Literature DB >> 33194210

Prevalence and characterization of virulence genes among methicillin-resistant Staphylococcus aureus isolated from Sudanese patients in Khartoum state.

M M E Elboshra1, Y F Hamedelnil1, E H Moglad2,3, H N Altayb4.   

Abstract

Staphylococcus aureus is a versatile pathogen that can cause a variety of diseases, ranging from mild to fatal infection. This study aimed to detect the virulence genes (cna, ica, hlg and sdrE) in S. aureus isolated from different types of infections in Sudanese patients admitted to different hospital in Khartoum state. This is a descriptive cross-sectional study conducted over a period of 4 months from 1 April to 30 July 2017 in Khartoum. Overall, 65 S. aureus isolates were identified using standard biochemical and microbiologic tests. Antibiotic susceptibility testing was performed using the Kirby-Bauer disc diffusion method. Nucleic acid was extracted using the guanidine hydrochloride method, and all the genes except for sdrE were detected by multiplex PCR. The ica gene was the predominant one, found in 73.85% of the isolates, with sdrE found in 38.46%, cna in 29.25% and hlg in 7.69%. The relationship between the virulence genes and resistance to antibiotics showed that the highest resistance was observed in isolates with ica and sdrE, followed by cna and hlg. There were significant relationships between methicillin resistance and the presence of sdrE and ica genes (p 0.01 for both) and between ciprofloxacin resistance and the presence of sdrE gene (p 0.03).
© 2020 The Author(s).

Entities:  

Keywords:  MRSA; cna; hlg; ica; sdrE

Year:  2020        PMID: 33194210      PMCID: PMC7642864          DOI: 10.1016/j.nmni.2020.100784

Source DB:  PubMed          Journal:  New Microbes New Infect        ISSN: 2052-2975


Introduction

The genus Staphylococcus is found as both commensals and pathogens in human and animals [1]. Staphylococcus aureus is one of the most common organisms; it causes mild to life-threatening infections by producing different virulence factors that help the microorganism adapt and survive in different tissues and environmental conditions [2,3]. Various genes encoding these factors are sdrE, sdrD and sdrC, which are found in different S. aureus strains [4,5]. The sdr proteins help bacteria to adhere to epithelial cells. Strains carrying the sdrE gene are reported to be 7.3% more prevalent among all S. aureus isolates. The sdrD gene is essential in abscess formation, and the sdrC gene has a low ability to infect bones [6]. Other virulence factors like hlg (γ-haemolysins hlgA and hlgC/hlgB) are common in S. aureus strains. This gene plays part in septic arthritis. It helps community-acquired methicillin-resistant S. aureus (MRSA) strains to persist in human through infection [[7], [8], [9]]. The ica A, C, B and D genes are associated with cell aggregation and biofilm formation. They encode for essential proteins to produce polysaccharide intercellular adhesion and capsule polysaccharide in Staphylococcus species. Various studies have reported the critical role that the ica gene plays as one of the staphylococcal infection's virulence factors [10,11] as well as in biofilm formation [12]. There is a global report of an increase in hypervirulent strains of MRSA [13]. S. aureus developed itself by acquiring antibiotic resistance genes; in addition, the presence of virulence genes complicates therapeutic interventions [14]. In Sudan, there are no published studies on the prevalence of virulent strains of S. aureus. Moreover, detection of S. aureus virulence genes is essential for epidemiologic reasons. We therefore aimed to detect Staphylococcus aureus virulence genes. The genes ica, cna, hlg and sdrE were isolated from different clinical samples taken from people living in Khartoum state. We also assessed the frequency of these genes with MRSA as well as resistance to fluoroquinolones and aminoglycosides.

