| Literature DB >> 33204706 |
O Abida1, E Bahloul2, N Elloumi1, A Toumi1, Safa Tahri1, M Ben Jmaa1, R Fakhfakh1, N Mahfoudh3, H Turki2, H Masmoudi1.
Abstract
Pemphigus foliaceus (PF) is considered to be caused by the combined effects of susceptibility genes and environmental triggers. The polymorphisms of Toll-like receptors (TLRs) genes have been associated with the risk of various autoimmune diseases. The aim of this study was to evaluate the potential association of TLR2-3-4 and 7 gene polymorphisms with Tunisian PF. Fourteen polymorphisms were analyzed in 93 Tunisian PF patients compared to 193 matched healthy controls: rs5743703-rs5743709 and (GT)n repeat (TLR2); rs5743305, rs3775294, and rs3775291 (TLR3), rs4986790 and rs4986791 (TLR4); and rs3853839 (TLR7). Our results showed that the genetic factors varied depending on the epidemiological feature stratification. In fact, in the whole population, no association with the susceptibility to PF was found. The TLR2 GT repeat seems to be closely associated with PF risk in patients originated from the endemic localities (group 3); the GT18 allele and the heterozygous genotype GT18/GT19 seem to confer risk to endemic PF (P = 0.02; OR = 2.3 [1.1-4.9] and P = 0.0002, OR = 20 [2.5-171], respectively). In contrast, the GT23 repeat could be considered as protector allele (P = 0.02, OR = 0.2 [0.06-0.87]). Furthermore, medium GT alleles which induce high promoter activity were also significantly more frequent in patients versus short or long GT repeats (P = 0.0018 with OR = 3.26 [1.5-7]). On the other hand, the TLR3-rs574305 AA genotype and A allele were significantly more frequent in patients whose age of the onset was above 35 years (group 2) (P = 0.038, OR = 1.78 and P = 0.009, OR = 3.92, respectively). Besides, the TLR4>rs3775294 A allele was found to be protector only in patients with sporadic features (groups 2 and 4) (P = 0.03, OR = 0.57 [0.3-0.9] and P = 0.006, OR = 0.24 [0.08-0.74], respectively). No statistically significant difference was observed in the genotypic and allelic frequencies of TLR-4 and TLR-7 gene polymorphisms. The present data suggest that TLR2and TLR3 polymorphisms are significantly associated with increased susceptibility to PF in the Tunisian population.Entities:
Mesh:
Substances:
Year: 2020 PMID: 33204706 PMCID: PMC7661111 DOI: 10.1155/2020/6541761
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Figure 1Flowchart for the inclusion and exclusion of the studied patients. DIF: direct immunofluorescence; Dsg: desmoglein, IIF: indirect immunofluorescence.
Primary information of genotyped polymorphisms in TLR2, 3, 4, and 7 genes.
| Gene | SNPs | Base change | Localization | Primers | Enzyme |
|---|---|---|---|---|---|
|
| rs5743703/04/05/06/07/09 | G/A-C/A-T/C-T/A-T/G-G/A | Exon 1 | F: 5′-GGCCAGCAAATTACCTGTGT-3′ | ┼ |
| rs5743708 | +2477 G/A (Arg753Gln) | Exon 1 | F: 5′-GGCCAGCAAATTACCTGTGT-3′ |
| |
| (GT)n | — | Intron 2 | F: 5′-TATCCCCATTCATTCGTTCCATT-3′ | $ | |
|
| rs5743305 | -8441 T/A | Promotor | F: 5′-GGGACAGTCACGTACTCAGGA-3′ |
|
| rs3775294 | T/C | Intron 2 | F: 5′-CACATGGCTTATCAAACACAC-3′ |
| |
| rs3775291 | +1234 G/A (Leu412Phe) | Exon 4 | F: 5′-ATCAGTCGTTGAAGGCTTGG-3′ |
| |
|
| rs4986790 | +896A/G (Asp299Gly) | Exon 4 | F: 5′-GATTAGCATACTTAGACTACTACCTCCATG-3′ |
|
| rs4986791 | +1196 C/T (Thr399Ile) | Exon 4 | F: 5′-GGTTGCTGTTC CAAAGTGATTTTGGGACAA-3′ |
| |
|
| rs3853839 | C/G | 3′UTR | F: 5′TTGCTTCCGTGTCATCCAGG3′ |
|
┼: SNPs were genotyped by direct sequencing; $: primers as described previously [24] and was genotyped using the automatic genotyping method.
