| Literature DB >> 33194210 |
M M E Elboshra1, Y F Hamedelnil1, E H Moglad2,3, H N Altayb4.
Abstract
Staphylococcus aureus is a versatile pathogen that can cause a variety of diseases, ranging from mild to fatal infection. This study aimed to detect the virulence genes (cna, ica, hlg and sdrE) in S. aureus isolated from different types of infections in Sudanese patients admitted to different hospital in Khartoum state. This is a descriptive cross-sectional study conducted over a period of 4 months from 1 April to 30 July 2017 in Khartoum. Overall, 65 S. aureus isolates were identified using standard biochemical and microbiologic tests. Antibiotic susceptibility testing was performed using the Kirby-Bauer disc diffusion method. Nucleic acid was extracted using the guanidine hydrochloride method, and all the genes except for sdrE were detected by multiplex PCR. The ica gene was the predominant one, found in 73.85% of the isolates, with sdrE found in 38.46%, cna in 29.25% and hlg in 7.69%. The relationship between the virulence genes and resistance to antibiotics showed that the highest resistance was observed in isolates with ica and sdrE, followed by cna and hlg. There were significant relationships between methicillin resistance and the presence of sdrE and ica genes (p 0.01 for both) and between ciprofloxacin resistance and the presence of sdrE gene (p 0.03).Entities:
Keywords: MRSA; cna; hlg; ica; sdrE
Year: 2020 PMID: 33194210 PMCID: PMC7642864 DOI: 10.1016/j.nmni.2020.100784
Source DB: PubMed Journal: New Microbes New Infect ISSN: 2052-2975
Primers and amplicon sizes
| Gene | Sequence (5′–3′) | Product size (bp) | Reference |
|---|---|---|---|
| F: AGTGGTACTACTAATACTG | 740 | [ | |
| F: GCCAATCCGTTATTAGAAAATGC | 937 | ||
| F: GATTATGTAATGTGCTTGGA | 770 | ||
| F: AGTAAAATGTGTCAAAAGA | 767 |
Sensitivity profile for all Staphylococcus aureus clinical isolates
| Antibiotic | Result | |
|---|---|---|
| Ciprofloxacin | Sensitive | 29 (44.6) |
| Resistant | 36 (55.4) | |
| Gentamicin | Sensitive | 27 (41.5) |
| Resistant | 38 (58.5) | |
| Vancomycin | Sensitive | 25 (38.5) |
| Resistant | 40 (61.5) | |
| Methicillin | Sensitive | 36 (55.4) |
| Resistant | 29 (44.6) |
According to CLSI 2017 criteria: Zone of inhibition interpreted as sensitive and resistant.
Correlation between Staphylococcus aureus virulence genes and antibiotic resistance
| Gene | Finding ( | Ciprofloxacin | Gentamicin | Vancomycin | Methicillin | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| R | S | p | R | S | p | R | S | p | R | S | p | ||
| Positive (19) | 9 | 10 | 0.95 | 11 | 8 | 0.32 | 13 | 6 | 0.94 | 7 | 12 | 0.11 | |
| Negative (46) | 27 | 19 | 27 | 19 | 27 | 19 | 22 | 24 | |||||
| Positive (48) | 25 | 23 | 0.69 | 28 | 20 | 0.95 | 31 | 17 | 0.21 | 20 | 28 | 0.01 | |
| Negative (17) | 11 | 6 | 10 | 7 | 9 | 8 | 9 | 8 | |||||
| Positive (5) | 2 | 3 | 0.31 | 4 | 1 | 0.32 | 4 | 1 | 0.31 | 2 | 3 | 0.12 | |
| Negative (60) | 34 | 26 | 34 | 26 | 36 | 24 | 27 | 33 | |||||
| Positive (25) | 1 8 | 7 | 0.03 | 15 | 10 | 0.84 | 17 | 8 | 0.94 | 17 | 8 | 0.01 | |
| Negative (40) | 1 8 | 22 | 23 | 17 | 23 | 17 | 12 | 28 | |||||
p values indicate significance at 95% confidence level. R, resistant; S, sensitive.
Relationship between Staphylococcus aureus virulence genes and sample source
| Gene | Reaction | Sample source, | p | |||
|---|---|---|---|---|---|---|
| Urine ( | Wound swab ( | Blood ( | Total | |||
| Positive | 7 (36.8) | 8 (42.1) | 4 (21.1) | 19 (34) | 0.71 | |
| Negative | 18 (39.1) | 22 (47.8) | 6 (13.0) | 46 (71) | ||
| Positive | 19 (39.6) | 21 (43.8) | 8 (16.7) | 48 (74) | 0.78 | |
| Negative | 6 (35.3) | 9 (52.9) | 2 (11.8) | 17 (26) | ||
| Positive | 0 | 1 (20.0) | 4 (80.0) | 5 (8) | 0.01 | |
| Negative | 25 (41.7) | 29 (48.3) | 6 (10.0) | 60 (92) | ||
| Positive | 9 (36.0) | 13 (52.0) | 3 (12.0) | 25 (38) | 0.71 | |
| Negative | 16 (40.0) | 17 (42.5) | 7 (17.5) | 40 (62) | ||
Incidence of Staphylococcus aureus virulence genes with patient sex
| Gene | Reaction | Sex, | p | |
|---|---|---|---|---|
| Male | Female | |||
| Positive | 8 (42.1) | 11 (57.9) | 0.79 | |
| Negative | 21 (45.7) | 25 (54.3) | ||
| Positive | 22 (45.8) | 26 (54.2) | 0.74 | |
| Negative | 7 (41.2) | 10 (58.8) | ||
| Positive | 1 (20.0) | 4 (80.0) | 0.24 | |
| Negative | 28 (46.7) | 32 (53.3) | ||
| Positive | 11 (44.0) | 14 (56.0) | 0.94 | |
| Negative | 18 (45.0) | 22 (55.0) | ||