Materials and methods

Study area, design and population

We performed this descriptive cross-sectional study from 1 April to 30 July 2017 in Khartoum state, Sudan. Isolates were collected from Omdurman Military Hospital, Police Hospital, Soba Hospital and Bahary Hospital, representing different provinces in Khartoum state. Patient of both sexes admitted to hospitals for treatment of urinary tract infections, wound infections or sepsis and who were suspected to have S. aureus infection were included in this study. Ethical approval to carry out this study was obtained from the institutional ethics committee, Deanship of Scientific Research, Sudan University of Science and Technology. Participants' privacy and confidentially were protected for all samples; personal information was not of great value in the current study and was thus not taken. Subsequently the ethical and scientific committee waived the need for patient consent.

Specimen collection

Bacterial isolates were collected from hospitals and subcultured onto blood agar and mannitol salt agar (Himedia Laboratories, Mumbai, India), then incubated aerobically for 24 hours at 37°C. Colonies were examined the next day. Identification of bacteria was made according to colony morphology, Gram stain and biochemical tests [15].

Antibiotic susceptibility patterns

Antibiotic susceptibility testing was carried out using the Kirby-Bauer disc diffusion method as recommended by the Clinical and Laboratory Standards Institute (CLSI) [16]. Antibiotic discs of methicillin (5 μg), vancomycin (30 μg), gentamicin (10 μg) and ciprofloxacin (5 μg) were placed on Müller-Hinton agar and incubated aerobically at 37°C for 24 hours (Himedia). The zone of inhibition was interpreted as sensitive or resistant using CLSI criteria.

Nucleic acid extraction and detection of virulence genes

DNA was extracted using the guanidine hydrochloride method described by Sabeel et al. [17]. Multiplex PCR reactions performed using 1 μL DNA solution (100–150 ng/L), 5 μL Qiagen Hot Star Taq Master Mix (Qiagen, Germantown, MD, USA) and 1 μL (10 pmol) of each gene-specific primer (hlg, ica and cna) in a final volume of 25 μL were used as recommended by Kumar et al. [18]. This mixture was introduced into a multiplex PCR protocol: 40 cycles of the following: 94°C for 30 seconds, 50°C for 30 seconds and 72°C for 30 seconds, 72°C for 40 seconds and a final extension at 72°C for 5 minutes. The origin and expected PCR amplicons size are listed in Table 1. For sdrE, the following single PCR protocol was conducted: 30 cycles of the following: 94°C for 5 minutes, 94°C for 40 seconds, 50°C for 40 seconds, 72°C for 40 seconds and final extension for 72°C for 5 minutes. Then visualization of PCR products was carried out by using 1% agarose on gel electrophoresis; the gel casting tray was flooded by 10 × Tris–borate–EDTA buffer near the gel cover surface and then 5 μL of amplified PCR products of each sample was put into each well. Then DAN ladder (100bp) and PCR products were loaded into gel. The gel electrophoresis apparatus was connected to a power supply (primer 125 V, 500 mA) (iNtRON Biotechnology Inc., Seoul, Korea). Electrophoresis was performed at 100 V/cm for 30 minutes; after that, the gel holder was removed and the gel visualized with a UV transilluminator (Transilluminator; Uvitec, UK).
Table 1

Primers and amplicon sizes

GeneSequence (5′–3′)Product size (bp)Reference
cna (collagen adhesin)F: AGTGGTACTACTAATACTGR: CAGGATAGATTGGTTTA740[18]
hlg (haemolysin)F: GCCAATCCGTTATTAGAAAATGCR: CCATAGACGTAGCAACGGAT937
ica (intracellular adhesin)F: GATTATGTAATGTGCTTGGAR: ACTACTGCTGCGTTAATAAT770
sdrE (putative adhesin)F: AGTAAAATGTGTCAAAAGAR: TTGACTACCAGGCTATATC767
Primers and amplicon sizes

Statistical analysis

Data were analysed by SPSS 20.0 software (IBM, Armonk, NY, USA). The chi-square test was used to find the relationship between virulence genes, antibiotic profiles and patient sex, with p < 0.05 considered statistically significant.

Results

Distribution of Staphylococcus aureus isolates according to sample source and sex

Of 65 isolates, 30 were from infected wounds (46.15%), 25 urine (38.5%) and ten blood samples (15.4%). Sex distribution among isolate donors was 36 women (55.6%) and 29 men (45.4%).