Genotype and allele frequencies of TLR3, 4 and 7 studied SNPs in Pemphigus foliaceus patient's groups and their relative matched healthy controls.
| Group 1 | Group 2 | Group 3 | Group 4 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene/SNP | Case | Controls |
| Case | Controls |
| Case | Controls |
| Case | Controls |
|
|
| ||||||||||||
| A | 27 (24.5) | 58 (34.9) | 0.067 | 30 (39.4) | 59 (26.8) | 0.038 | 18 (24.3) | 50 (36.2) | 0.07 | 39 (34.8) | 67 (27) | 0.13 |
| T | 83 (75.4) | 108 (65) | 46 (60.5) | 161 (73.1) | 56 (75.6) | 88 (63.7) | 73 (65.1) | 181 (72.9) | ||||
| AA | 7 (12.7) | 17 (20.4) | 0.23 | 8 (21) | 7 (6.3) | 0.009 | 4 (10.8) | 12 (17.3) | 0.36 | 11 (19.6) | 12 (9.6) | 0.063 |
| AT | 13 (23.6) | 24 (28.9) | 0.4 | 14 (36.8) | 45 (40.9) | 0.6 | 10 (27) | 26 (37.6) | 0.26 | 17 (30.3) | 43 (34.6) | 0.5 |
| TT | 35 (63.6) | 42 (50.6) | 0.1 | 16 (42.1) | 58 (52.7) | 0.2 | 23 (62.1) | 31 (44.9) | 0.09 | 28 (50) | 69 (55.6) | 0.4 |
|
| ||||||||||||
| C | 36 (37) | 57 (36.5) | 0.9 | 29 (32.5) | 108 (51.9) | 0.03 | 31 (50) | 58 (44.6) | 0.4 | 34 (26.4) | 107 (45.7) | 0.006 |
| T | 62 (63) | 99 (63.4) | 47 (67.5) | 100 (48) | 31 (50) | 72 (55.3) | 78 (73.5) | 127 (54.2) | ||||
| CC | 7 (13) | 14 (17.9) | 0.5 | 6 (16) | 32 (30.7) | 0.07 | 9 (29) | 18 (27.6) | 0.8 | 4 (7.2) | 28 (23.9) | 0.007 |
| CT | 22 (45) | 29 (37.1) | 0.4 | 17 (45) | 44 (42.3) | 0.1 | 13 (42) | 22 (33.8) | 0.7 | 26 (46.4) | 51 (43.5) | 0.7 |
| TT | 20 (42) | 35 (44.8) | 0.6 | 15 (39) | 28 (26.9) | 0.1 | 9 (29) | 18 (27.6) | 0.8 | 26 (46.4) | 38 (32.4) | 0.07 |
|
| ||||||||||||
| A | 12 (11) | 12 (7.4) | 0.29 | 9 (12.5) | 26 (12.2) | 0.95 | 8 (10.5) | 10 (7.4) | 0.44 | 13 (12.5) | 28 (11.6) | 0.85 |
| G | 96 (89) | 150 (92.5) | 63 (87.5) | 186 (87.7) | 68 (89.4) | 124 (92.5) | 91 (87.5) | 212 (88.3) | ||||
| AA | 0 | 1 (1.2) | 0 | 0 | — | 0 | 0 | — | 0 | 1 (0.8) | 0.78 | |
| AG | 12 (22.2) | 10 (12.3) | 0.1 | 9 (25) | 26 (24.5) | 0.9 | 8 (21) | 10 (14.9) | 0.4 | 13 (25) | 26 (21.6) | 0.63 |
| GG | 42 (77.7) | 70 (86.4) | 0.1 | 27 (74.9) | 80 (75.4) | 0.9 | 30 (78.9) | 57 (85) | 0.4 | 39 (74.9) | 93 (77.5) | 0.7 |
