Literature DB >> 33184322

The genetic legacy of fragmentation and overexploitation in the threatened medicinal African pepper-bark tree, Warburgia salutaris.

Annae M Senkoro1,2, Pedro Talhinhas3, Fernanda Simões4, Paula Batista-Santos3, Charlie M Shackleton1, Robert A Voeks5, Isabel Marques6, Ana I Ribeiro-Barros7.   

Abstract

The pepper-bark tree (Warburgia salutaris) is one of the most highly valued medicinal plant species worldwide. Native to southern Africa, this species has been extensively harvested for the bark, which is widely used in traditional health practices. Illegal harvesting coupled with habitat degradation has contributed to fragmentation of populations and a severe decline in its distribution. Even though the species is included in the IUCN Red List as Endangered, genetic data that would help conservation efforts and future re-introductions are absent. We therefore developed new molecular markers to understand patterns of genetic diversity, structure, and gene flow of W. salutaris in one of its most important areas of occurrence (Mozambique). In this study, we have shown that, despite fragmentation and overexploitation, this species maintains a relatively high level of genetic diversity supporting the existence of random mating. Two genetic groups were found corresponding to the northern and southern locations. Our study suggests that, if local extinctions occurred in Mozambique, the pepper-bark tree persisted in sufficient numbers to retain a large proportion of genetic diversity. Management plans should concentrate on maintaining this high level of genetic variability through both in and ex-situ conservation actions.

Entities:  

Year:  2020        PMID: 33184322      PMCID: PMC7661512          DOI: 10.1038/s41598-020-76654-6

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Medicinal plants have been used worldwide since ancient times, being particularly relevant in the developing world where ca. 80% of the population rely on these resources to fulfil their basic health care needs[1-4]. Additionally, at the global level the importance of bio-based compounds continues to grow and phytochemical research towards the identification of new active compounds of medical and nutritional importance is among top research priorities (e.g.[5-14]). Sub-Saharan Africa harbours a vast repository of plant biodiversity, with 45,000 known vascular plant species[15], many of which are used in traditional medicine[16-20]. However, efforts to safeguard this biodiversity are often compromised by anthropogenic pressures, with proximal drivers being land transformation, synergistic impacts of fires, grazing, climate change and harvesting (c.f.[17,21-27]), and growing commercialisation of medicinal plant in high demand (c.f.[17,28,29]). The last is motivated by preferences for certain species due to cultural identity, traditions, and lower costs in comparison with modern pharmaceuticals, even under circumstances of access to modern medical facilities[21,30]. On the other hand, the conservation status of many endemic and native species is poorly understood[31,32] and many natural populations may be at risk. Current exploitation rates, often in tandem with other pressures like fire, invasive species, browsing and land transformation, threaten wild populations unless management methods are established, including community-based approaches[17,21,30]. Under the current scenario of climate change and human population growth, the use of genomic tools is valuable to understand species evolution and adaptation in natural ecosystems[33,34]. The importance of phylogenetic data, genetic diversity, and population structure analyses to characterize the biodiversity of wild species has been well-established in numerous studies (e.g.[35-39]). Microsatellites (Single Sequence Repeats, SSR) are amongst the most efficient and widely used markers for these studies as they are codominant and highly polymorphic loci[40]. Although these markers are species specific, the increasing accessibility to next-generation sequencing[41] has enabled the development of SSRs for the so-called orphan, neglected or wild crop relative species (e.g.[42-45]), although sequencing large plant genomes still remains a challenge[46]. The pepper-bark tree, Warburgia salutaris (Bertol.) Chiov. (Family Canellaceae) is one of the most widely used and traded medicinal plants in southern Africa[47]. This slow growing species is part of an early diverging group of basal angiosperms, thought to be native to eastern and southern Africa[48]. However, subsequent studies confined the distribution of W. salutaris to only a sub-region of southern Africa, i.e. South Africa[21,49], Eswatini (previously known as Swaziland)[24,50], Zimbabwe[29,51-53], Malawi[54] and Mozambique[55]. This species is commonly used to treat several ailments such as common colds, throat and mouth sores, or coughs[47,48]. In the past, sustainable harvesting of medicinal plants was regulated through traditional practises such as taboos, restrictions and harvesting tools[30]. However, with commercial demand increasing, W. salutaris groves were repeatedly raided by harvesters that often debarked the whole tree, especially mature plants[56]. Severe harvesting resulted in high tree mortality in many areas and in the extinction of many local populations[21,24,57] and consequently, W. salutaris is considered threatened throughout its range[50,58,59], and listed as an Endangered Species in the IUCN Red List[57]. The most extreme case is that of Zimbabwe, where the species is listed as extinct in the wild[29,60]. That resulted in the import of bark supplies in the late 1990s from Mozambique and South Africa[53] being later trafficked from the same countries[29]. For instance, in South Africa, 43% of W. salutaris bark in the Johannesburg main market originated from Mozambique, with annual traded amounts estimated at 500–1000 kg[28]. As a result, populations of W. salutaris in Mozambique are currently restricted to fragmented patches in the Lebombo Mountains, Tembe River and Futi Corridor (Fig. 1)[48]. According to the Red List classification for Mozambique, this species is considered Vulnerable VU A2 cd[58]. Despite this critical situation, only a few studies on the populations dynamics of W. salutaris are available; of the 60 research and review papers available in the Web of Science on W. salutaris on 05 February 2020, only seven addressed this topic[21,24,48,61-63] while the vast majority are focused on the medicinal applications of this species. Nevertheless, amplified fragment length polymorphisms (AFLPs) have been used to solve genetic relationships between W. ugandensis, W. salutaris and W. stuhlmanni showing a high degree of genetic variation among individuals within populations as well as between populations[62].
Figure 1

Location of the Lebombo Mountains, Tembe River, and Futi Corridor areas and their respective villages in southern Mozambique. Maps were generated with Idrisi Selva v.17.02 environment (Clark Labs, Clark University, www.clarklabs.org).