S. aureus antimicrobial susceptibility testing

Of 65 isolates, 36 were sensitive to methicillin (55.4%), 25 to vancomycin (38.5%), 27 to gentamicin (41.5%) and 29 to ciprofloxacin (44.6%) (Table 2).
Table 2

Sensitivity profile for all Staphylococcus aureus clinical isolates

AntibioticResultN (%)
CiprofloxacinSensitive29 (44.6)
Resistant36 (55.4)
GentamicinSensitive27 (41.5)
Resistant38 (58.5)
VancomycinSensitive25 (38.5)
Resistant40 (61.5)
MethicillinSensitive36 (55.4)
Resistant29 (44.6)

According to CLSI 2017 criteria: Zone of inhibition interpreted as sensitive and resistant.

Sensitivity profile for all Staphylococcus aureus clinical isolates According to CLSI 2017 criteria: Zone of inhibition interpreted as sensitive and resistant.

Detection of virulence genes

The ica gene was predominant as it was detected in 48 isolates (73.85%). The cna gene was detected in 19 isolates (29.2%). Five isolates (7.6%) were positive for hlg and 25 isolates (38.46%) for sdrE. The present data showed that the sdrE gene is more prevalent in ciprofloxacin and methicillin resistance strains (p 0.03 and 0.01 respectively) (Table 3).
Table 3

Correlation between Staphylococcus aureus virulence genes and antibiotic resistance

GeneFinding (n)Ciprofloxacin
Gentamicin
Vancomycin
Methicillin
RSpRSpRSpRSp
cnaPositive (19)9100.951180.321360.947120.11
Negative (46)2719271927192224
icaPositive (48)25230.6928200.9531170.2120280.01
Negative (17)1161079898
hlgPositive (5)230.31410.32410.31230.12
Negative (60)3426342636242733
sdrEPositive (25)1 870.0315100.841780.941780.01
Negative (40)1 822231723171228

p values indicate significance at 95% confidence level. R, resistant; S, sensitive.

Correlation between Staphylococcus aureus virulence genes and antibiotic resistance p values indicate significance at 95% confidence level. R, resistant; S, sensitive. Table 4, Table 5 provide information regarding the distribution of sample sources of S. aureus as well as sex and its association with virulence genes.
Table 4

Relationship between Staphylococcus aureus virulence genes and sample source

GeneReactionSample source, n (%)
p
Urine (n = 25)Wound swab (n = 30)Blood (n = 10)Total
cnaPositive7 (36.8)8 (42.1)4 (21.1)19 (34)0.71
Negative18 (39.1)22 (47.8)6 (13.0)46 (71)
icaPositive19 (39.6)21 (43.8)8 (16.7)48 (74)0.78
Negative6 (35.3)9 (52.9)2 (11.8)17 (26)
hlgPositive01 (20.0)4 (80.0)5 (8)0.01
Negative25 (41.7)29 (48.3)6 (10.0)60 (92)
sdrEPositive9 (36.0)13 (52.0)3 (12.0)25 (38)0.71
Negative16 (40.0)17 (42.5)7 (17.5)40 (62)
Table 5

Incidence of Staphylococcus aureus virulence genes with patient sex

GeneReactionSex, n (%)
p
MaleFemale
cnaPositive8 (42.1)11 (57.9)0.79
Negative21 (45.7)25 (54.3)
icaPositive22 (45.8)26 (54.2)0.74
Negative7 (41.2)10 (58.8)
hlgPositive1 (20.0)4 (80.0)0.24
Negative28 (46.7)32 (53.3)
sdrEPositive11 (44.0)14 (56.0)0.94
Negative18 (45.0)22 (55.0)
Relationship between Staphylococcus aureus virulence genes and sample source Incidence of Staphylococcus aureus virulence genes with patient sex

