Guang Yang1, Xiaohong Cao1, Ling Qin1, Lijuan Yan1, Rongsheng Hong1, Jun Yuan1, Shihua Wang1. 1. Key Laboratory of Pathogenic Fungi and Mycotoxins of Fujian Province, Key Laboratory of Biopesticide and Chemical Biology of Education Ministry, School of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China.
Abstract
The RNA polymerase II (Pol II) transcription process is coordinated by the reversible phosphorylation of its largest subunit-carboxy terminal domain (CTD). Ssu72 is identified as a CTD phosphatase with specificity for phosphorylation of Ser5 and Ser7 and plays critical roles in regulation of transcription cycle in eukaryotes. However, the biofunction of Ssu72 is still unknown in Aspergillus flavus, which is a plant pathogenic fungus and produces one of the most toxic mycotoxins-aflatoxin. Here, we identified a putative phosphatase Ssu72 and investigated the function of Ssu72 in A. flavus. Deletion of ssu72 resulted in severe defects in vegetative growth, conidiation and sclerotia formation. Additionally, we found that phosphatase Ssu72 positively regulates aflatoxin production through regulating expression of aflatoxin biosynthesis cluster genes. Notably, seeds infection assays indicated that phosphatase Ssu72 is crucial for pathogenicity of A. flavus. Furthermore, the Δssu72 mutant exhibited more sensitivity to osmotic and oxidative stresses. Taken together, our study suggests that the putative phosphatase Ssu72 is involved in fungal development, aflatoxin production and pathogenicity in A. flavus, and may provide a novel strategy to prevent the contamination of this pathogenic fungus.
The RNA polymerase II (Pol II) transcription process is coordinated by the reversible phosphorylation of its largest subunit-carboxy terminal domain (CTD). Ssu72 is identified as a CTD phosphatase with specificity for phosphorylation of Ser5 and Ser7 and plays critical roles in regulation of transcription cycle in eukaryotes. However, the biofunction of Ssu72 is still unknown in Aspergillus flavus, which is a plant pathogenic fungus and produces one of the most toxic mycotoxins-aflatoxin. Here, we identified a putative phosphatase Ssu72 and investigated the function of Ssu72 in A. flavus. Deletion of ssu72 resulted in severe defects in vegetative growth, conidiation and sclerotia formation. Additionally, we found that phosphatase Ssu72 positively regulates aflatoxin production through regulating expression of aflatoxin biosynthesis cluster genes. Notably, seeds infection assays indicated that phosphatase Ssu72 is crucial for pathogenicity of A. flavus. Furthermore, the Δssu72 mutant exhibited more sensitivity to osmotic and oxidative stresses. Taken together, our study suggests that the putative phosphatase Ssu72 is involved in fungal development, aflatoxin production and pathogenicity in A. flavus, and may provide a novel strategy to prevent the contamination of this pathogenic fungus.
