemiological significance.So far, four sibling species have been described from a south Indian population of An. subpictus s.l. (provisionally designated as species A, B, C and D) based on the arrangement of inversions present on two loci on the polytene chromosome X [18]. To the best of our knowledge, this technique has not been effectively used for the identification of sibling species in An. subpictus, except in a neighbouring country, Sri Lanka [20], where inversions on a single locus (X+a and Xa), out of two diagnostic loci (Xa/+a and Xb/+b), were examined (which preclude the identification of species C and D). Identification of sibling species in malaria control programme is challenging due to the non-availability of simpler technique, as an alternative to the cytological technique that requires a highly specialized skilled personnel to read banding patterns. Moreover, the cytological technique can be applied only on a fraction of a population, i.e., only live semi-gravid female mosquitoes. As an alternative, molecular tools can be used for the identification of sibling species which are easier and can be applied to dead or alive mosquitoes of either sex. Identification of ‘fixed’ molecular form of rDNA, particularly in ITS2, is a primary step toward the recognition of sibling species. In this direction, ITS2 of An. subpictus populations have been characterized in Sri Lankan [27], Thai and Indonesian population [30], however, reliable data on molecular forms from India is lacking. The present study is an attempt to characterize all the molecular forms of morphologically identified An. subpictus and An. sundaicus prevalent in the Indian subcontinent to uncover hidden cryptic species, distribution pattern and to establish their phylogenetic relationship. Characterization of molecular forms will help in identifying sibling species and developing a reliable and simpler method for their identification. Characterization of An. sundaicus was included in this study in view of the report of incongruence in molecular taxonomy with formal (morphological) taxonomy, where one molecular form of An. subpictus (mostly species B) was found to be a close relative of An. sundaicus [27]. As a result, Surendran et al. [27] recognized them as a member of the Sundaicus Complex. Earlier phylogenetic study on Sri Lankan An. subpictus [27, 28] was based on partial ITS2 and D3 domain of 28S rDNA. In this study, full length ITS2 sequence and 28S-D1-D3 was used to identify molecular forms of both An. subpictus and An. sundaicus from the Indian subcontinent.This study revealed the presence of a total of five molecular forms in Sundaicus-Subpictus complex in the Indian subcontinent (both by ITS2 as well as 28S-D1-D3): three molecular forms present in morphologically identified An. subpictus (Form A, B and C) and two molecular forms in An. sundaicus complex. Phylogenetic analysis using two regions of rDNA revealed two distinct clades where An. subpictus Form B and C, An. epiroticus, all members of Sundaicus Complex and An. indefinitus falls under one clade (Sundaicus) and one molecular form, Form A, falls under distantly related clade (Subpictus). Thus, the phylogenetic relationship showed incongruence with the morphological delimitation of the species. In an earlier study, Surendran et al. [27] showed that most of the An. subpictus species B (Form B in this study) from Sri Lanka fall under Sundaicus complex and, therefore, considered as a member of Sundaicus Complex. This study include another molecular form of An. subpictus, i.e., Form C, found in A&N Island as a member of Sundaicus Complex. The two molecular forms very recently reported from Indonesia and Thailand [30] also fall in the same clade and closely related to Indian molecular forms Form B and C.The designation of molecular forms in this study is based on ribosomal DNA (ITS2 and 28SrDNA), where no intraspecific variation in a specific population (due to concerted evolution) was observed, as seen in mitochondrial DNA (maternally inherited and mutations are passed through generations). The absence of individual variation in DNA sequences in molecular forms of An. subpictus across wide geographical areas is contrary to the findings by Kaura et al. [31], Chattopadhyay et al. [32] and Chhilar et al. [33], where they recorded individual variation in ITS2 sequences in samples collected from inland India. These sequences are very similar to Form A and it is suspected that individual differences in ITS2 sequences presented in above-mentioned publications is due to errors in the sequence-read of Form A, possibly