Discussion

The current study determined the incidence of some of the various virulence markers of S. aureus in different clinical specimens. We specifically targeted a small portion of genes associated with S. aureus virulence. These genes (cna, hlg, ica and sdrE) were chosen because they predominate among aggressive isolates. PCR amplification of these targeted genes showed that they were distributed among different isolates. In addition, all the isolates showed diverse combinations of genes, among which all the tested genes were found in four isolates, thus indicating a high level of genetic diversity among the study population. This finding was in agreement with Stotts et al. [19], who found that eight isolates from their study population had these four genes in combination. They reported a high rate of resistance in MRSA and vancomycin-resistant S. aureus (VRSA), which were 44.6% and 61.5% respectively. This finding of resistance was similar to that of other studies, including one from Egypt (which shares a north border with Sudan) which reported that the prevalence of VRSA and MRSA were (27% and 14.5% ) in dromedary camels and (54% and 55%) in humans, respectively, [20]. Such findings are similar to those of a study from Ethiopia (which shares an east border with Sudan) which reported that of 31 S. aureus, the percentages of VRSA and MRSA were 65.1% and 55.8% respectively [21]. However, these results are unlike those of a study from Tehran, which reported that out of 1789 S. aureus, only four VRSA were detected [22]. This reports indicate the presence of an alarming situation in Sudan, which is a neighbouring country, regarding the spread of MRSA and VRSA. More comprehensive molecular epidemiologic monitoring studies on MRSA and VRSA are urgently needed. In the current research, notable differences were observed in antimicrobial sensitivity between those isolates that harbour all four virulence factors and those that contain varying or no virulence factors. The acquisition of virulence genes among S. aureus species was noted more in methicillin- sensitive strains. This finding may be due to the adjacent position of the resistance gene to the virulence gene [19,23]. In this research, we observed that the presence of the ica gene in methicillin-resistant strains was more common (p 0.01). This finding entirely disagreed with the study of Almeida et al. [24], which concluded that there was no prevalence of either cna or ica genes among S. aureus isolates. Moreover, the presence of the cna gene, which encodes the collagen-binding protein, was not found in the S. aureus isolates of Smeltzer et al. [25]. The hlg (γ-haemolysin) gene, which was present in 7.69% of the isolates in this study, was not been reported by Almeida et al. [24]. The sdrE gene was found to have a prevalence of 38.46% among our study isolates. They may play a role in microbial surface component–recognizing adhesive matrix molecules. The S. aureus proteins are one of this family that is formed by the tandem arranged sdrC, sdrD and sdrE genes [4]. Although the exact role of sdrE adhesins in staphylococcal infection has not yet been identified, a strong association between the sdrE genes of S. aureus and some diseases has been described, with several studies reporting a significant growth incidence of sdrE genes in invasive S. aureus strains, mainly in S. aureus strains causing osteomyelitis and bone infections [4,26]. Interestingly, a statistically significant association (p 0.01) was detected between the presence of the hlg gene and blood samples. This gene is responsible for the production of γ toxins, which could help both community-acquired and hospital-acquired MRSA to survive in human blood during infection [[7], [8], [9]]. Of 29 MRSA isolates, 20 MRSA strains possessed ica genes, two hlg genes, seven cna genes and 17 sdrF genes. These strains are considered to have high virulence potential.

Conclusions

Hypervirulent MRSA is predominant in Khartoum, Sudan. The sdrE and ica genes are highly prevalent in MRSA. Further, there are a high number of Staphylococcus aureus isolates with different levels of virulence-determining genes in Sudanese patients. The results provide evidence of a high frequency of MRSA in Sudanese patients.
  22 in total

Review 1.  Bacterial biofilms: from the natural environment to infectious diseases.