Entities:
Keywords:
A. flavus; aflatoxins; pathogenicity; phosphatase; ssu72
Aspergillus flavus is a saprophytic plant pathogenic fungus that infects a range of seed crops (maize, peanuts, cottonseed and tree nuts) before and after harvest [1,2]. In addition, A. flavus is also a human opportunistic pathogen, causing invasive aspergillosis in mammals and humans [3,4]. Aflatoxin (AF), which is mainly synthesised by A. flavus, is one of the most toxic and carcinogenic secondary metabolites in nature, posing a huge threat to economic development, food safety and human health [5,6]. Long-term intake of low doses of AFs may result in a number of health problems, such as growth impairment, lung and liver cancer or even death in many mammals and humans [7,8]. Therefore, it is essential to explain and clarify the regulatory mechanism of this fungus in pathogenicity and aflatoxin biosynthesis.Previous studies have shown that aflatoxin biosynthesis and pathogenicity of A. flavus are regulated by multiple factors, such as temperature [9], water activity [10] and post-translational modifications (PTMs) including phosphorylation [11], acetylation [12], succinylation [13], methylation [14] and SUMOylation [15]. Reversible phosphorylation catalyzed by kinases and phosphatases, is one of the most common PTMs, and has been shown to regulate various biological processes [16,17]. In eukaryotes, reversible phosphorylation mainly occurs on three amino acids (serine, threonine and tyrosine) [18,19]. Phosphatase-mediated dephosphorylation plays a critical role in signal transduction in eukaryotic cells [20]. Based on sequence homology, structure and catalytic specificity, phosphatases can be classified into two major superfamilies: serine/threonine (S/T) phosphatases and tyrosine phosphatases (PTPs) [21]. The PTPs have demonstrated to be involved in the regulation of various cellular processes in eukaryotes, including cell cycle, signal transduction, transcriptional activation, development and secondary metabolism [22,23,24].In eukaryotes, transcription of all coding genes is mainly regulated by RNA polymerase II (RNAP II) complex, which consist of 12 different subunits [25]. The carboxy-terminal domain (CTD) is one of the largest RNAP II subunits and composed of the evolutionarily conserved reiterate heptapeptide sequence (YSPTSPS), and reversible phosphorylation of this sequence is involved in distinct stages of transcription [26,27]. Ssu72 is identified as a highly conserved CTD phosphatase and negatively regulate the phosphorylation of specific Ser(5) and Ser(7) [28]. In Saccharomyces cerevisiae, Ssu72 is well studied due to its role in transcription initiation, mRNA processing, transcription termination and sister-chromatid cohesion [29,30]. In fission yeast, phosphatase Ssu72 is known to be essential for growth [31]. In addition, Ssu72 is found to be involved in RNA 3′ processing and the regulation of phosphate homeostasis in Schizosaccharomyces pombe [32,33]. In plant pathogenic fungus Fusarium graminearum, it has been demonstrated that the ortholog of phosphatase Ssu72 is involved in asexual development and virulence [34]. Despite the roles of phosphatase Ssu72 in yeast have been well studied, the function of Ssu72 in Aspergillus species is still poorly understood.In this study, we identified a putative phosphatase Ssu72 of A. flavus, and then systematically characterized the function of Ssu72 in A. flavus. Our results reveal that the putative phosphatase Ssu72 plays critical roles in the regulation of fungal development, aflatoxin biosynthesis, stresses response and pathogenicity in A. flavus. This will provide a new insight that Ssu72 may be used as a potential target for preventing the hazard of A. flavus.
2. Results
2.1. Identification of Putative Phosphatase Ssu72 in A. flavus
To identify the ortholog of Ssu72 phosphatase in A. flavus, the Ssu72 protein sequence of model organism S. cerevisiae was used to search with a basic local alignment search tool (BLAST) in the A. flavus genome database. A putative Ssu72 phosphatase protein in A. flavus was identified, predicting to encode 290 amino acids and present 45% homology with S. cerevisiaeSsu72. Then, a similar approach was performed to obtain Ssu72 homologous protein sequences in some fungi (A. nidulans, A. fumigatus, F. graminearum, Magnapoethe oryzae, Neurospora crassa, Candida albicans). Our sequence alignment results showed that the A. flavusSsu72 protein displayed 99% similarity to A. oryzae, 95% similarity to A. nidulans, and 93% similarity to A. fumigatus. The phylogenetic analysis indicated that the Ssu72 protein is evolutionarily conserved in Aspergillus species (Figure 1A), and the A. flavusSsu72 protein exhibited a high similarity with the ortholog of Ssu72 in Aspergillus species. Domain analysis revealed that the Ssu72 homologous proteins all contained a Ssu72-like phosphatase domain (Figure 1B), and this domain was mainly concentrated on the C-terminal of Ssu72 protein, suggesting that Ssu72-like phosphatase domain is highly conserved in fungi. These results indicate that the putative Ssu72 phosphatase protein is highly conserved in evolution and may have similar function in fungi.