|
| ||||||||||||
| A | 98 (94.2) | 148 (91.3) | 0.38 | 73 (96) | 201 (95.7) | 0.89 | 70 (94.5) | 124 (92.5) | 0.57 | 101 (95.2) | 225 (94.5) | 0.77 |
| G | 6 (5.7) | 14 (8.6) | 3 (3.9) | 9 (4.2) | 4 (5.4) | 10 (7.4) | 5 (4.7) | 13 (5.4) | ||||
| AA | 46 (88.4) | 68 (83.9) | 0.6 | 35 (92.1) | 97 (92.3) | 0.79 | 33 (89.1) | 58 (86.5) | 0.69 | 48 (90.5) | 107 (89.9) | 0.9 |
| AG | 6 (11.5) | 12 (14.8) | 3 (7.8) | 7 (6.6) | 4 (10.8) | 8 (11.9) | 0.86 | 5 (9.4) | 11 (9.2) | 0.9 | ||
| GG | 0 | 1 (1.2) | 0 | 1 (0.9) | 0 | 1 (1.4) | 0.45 | 0 | 1 (0.8) | 0.13 | ||
|
| ||||||||||||
| C | 99 (95.1) | 109 (95.6) | 0.8 | 74 (97.3) | 190 (97.9) | 0.77 | 71 (95.9) | 85 (94.4) | 0.72 | 102 (96.2) | 214 (98.1) | 0.44 |
| T | 5 (4.8) | 5 (4.3) | 2 (2.6) | 4 (2) | 3 (4.1) | 5 (5.6) | 4 (3.7) | 4 (1.8) | ||||
| CC | 47 (90.3) | 52 (91.2) | 0.87 | 36 (94.7) | 93 (95.8) | 0.67 | 34 (91.8) | 40 (88.8) | 0.65 | 49 (92.4) | 105 (96.3) | 0.28 |
| CT | 5 (9.6) | 5 (8.7) | 0.87 | 2 (5.2) | 4 (4.1) | 0.67 | 3 (8.1) | 5 (11.1) | 0.65 | 4 (7.5) | 4 (3.6) | 0.28 |
| TT | 0 | 0 | — | 0 | 0 | — | 0 | 0 | — | 0 | 0 | — |
|
| ||||||||||||
| Female | ||||||||||||
| C | 57 (53.7) | 85 (57.3) | 0.56 | 45 (62.4) | 124 (64.2) | 0.79 | 42 (56.7) | 71 (57.2) | 0.94 | 60 (57.6) | 138 (63.5) | 0.28 |
| G | 49 (46.2) | 62 (41.8) | 27 (37.4) | 69 (35.7) | 32 (43.2) | 53 (42.7) | 44 (42.3) | 78 (35.9) | ||||
| CC | 18 (33.9) | 22 (29.7) | 0.33 | 13 (36.1) | 33 (34.1) | 0.81 | 13 (35.1) | 19 (30.6) | 0.64 | 18 (34.6) | 36 (33.1) | 0.9 |
| CG | 21 (39.6) | 38 (51.3) | 0.1 | 16 (44.4) | 47 (48.7) | 0.67 | 16 (43.2) | 33 (53.2) | 0.33 | 21 (40.3) | 52 (47.9) | 0.26 |
| GG | 14 (26.4) | 12 (16.2) | 0.18 | 4 (11.1) | 9 (9.3) | 0.7 | 8 (21.6) | 10 (16.1) | 0.78 | 10 (19.2) | 11 (10.1) | 0.12 |
| Male | ||||||||||||
| C | — | — | 3 (50) | 14 (67) | 0.4 | 3 (50) | 14 (67) | 0.4 | ||||
| G | — | — | 3 (50) | 7 (33) | 3 (50) | 7 (33) | ||||||
This case control-study enrolled 93 PF patients matched to 193 healthy control, whereas in some subjects the genotyping was failed.