arising due to the 12 bp indel in one haplotype leading to ambiguous sequence beyond the point of indel in sequence read. Interestingly, the intragenomic variation in Form A, with the presence of two haplotypes, was found fixed throughout its distribution, from north India to Sri Lanka. The fixed molecular forms based on rDNA, which are sympatric, deserve distinct specific status, but the specific status of closely related molecular forms, which are allopatric, is obscure. Thus the two molecular forms A and B found in sympatry in southern Asia (India and Sri Lanka) are genetically isolated but the specific status of other molecular forms found in South-east Asia (A&N Islands, Thailand and Indonesia) is not certain.Wilai et al. [30] reported that An. subpictus from Thailand and Indonesia are different from India and Sri Lanka. They recorded two types of ITS2 sequences from Thailand which were identical except in one type of sequence. There was a mixed nucleotide base at one position. It is unlikely that these two forms are reproductively isolated. The specific status of allopatric molecular forms cannot be ascertained using population genetic analysis, which can be verified using crossing experiments only. Recently, Wilai et al. [30] has carried out crossing experiments in two forms having different mtDNA sequence (but same molecular forms with respect to ITS2) and found genetic compatibility between them. These two mtDNA forms may be considered as intraspecific variation because such variation is common in mtDNA being inherited maternally. Similar intraspecific variation were also found in this study where multiple haplotypes of COII mtDNA were recorded, even in small numbers of samples studied. The molecular forms reported from Thailand and Indonesia were very close to Indian molecular forms B and C with a very low genetic distance ranging from 0.0 to 0.018 (with respect to ITS2). The lack of genetic distance between Indonesian An. subpictus and Form C was due to 100% similarity in sequences except presence of two bp indel in Form C.Interestingly two molecular forms of An. subpictus s.l., Form B and C, which falls under sundaicus clade, are found in coastal areas or islands. This may be due to their breeding preference is brackish water, similar to most of the members of An. sundaicus complex. This is complemented by the fact that, in Chilka Lake (a brackish lagoon), Form B was found exclusively in Post monsoon season (October and February), while this was present along with Form A in Monsoon season (August–September) when freshwater breeding habitats are abundantly present beside brackish water habitat. Suguna [29] and Panicker et al. [15] also found species B of Subpictus Complex along with species A in the rainy season. These observations indicate that Form B and Form C of An. subpictus, found in coastal areas or islands, has a preference to breed in brackish water. Another form of An. subpictus, Form A, which is widely distributed throughout inland India, appears to breed in freshwater.Review of literature shows that species B of An. subpictus, found mainly in coastal areas [19, 20], is a potential malaria vector [15, 53]. Recently An. subpictus was reported be a potential malaria vector from Goa (coastal area) [16]. This study confirms presence of molecular form B in Goa, It appears that molecular Form B (species B) is playing role in malaria transmission, however, further study is warranted. However, in some inland areas, An. subpictus has been found to have sporozoite in their salivary glands [53-55]. The differential role of these molecular forms in malaria transmission need to be confirmed.An attempt was made to classify sibling species of Form A and B of the Subpictus Complex, prevalent in mainland India based on the mode number of float-ridges. All the molecular Form B were correctly classified as species B while the majority of Form A were characterized as species C. Frequency distribution pattern of float-ridges clearly shows two distinct peaks, one peak corresponds to molecular Form A and another peak corresponds to Form B. It appears that all molecular Form A is a single species. Because majority of species C identified based on ridges on egg-floats belong to molecular Form A, it is erroneous to assign them as ‘Species A’ [27, 56]. It is recommended that they may be described as molecular Form A instead of Species A. However, molecular Form B may be designated as ‘Species B’. It is evident from our data that molecular method as well as mode number of float ridges can correctly identify species B, and can differentiate