Figure 1
Identification of putative phosphatase Ssu72 in A. flavus. (A) Phylogenetic tree analysis of putative Ssu72 phosphatases from different organisms. The tree was generated by MEGA 5.1 software with Neighbour-joining and bootstrap method. (B) Domain structure analysis of putative Ssu72 phosphatase from different fungi. Protein structure was characterized by SMART and drew using DOG 1.0 software. The Ssu72-like phosphatase domain is shown in blue.
2.2. Construction of the ssu72 Mutant Strains
To investigate the potential function of Ssu72 phosphatase gene in A. flavus, the ssu72 deletion (Δssu72) and the ssu72 complementation (Δssu72-Com) strains were constructed by a homologous recombination approach (Figure 2A). The specific primers and sequence lengths are displayed in Figure 2A. For knockout strain construction, three fragments (1392 bp ssu72 5′UTR, 1220 bp 3′UTR and 1890 bp pyrG) were amplified with the specific primers and then fused together. PyrG from A. fumigatus was used to replace the ssu72 gene, and open reading frame (ORF) of ssu72 gene was reinserted into the genome of the knockout strain to construct complementary strains. Then, the deletion and complementation transformants were verified by polymerase chain reaction (PCR) analysis (Figure 2B), and the result showed that ORF fragment could be detected in WT (wild type) and Δssu72-Com strains, but not in Δssu72 strain. While AP (5′UTR+pyrG) and BP (5′UTR+pyrG) fragments (Figure 2A) were amplified from ssu72 deletion and complementation mutants but not from WT strain. Furthermore, expression levels of ssu72 gene in WT, Δssu72 and Δssu72-Com strains were analyzed by reverse transcription-PCR (RT-PCR) and quantitative real-time PCR (qRT-PCR), and the results indicated that the transcripts of ssu72 were not detected in Δssu72 strain, whereas ssu72 gene was expressed in the WT and Δssu72-Com strains (Figure 2C,D). All these results showed that both ssu72 knockout mutant (Δssu72) and ssu72 complementation strain (Δssu72-Com) were successfully constructed.
Figure 2
Construction and verification of ssu72 mutants. (A) Strategy for deletion and complementation of phosphatase ssu72 gene by using homologous recombination. (B) PCR analysis of deletion and complementation strains. ORF: open reading frame; AP: 5′UTR+pyrG; BP: 5′UTR+pyrG. (C) RT-PCR analysis was used to detect the expression levels of ssu72 in different strains. Actin was used as reference gene. (D) qRT-PCR was performed to detect the transcript levels of ssu72 in different strains. ND means not detected.
2.3. Ssu72 Is Involved in Vegetative Growth in A. flavus
To investigate the roles of ssu72 in vegetative growth of A. flavus, the WT, Δssu72 and Δssu72-Com strains were inoculated in yeast extract-sucrose (YES), potato dextrose agar (PDA) and yeastglucose trace-elements (YGT) media and cultured for 5 days. As shown in Figure 3A,B, our result revealed that the Δssu72 mutant displayed significant growth reduction on YES, PDA and YGT media when compared with WT and complementation strains (Δssu72-Com). Moreover, microscopic examination showed that abnormal and shorter aerial hyphal were observed in Δssu72 mutant, while the abnormal hyphal defect of Δssu72 mutant was restored in the Δssu72-Com strain (Figure 3C). These observations suggest that phosphatase Ssu72 plays important roles in vegetative growth of A. flavus.