Genotype and allele frequencies of TLR2 GT repeat inPemphigus foliaceus patient's groups and their relative matched healthy controls.
| Group 1 | Group 2 | Group 3 | Group 4 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Case | Controls |
| Case | Controls |
| Case | Controls |
| Case | Controls |
| |
|
| ||||||||||||
| 12 | 2 (1.9) | 4 (4.9) | 0.2 | 2 (3.4) | 3 (1.8) | 0.5 | 1 (1.4) | 5 (6) | 0.1 | 3 (3.2) | 1 (0.6) | 0.1 |
| 13 | 7 (6.7) | 4 (4.9) | 0.6 | 5 (8.6) | 5 (3.1) | 0.09 | 6 (8.5) | 3 (3.6) | 0.2 | 6 (6.5) | 6 (3.8) | 0.3 |
| 14 | 0 | 1 (1.2) | — | 0 | 1 (0.6) | — | 0 | 1 (1.2) | — | 0 | 1 (0.6) | 0.4 |
| 15 | 0 | 0 | — | 0 | 1 (0.6) | — | 0 | 0 | — | 0 | 1 (0.6) | 0.4 |
| 16 | 1 (0.9) | 1 (1.2) | 0.8 | 0 | 5 (3.1) | — | 1 (1.4) | 4 (4.8) | 0.2 | 0 | 2 (1.2) | 0.27 |
| 17 | 3 (2.8) | 4 (4.9) | 0.45 | 5 (8.6) | 10 (6.3) | 0.5 | 1 (1.4) | 5 (6) | 0.1 | 7 (7.6) | 9 (5.8) | 0.58 |
| 18 | 28 (26.9) | 16 (19.9) | 0.27 | 13 (22.4) | 28 (17.7) | 0.4 | 24 (34.2) | 15 (18.2) | 0.02 | 17 (18.4) | 29 (18.8) | 0.9 |
| 19 | 25 (24) | 21 (26..2) | 0.7 | 14 (24.1) | 30 (18.9) | 0.4 | 21 (30) | 14 (17) | 0.059 | 18 (19.5) | 37 (24) | 0.5 |
| 20 | 12 (11.5) | 10 (12.4) | 0.8 | 7 (12) | 16 (10.5) | 0.6 | 8 (11.4) | 5 (6) | 0.2 | 11 (11.9) | 21 (13.6) | 0.7 |
| 21 | 8 (7.6) | 3 (3.7) | 0.26 | 1 (1.7) | 17 (10.7) | 0.03 | 4 (5.7) | 12 (14.6) | 0.07 | 5 (5.4) | 8 (5.1) | 0.9 |
| 22 | 4 (3.8) | 4 (4.9) | 0.7 | 2 (3.4) | 9 (5.6) | 0.5 | 1 (1.4) | 3 (3.6) | 0.4 | 5 (5.4) | 10 (6.4) | 0.7 |
| 23 | 11 (10.5) | 11 (13.7) | 0.5 | 6 (10.3) | 22 (13.9) | 0.48 | 3 (4.2) | 13 (15.8) | 0.02 | 14 (15.2) | 19 (12.3) | 0.5 |
| 24 | 1 (0.9) | 0 | — | 2 (3.4) | 4 (2.5) | 0.7 | 0 | 1 (1.2) | — | 3 (3.2) | 3 (1.9) | 0.5 |
| 25 | 1 (0.9) | 1 (1.2) | 0.8 | 1 (1.7) | 5 (3.1) | 0.56 | 0 | 1 (1.2) | — | 2 (2.1) | 5 (3.2) | 0.6 |
| 26 | 1 (0.9) | 0 | — | 0 | 2 (1.2) | 0.38 | 0 | 0 | — | 1 (1) | 2 (1.2) | 0.7 |
| GT18/GT19 | 12 (23) | 2 (4.9) | 0.16 | 6 (20.6) | 6 (7.5) | 0.054 | 12 (34.2) | 1 (2.4) | 2.3 10−4 | 6 (13) | 7 (11) | 0.5 |
| GT18/GT20 | 5 (9.6) | 0 | 0.043 | 3 (10.3) | 2 (2.5) | 0.08 | 5 (10.8) | 1 (1.2) | 0.017 | |||
| 18 ≤ Gn ≤ 22 | 77 | 54 | 0.47 | 37 | 100 | 0.9 | 58 | 49 | 0.0018 | 56 | 105 | 0.052 |
| GTn ≤ 17 | 27 | 25 | 21 | 58 | 12 | 33 | 36 | 49 | ||||
This case control-study enrolled 93 PF patients matched to 193 healthy control, whereas in some subjects the genotyping was failed.