Authors:  Luanne Hall-Stoodley; J William Costerton; Paul Stoodley
Journal:  Nat Rev Microbiol       Date:  2004-02       Impact factor: 60.633

2.  Characterization of a new cytotoxin that contributes to Staphylococcus aureus pathogenesis.

Authors:  Ashley L Dumont; Tyler K Nygaard; Robert L Watkins; Amanda Smith; Lina Kozhaya; Barry N Kreiswirth; Bo Shopsin; Derya Unutmaz; Jovanka M Voyich; Victor J Torres
Journal:  Mol Microbiol       Date:  2010-12-13       Impact factor: 3.501

3.  DNA macroarray for identification and typing of Staphylococcus aureus isolates.

Authors:  Salim Trad; Jeanine Allignet; Lionel Frangeul; Marilyne Davi; Massimo Vergassola; Elisabeth Couve; Anne Morvan; Amel Kechrid; Carmen Buchrieser; Philippe Glaser; Névine El-Solh
Journal:  J Clin Microbiol       Date:  2004-05       Impact factor: 5.948

4.  Distribution of the serine-aspartate repeat protein-encoding sdr genes among nasal-carriage and invasive Staphylococcus aureus strains.

Authors:  Artur Sabat; Damian C Melles; Gayane Martirosian; Hajo Grundmann; Alex van Belkum; Waleria Hryniewicz
Journal:  J Clin Microbiol       Date:  2006-03       Impact factor: 5.948

5.  Detection of virulence genes in Staphylococcus aureus isolated from paper currency.

Authors:  J Dinesh Kumar; Yogesh K Negi; Abhishek Gaur; Deepshikha Khanna
Journal:  Int J Infect Dis       Date:  2009-05-27       Impact factor: 3.623

6.  Identification of a novel Staphylococcus aureus two-component leukotoxin using cell surface proteomics.

Authors:  Christy L Ventura; Natalia Malachowa; Carl H Hammer; Glenn A Nardone; Mary Ann Robinson; Scott D Kobayashi; Frank R DeLeo
Journal:  PLoS One       Date:  2010-07-16       Impact factor: 3.240

Review 7.  Food poisoning and Staphylococcus aureus enterotoxins.

Authors:  María Ángeles Argudín; María Carmen Mendoza; María Rosario Rodicio
Journal:  Toxins (Basel)       Date:  2010-07-05       Impact factor: 4.546

8.  Phenotypic and Genotypic Analysis of Multidrug-Resistant Mycobacterium tuberculosis Isolates from Sudanese Patients.

Authors:  Solima M A Sabeel; Mohamed Ahmed Salih; Manasik Ali; Salah-Eldin El-Zaki; Nadir Abuzeid; Zeinab Abubaker Mohammed Elgadi; Hisham N Altayb; Asrar M A Elegail; Nuha Y Ibrahim; Bahaeldin K Elamin
Journal:  Tuberc Res Treat       Date:  2017-01-18

9.  Prevalence and antimicrobial resistance profile of Staphylococcus in dairy farms, abattoir and humans in Addis Ababa, Ethiopia.

Authors:  Takele Beyene; Halefom Hayishe; Fikru Gizaw; Ashenafi Feyisa Beyi; Fufa Abunna; Bedaso Mammo; Dinka Ayana; Hika Waktole; Reta Duguma Abdi
Journal:  BMC Res Notes       Date:  2017-04-28

10.  Biofilm formation and prevalence of adhesion genes among Staphylococcus aureus isolates from different food sources.

Authors:  Qi Chen; Sangma Xie; Xiuqin Lou; Shi Cheng; Xiaodong Liu; Wei Zheng; Zhibei Zheng; Haoqiu Wang
Journal:  Microbiologyopen       Date:  2019-11-25       Impact factor: 3.139

View more
  2 in total

1.  Loranthus acaciae: Alternative medicine for β-lactamase producer and methicillin-resistant Staphylococcus aureus.

Authors:  Ehssan H Moglad
Journal:  Saudi J Biol Sci       Date:  2020-12-30       Impact factor: 4.219

2.  Antibiogram, prevalence of methicillin-resistant and multi-drug resistant Staphylococcus spp. in different clinical samples.

Authors:  Ehssan H Moglad; Hisham N Altayb
Journal:  Saudi J Biol Sci       Date:  2022-09-05       Impact factor: 4.052

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.