Figure 3
The function of ssu72 in vegetative growth in A. flavus. (A) The colony phenotype of WT, Δssu72 and Δssu72-Com strains grown on YES, PDA and YGT media for 5 days. All strains were cultured at 37 °C. (B) Colony diameter of all strains was measured on different media. Significant difference was analyzed by t test. ** p < 0.01 stands for significant difference. (C) Microscopic examination of mycelial tips in WT, Δssu72 and Δssu72-Com strains, scale bars = 200 μm. Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
2.4. Ssu72 Is Critical for Conidiation in A. flavus
Conidia is mainly produced by aerial hyphae and plays critical roles in asexual development and infection processes of A. flavus [35]. To assess the effect of ssu72 in conidiation, the WT, Δssu72 and Δssu72-Com strains were cultured on PDA medium for 5 days, and we found that the amount of conidia was obviously reduced in the Δssu72 mutant in comparison with WT and Δssu72-Com strains (Figure 4A). About one tenth of conidia was observed in the knockout strain, when compared with the WT and complementation strains (Figure 4B). Furthermore, microscopic examination revealed that abnormal head of conidiophores was observed in Δssu72 mutant (Figure 4C). To further explore the role of ssu72 in conidiation, the expression levels of two key transcript factors (brlA and abaA) were analyzed by qRT-PCR. The consequence showed that the expression levels of brlA and abaA were both significantly down-regulated in Δssu72 mutant when compared to WT and Δssu72-Com strains (Figure 2D). These results suggest that phosphatase Ssu72 is involved in the conidia production of A. flavus.
Figure 4
Defects of conidiation in Δssu72 mutant. (A) Morphology analysis of WT, Δssu72 and Δssu72-Com strains grown on PDA medium at 37 °C for 5 days. (B) Statistical analysis of the amount of conidia produced on PDA medium. (C) Conidiophores of all strains were observed by light microscope, scale bars = 200 μm. (D) Transcript levels of conidia key genes (brlA and abaA) in different strains after cultured for 48 h. Actin was used as reference gene. (** p < 0.01 means significant difference by t test.) Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
2.5. Ssu72 Is Required for Sclerotia Formation in A. flavus
In A. flavus, a sexual structure-sclerotia is formed to survive under harsh environment [5]. To investigate the bio-function of ssu72 in sclerotia formation, the WT, Δssu72 and Δssu72-Com strains were cultured on the Wickerham (WKM) medium in the dark for 7 days. As shown in Figure 5A,B, lots of sclerotia were discovered in WT and Δssu72-Com strains. However, no sclerotia was observed in Δssu72 strain. To further confirm these findings, qRT-PCR analysis was performed to analyze the transcript levels of two sclerotia formation key genes (nsdC and nsdD). The result indicated that the transcript levels of nsdC and nsdD were both dramatically reduced in the Δssu72 mutants when compared to WT and Δssu72-Com strains (Figure 5C). All the above findings suggest that phosphatase Ssu72 is required for sclerotia formation of A. flavus.
Figure 5
Phosphatase Ssu72 is essential for sclerotia formation. (A) Sclerotia formation of WT and ssu72 mutants on WKM medium after 7 days. (B) Amount of sclerotia produced in different strains on WKM medium. (C) Expression levels of sclerotia formation key genes (nsdC and nsdD) in WT, Δssu72 and Δssu72-Com strains cultured for 48 h. Actin was used as reference gene. (** p ≤ 0.01 means significant difference by t test.) ND means not detected. Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
2.6. Ssu72 Plays a Positive Role in Regulation of Aflatoxin Biosynthesis
Aflatoxin (AF) is one of the most toxic secondary metabolites of A. flavus, and poses a huge threat to human health [36,37]. Thus, it is necessary to determine whether phosphatase Ssu72 is involved in aflatoxin biosynthesis. Then, the strains were cultured in YES liquid medium for 6 days, and thin-layer chromatography (TLC) analysis showed that deletion of ssu72 gene resulted in a significant decrease in aflatoxin B1 (AFB1) production when compared to WT and Δssu72-Com strains (Figure 6A,B). Subsequently, qRT-PCR was performed to analyze the expression levels of AFB1 biosynthesis cluster genes. We found that the transcript levels of some key genes (regulatory genes aflR and aflS, structural genes aflP, aflQ, aflO and aflK) in Δssu72 mutant were significantly lower than those in WT and Δssu72-Com strains (Figure 6C). Overall, these results indicate that phosphatase Ssu72 positively regulates AFB1 biosynthesis in A. flavus.