them from molecular Form A. However, morphological identification based on egg’s ridges has certain limitations. It cannot differentiate species B from An. sundaicus due to overlapping range of ridges (range 16 to 20). Moreover, morphological identification based on the number of ridges is a cumbersome process and can be used with only live and gravid female mosquitoes, whereas molecular method can be applied on dead or alive mosquitoes irrespective of life stages and sex.Anopheles sundaicus is widely distributed species and a malaria vector in the coastal region of Southeast Asia [25]. In India, this is the most prevalent and important malaria vector in the A&N Islands. Earlier studies by Nanda et al. [22] and Alam et al. [23] revealed the presence of only one sibling species in A&N Islands, i.e., An. sundaicus D (variant III). This study confirms the presence of An. sundaicus D in A&N islands (Port Blair and Car Nicobar). This study also recorded the presence of an additional molecular form in the Sundaicus Complex, An. sundaicus (TK), in Car Nicobar island, though just one specimen out of small sample size (n = 52). Further studies are required to explore the presence of this molecular form or new cryptic species in this area. In addition, the presence of An. epiroticus s.s. was recorded in Myanmar, which is in agreement with Dusfour et al. [24]. An. sundaicus (TK) recorded from Car Nicobar island was identical to An. epiroticus but had mixed haplotypes of ITS2, unlike An. epiroticus from Myanmar or classic An. epiroticus. A similar variant has been reported in Indonesia, Thailand and Vietnam [57, 58]. Dusfour et al. [24] reported combinations of variants I and III, II and III, and I, II and III in continental Southeast Asia. Syafruddin et al. [58] hypothesized that such mixed bases may be due to possible hybridization/introgression between sympatric sibling species.In this study, a new PCR based assay was developed for the differentiation of members of sundaicus and subpictus clade. Initially, it was designed to differentiate Form A and B of Subpictus Complex but, later upon discovery of Form C, it was found that this could not differentiate Form B and C. However, this PCR can differentiate unambiguously members of Sundaicus (An. subpictus Form A) and subpictus clade (An. subpictus Form B, Form C and An. sundaicus). A similar ASPCR assay was developed by Surendran et al. [28], but a new assay was developed because it was noticed that this ASPCR has cross-reactivity with other Indian malaria vector Anopheles stephensi, which has superficial resemblance with An. sundaicus [26] and often misidentified in old specimens with lost palpal ornamentation and scales.This study has certain limitation. In absence of data on inversion genotypes of the polytene chromosome of An. subpictus, association of molecular forms with previously designated sibling species could not be correlated. Recently one new species Anopheles pseudosundaicus belonging to the Pyretophorus series [59] has been designated from Kerala, southwest India, which unlike An. sundaicus does not have speckling on legs and closer to An. subpictus based on the DNA sequence of cytochrome oxidase C subunit 1. However, access to this molecular data has not been made public. Therefore, it could not be ascertained if this species is one of the molecular forms described in this study. A more elaborate study on molecular characterization of all cytological forms of An. subpictus is desirable.
Conclusions
Based on nuclear rDNA sequences, three fixed molecular forms (Form A, B and C) were identified in the morphologically classified An. subpictus s.l. and two forms in An. sundaicus s.l. in the Indian subcontinent. Molecular phylogenetic analysis revealed two diverse clades of mosquitoes where two molecular forms (B and C) of morphologically identified An. subpictus found mainly in coastal areas or islands along with molecular forms reported from Thailand and Indonesia were found to be close relative of An. sundaicus. A molecular form of An. subpictus, Form A, prevalent in mainland India and Sri Lanka, has fixed intragenomic sequence variation in ITS2 throughout its distribution with the presence of two haplotypes differing by 12 bp indel.Additional file 1: Fig. S1. Alignment of rDNA sequences (ITS2 to D3 domain of 28S) of different molecular forms of An. subpictus s.l., and An. sundaicus complex s.l.
Authors: Sinnathamby N Surendran; Pavilupillai J Jude; Thilini C Weerarathne; S H P Parakrama Karunaratne; Ranjan Ramasamy Journal: Parasit Vectors Date: 2012-02-10 Impact factor: 3.876