Figure 6
Analysis of aflatoxin production in the WT and Δssu72 mutants. (A) Aflatoxins in the YES liquid medium were extracted in YES liquid medium for 6 days at 29 °C, and TLC was used to detect the aflatoxin production in each strain. S means AFB1 standard. The concentration of the AFB1 standard is 0.1 mg/mL. (B) Gene Tools software was used for quantification analysis of AFB1 as in (A). (C) Relative expression levels of aflatoxin biosynthesis cluster genes cultured for 48 h. Actin was used as reference gene. (** p ≤ 0.01). Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
2.7. Ssu72 Contributes to Pathogenicity in Crop Seeds in A. flavus
Since A. flavus infects crops and causes huge economic losses, the effect of phosphatase Ssu72 on the pathogenicity to crop seeds was characterized in this study. After cultivation for 5 days, a lot of conidia on surface of peanut and maize seeds were found in the WT and Δssu72-Com strain (Figure 7A). However, no obvious colonization was observed on peanuts and maize seeds after inoculated with Δssu72 mutant (Figure 7A), indicating that deletion of ssu72 resulted in a significant decrease in pathogenicity to peanut and maize seeds. Conidia were then harvested from the infected seeds, and Δssu72 mutant produced less amount of conidia on infected seeds than WT and Δssu72-Com strain (Figure 7B). Subsequently, TLC assay was used to detect aflatoxin production in the infected seeds, and the result revealed that no AFB1 was observed in peanut and maize seeds infected with Δssu72 strain (Figure 7C,D). All these data suggest that phosphatase Ssu72 contributes to its pathogenicity to crop seeds in A. flavus.
Figure 7
Analysis of seeds infection of WT, Δssu72 and Δssu72-Com strains. (A) Sterile peanut and maize seeds were infected with WT, Δssu72 and Δssu72-Com strains and cultured at 29 °C for 5 days. Mock means a blank control, peanuts and maize seeds were treated with the same amount of water instead of conidia. (B) Quantification analysis of conidia collected from the infected seeds. (C) TLC was used to detect the AFB1 production from the infected seeds. (D) Quantification of AFB1 as in (C). (** p ≤ 0.01). Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
2.8. Ssu72 Response to Multiple Stresses in A. flavus
In A. flavus, phosphatases have been proven to be involved in multiple stresses response [38,39]. To explore the role of putative phosphatase Ssu72 in response to osmotic and oxidative stresses, the strains (WT, Δssu72 and Δssu72-Com) were cultured on PDA medium supplemented with different stress reagents. As observed in Figure 8A,B, the relative inhibition of growth rate in Δssu72 induced by 1 M NaCl was obviously higher than that of WT and Δssu72-Com strains, suggesting that Δssu72 mutant displayed increased sensitivity to osmotic stresses. Additionally, the growth of Δssu72 mutant was completely inhibited after added with higher osmotic stresses (5 mM H2O2) (Figure 8A,B). All these results demonstrate that Ssu72 participates in osmotic and oxidative stresses in A. flavus.
Figure 8
The Ssu72 is involved in osmotic and oxidative stresses response. (A) Colony morphology of WT, Δssu72 and Δssu72-Com strains on PDA media added with 1 M NaCl or 5 mM H2O2 for 4 days. (B) Growth inhibition rate of all strains under osmotic and oxidative stresses. [inhibition of growth rate = (the diameter of untreated strain- the diameter of treated strain)/(the diameter of untreated strain) × 100%]. (** p ≤ 0.01 means significant difference by t test.) Each experiment was repeated at least three times. Standard deviation is indicated by error bars.
3. Discussion
As one of the largest RNAP II subunits, carboxy-terminal domain (CTD) is known to be involved in the regulation of transcriptional initiation/termination and pre-mRNA processing in eukaryotes [25,40]. Ssu72 is identified as a conserved CTD-related phosphatase and well characterized in yeast [33]. However, the biological functions of Ssu72 in other fungi, especially in Aspergillus species, are still unclear. In this study, a putative phosphatase Ssu72 of A. flavus was identified. The C-terminus of the ssu72 protein in fungi all contained a conserved Ssu72-like phosphatase domain, indicating that the ssu72 protein is evolutionarily conserved, and may have similar functions in fungi. In S. cerevisiae, the ssu72 protein has been shown to play important roles in regulation of multiple processes, so we speculate that Ssu72 may be involved in various processes in A. flavus. Next ssu72 gene deletion and complementation strains were constructed to characterize its function in A. flavus. Our findings reveal that the putative phosphatase Ssu72 is involved in fungal development, aflatoxin production and pathogenicity of A. flavus.Our previous studies have concluded that tyrosine phosphatases contribute to vegetative growth and conidiation in A. flavus [38]. In this study, our results demonstrated that knockout of putative phosphatase gene ssu72 resulted in a severe defect in vegetative growth (Figure 3A), which is consistent with the results in budding yeast [31]. Our microscopic observation on hyphae tips showed that shorter aerial hyphal was found in Δssu72 strain, which is in a good agreement with the above conclusion (Figure 3C). In addition, the amount of conidia was significantly reduced in Δssu72 strain (Figure 4A), which is consistent with the defect that was observed in ssu72 homolog mutants in F. graminearum and N. crassa [34,41]. This finding is well supported by the down-regulation of key transcription factors brlA and abaA [42]. Sclerotia is a sexual structure to survive in unfavorable environment in A. flavus [43]. However, no sclerotia was discovered in Δssu72 strain when compared to WT and complementation strains (Figure 5A), suggesting that phosphatase Ssu72 is essential for sclerotia formation. Furthermore, transcript levels of nsdC and nsdD genes, which have been known to be critical for sclerotia formation [44], was also significantly decreased in Δssu72 strain in this study. It is possible that deletion of ssu72 decrease the expression levels of nsdC and nsdD genes, and then regulate the sclerotia production. Therefore, phosphatase Ssu72 plays important roles in the regulation of vegetative growth, conidiation and sclerotia formation in A. flavus.As one of the most toxic secondary metabolites in nature, aflatoxin contamination poses a serious threat to food safety, human and animal health [45]. Recent studies have revealed that kinases and phosphatases play vital roles in regulation of aflatoxin production in A. flavus [39,46,47]. Here, we observed that aflatoxin production was dramatically reduced in Δssu72 mutant, and this finding is in accordance with the down-regulation of aflatoxin biosynthesis regulatory and structural genes (Figure 6). A similar result was also found that deletion of ssu72 homolog gene led to a lower production of mycotoxin-DON in plant pathogenic fungi F. graminearum [34]. A 70-kb DNA cluster is associated with aflatoxin biosynthesis, and regulatory and structural genes play important roles in this cluster [48]. As a conserved CTD phosphatase in fungi, Ssu72 has been proven to be involved in multiple cellular processes, including mRNA processing, transcription initiation and termination [29,32]. So we speculated that phosphatase Ssu72 may affect the transcription process of some key aflatoxin biosynthesis related genes, and then regulate the production of aflatoxin. These findings suggest that phosphatase Ssu72 positively regulates AFB1 biosynthesis in A. flavus.Tyrosine phosphatases are well conserved and play critical roles in fungal pathogenicity in filamentous fungi [24,39]. In F. graminearum, homologues of Ssu72 have been demonstrated to be essential for plant infection [34]. However, the role of phosphatase Ssu72 in seeds infection is still unknown in A. flavus. Here, seeds infection assays showed that deletion of ssu72 resulted in a severe defect in pathogenicity on maize and peanuts (Figure 7A), which is consistent with the previous finding in F. graminearum [34]. In addition, fewer conidia and aflatoxins were observed in the infected seeds of Δssu72 mutant (Figure 7B,C). In A. flavus, pathogenicity is related to various factors, such as vegetative growth, conidiation, mycotoxins and environment stresses [43]. Therefore, we believed that the severe defects in development and aflatoxin production are the main reasons for the decreased pathogenicity to seeds. Taken together, these data suggest that phosphatase Ssu72 displays a vital role in pathogenicity to seeds of A. flavus.Mitogen-activated protein kinase (MAPK) related phosphatases have been identified to be involved in multiple stresses response by regulating the phosphorylation level of MAP kinases (Hog1, Slt2 and Fus3) in A. flavus [39]. In this study, we found that the putative phosphatase Ssu72 is critical to respond to osmotic stress (Figure 8A). Similarly, the orthologue of Ssu72 has also been known to response to osmotic stress in N. crassa, and a higher phosphorylation level of Hog1 kinase was observed in ssu72 deletion mutant [41]. Additionally, Δssu72 mutants exhibited more sensitive to oxidative stress than WT and Δssu72-Com strains (Figure 8B). Reactive oxygen species (ROS) have been characterized to be highly related to oxidative stress [43]. In plant pathogenic fungi, elimination of ROS is critical to seeds infection [34]. Due to lower pathogenicity found in Δssu72 strain, we speculate that ROS scavenging ability of Δssu72 strain may be reduced. And this hypothesis is consistent with the result that the Δssu72 mutant displayed more sensitive to oxidative stress in A. flavus.In conclusion, a putative phosphatase Ssu72 was identified in A. flavus, and our results indicate that Ssu72 is involved in the regulation of development, aflatoxin biosynthesis and pathogenicity. This is the first report on the biofunction of phosphatase Ssu72 in Aspergillus species. We believe that our discoveries could improve the understanding of Ssu72 in filamentous fungi, and may provide a novel insight for developing new control strategies to this fungus.
4. Materials and Methods
4.1. Strains and Culture Conditions
Strains of A. flavus used and constructed were listed in Table 1. All strains were cultured on YES, PDA and YGT media for vegetative growth and conidiation analysis, and on WKM medium for sclerotia formation analysis [49]. YES liquid medium was used for aflatoxin production as described before [50].
Table 1
Strains used in the study.
Strains
Genotype Description
Reference
A. flavus CA14 PTS
∆ku70, ∆pyrG
Our lab
wild-type (WT)
∆ku70, ∆pyrG::AfpyrG
This study
∆ssu72
∆ku70, ∆pyrG::AfpyrG, ∆ssu72
This study
∆ssu72-Com
∆ku70, ∆ssu72::Aflssu72, ∆pyrG::AfpyrG
This study
4.2. Mutant Strains Construction
The homologous recombination approach was used to generate the ssu72 knockout mutant (Δssu72) [4]. Three fragments (1392 bp ssu72 5′UTR, 1220 bp 3′UTR and 1890 bp pyrG) were amplified with specific primers and fused together. Then, the fusion PCR products were transformed into A. flavus CA14 protoplasts as described earlier [51]. As the pyrG gene is inserted into the knockout strain, the knockout strain could grow in a medium without urea. This feature could be used to screen the knockout strain. Afterwards, the ssu72 complementation strain (Δssu72-Com) was constructed using a previously described method [50]. Briefly, an overlap PCR product which contains ssu72 coding region was introduced into the Δssu72 protoplasts. Finally, all the selected transformants were identified by PCR, and further confirmed by RT-PCR and qRT-PCR assays. At least two or three positive transformants were used for further phenotypic analysis. Primers are listed in Table 2.
Table 2
Primers used in this study.
Primer Name
Sequence (5′–3′)
Application
ssu72-AF
AAACCGACCACGAAGACA
5 ‘UTR of ssu72
ssu72-AR
GGGTGAAGAGCATTGTTTGAGGCTCAAGGAGGCTGGAAGAT
ssu72-BF
GCATCAGTGCCTCCTCTCAGACGGCTAGGGTCAACGAACA
3′UTR of ssu72
ssu72-BR
CCCTTCCCTCCTTCAGCA
pyrG-F
GCCTCAAACAATGCTCTTCACCC
fumigatus pyrG
pyrG-R
GTCTGAGAGGAGGCACTGATGC
ssu72-NF
GGTCCACTGGGTGGTAAT
Fusion PCR
ssu72-NR
GCACGATACAAGGCGATGG
ssu72-OF
ACCCAGGAGCAACAGTCA
ssu72 ORF verification
ssu72-OR
CCAGCCTTCAGAGTTATTCG
P801-R
CAGGAGTTCTCGGGTTGTCG
Verification of AP and BP
P1020-F
CAGAGTATGCGGCAAGTCA
ssu72-Com-AF
AACTAGTGAACACATCTTC
5′UTR of ∆ssu72-Com
ssu72-Com-AR
GGGTGAAGAGCATTGTTTGAGGCCCAATGTTCGTTGACCCTA
ssu72-Com-BF
GCATCAGTGCCTCCTCTCAGACCTGTATGCAGATCCAAAT
3′UTR of ∆ssu72-Com
ssu72-Com-BR
CTTCTAAAGCTCCTATCC
ssu72-Com-NF
TTCTGTTGGCCTGCGTAT
Fusion PCR
ssu72-Com-NR
GTATGCCTCTTGACTCCC
4.3. Phenotpic Assays
To explore the roles of ssu72 in growth and conidiation in A. flavus, 104 spores were spotted on YES, PDA and YGT media, and cultured at 37 °C for 5 days. Colony diameter was measured after 5 days of cultivation. Subsequently, conidia were collected from PDA medium and quantified using a hemocytometer as previously described [52]. For sclerotia production assay, all strains were incubated on WKM medium at 37 °C for 7 days. Then, 75% ethanol was used to wash away the mycelia and conidia, and the sclerotia were harvested and counted by a light microscope as described earlier [53].
4.4. Aflatoxin Production Assays
To determine aflatoxin production, 104 conidia of strains were inoculated on YES liquid medium and cultured at 29 °C for 6 days in the dark, then aflatoxins were extracted by chloroform according to a previously described approach [38]. TLC was performed to analyze aflatoxin in a solvent system (chloroform:acetone = 9:1) and examined under 365 nm UV light [13].
4.5. Pathogenicity Assays
Pathogenicity analysis on peanuts and maize seeds were conducted as described earlier [46]. Briefly, the sterilized crop seeds were inoculated with 106 spores of each strain at 29 °C for 5 days. The infected seeds were collected and transferred to 50 mL centrifuge tubes with 15 mL sterile water. Then, the conidia amount and aflatoxin production of the infected seeds were analyzed as the methods mentioned before.
4.6. Stress Assay
To investigate the role of Ssu72 in various stresses response, the WT, Δssu72 and Δssu72-Com strains were inoculated onto PDA medium supplemented with 1 M NaCl or 5 mM H2O2 at 37 °C for 4 days. The inhibition of growth rates was calculated as described before [38].
4.7. RNA Extraction and Quantitative Real-Time PCR Analysis
RNA extraction and cDNA synthesis were conducted according to the published references in our lab [39]. Mycelia were collected from PDA and WKM media cultured for 48 h, then TRIzol reagent (Biomarker Technologies, Beijing, China) was used for total RNA isolation. cDNA was synthesized with First-Strand cDNA Synthesis Kit (TransGen Biotech, Beijing, China). Subsequently, cDNA was used as a template for qRT-PCR analysis. All the qRT-PCR primers used in this study are listed in Table 3. The relative transcript levels of related genes were calculated with the 2–ΔΔCt method [54], and β-actin was used as internal control.