Location of the Lebombo Mountains, Tembe River, and Futi Corridor areas and their respective villages in southern Mozambique. Maps were generated with Idrisi Selva v.17.02 environment (Clark Labs, Clark University, www.clarklabs.org). In this work, we have developed SSRs markers for W. salutaris to investigate the genetic legacy of exploitation in this slow growing species and to contribute to future re-introduction actions. For that, we have used its best known area of occurrence, Mozambique (Fig. 1) to addressed the following questions: (1) How is genetic diversity distributed within and among individuals across geographical areas?; (2) Is the genetic structure associated with the geographical distribution?; and (3) Is there any evidence of inbreeding or lack of gene flow between populations?

Results

Genetic diversity

For each locus, the numbers of alleles varied from three (13-N1132836, 16-N1150626 and 18-N1173706 locus) to nine (31-N2284857 and 43-N1009973 locus) with an average of 5.8 ± 2.3 alleles per locus and a total of 58 alleles considering all loci (Table 1). The average observed and expected heterozygosis per loci varied from 0.299 ± 0.186 (16-N1150626) to 0.852 ± 0.062 (10-N1110523), and from 0.249 ± 0.109 (16-N1150626) to 0.812 ± 0.048 (31-N2284857), respectively.
Table 1

Characteristics and genetic diversity statistics of the 10 polymorphic microsatellite markers developed for Warburgia salutaris.

LocusRepeat motifAccession numberPrimer Sequence 5′–3′Size rangeNaHoHe
1-N1002135(ATG)5MT515706

F: TATGTTGGGAGAGGGTGAGG

R: GTTTAACGACTGCATCATCCCA

132–17460.487 ± 0.1390.394 ± 0.101
7-N1082598(AAT)9MT515707

F: GTTGATCATAGACACGCCAAGG

R: GTCGTGCAACCTAGAGGTCC

161–18270.633 ± 0.0850.700 ± 0.029
10-N1110523(TTA)9MT515708

F: AACCATTGGCACCTCAAGTC

R: GTTGAAGTTGAGGGAAGGGATG

244–26270.852 ± 0.0600.786 ± 0.023
12-N1126672(TTG)7MT515709

F: GTTAAATCTGGACCCACTTGCC

R: GGGTGAATTAGTGAACGTCTTG

161–18070.805 ± 0.1250.718 ± 0.074
13-N1132836(AAG)7MT515710

F: GTTCCTGCTCCGAGACCTAGAA

R: TCATGAAGAAATCGCAACCA

138–14430.304 ± 0.0870.296 ± 0.086
16-N1150626(TGG)5MT515711

F. GTCTTTGGCGAAATCAGTTGGT

R: GAAGGTTTCCAGGTTGGTGA

149–15930.299 ± 0.1860.249 ± 0.109
18-N1173706(AAG)6MT515712

F: GAGCTGCCTCGATATGGACT

R: GTTATCCAATGGCCAAGAAACC

164–17030.398 ± 0.1050.421 ± 0.078
31-N2284857(TTC)12MT515713

F: GTCTCTTGCTATCATGCGGTCA

R: CAGATTGGAGAATCCAGACCA

207–26390.771 ± 0.1380.812 ± 0.078
33-N3477883(TGA)6MT515714

F: GTACAAGATTCATGTGACCGGC

R: GCAAGGCATCATATTCACGA

184–20040.550 ± 0.1710.472 ± 0.124
43-N1009973(AT)10MT515715

F: GTTGCGCTCATCGATCTGTA

R: GTGCGAACTATGATCGGACGAA

146–18590.439 ± 0.1020.778 ± 0.027

For each loci, the repeat motif, Genbank accession number, primer sequence, and size range (bp) is indicated. Na refers to the number of alleles, Ho to observed heterozygosity (mean ± SE) and He to expected heterozygosity (mean ± SE).

Characteristics and genetic diversity statistics of the 10 polymorphic microsatellite markers developed for Warburgia salutaris. F: TATGTTGGGAGAGGGTGAGG R: GTTTAACGACTGCATCATCCCA F: GTTGATCATAGACACGCCAAGG R: GTCGTGCAACCTAGAGGTCC F: AACCATTGGCACCTCAAGTC R: GTTGAAGTTGAGGGAAGGGATG F: GTTAAATCTGGACCCACTTGCC R: GGGTGAATTAGTGAACGTCTTG F: GTTCCTGCTCCGAGACCTAGAA R: TCATGAAGAAATCGCAACCA F. GTCTTTGGCGAAATCAGTTGGT R: GAAGGTTTCCAGGTTGGTGA F: GAGCTGCCTCGATATGGACT R: GTTATCCAATGGCCAAGAAACC F: GTCTCTTGCTATCATGCGGTCA R: CAGATTGGAGAATCCAGACCA F: GTACAAGATTCATGTGACCGGC R: GCAAGGCATCATATTCACGA F: GTTGCGCTCATCGATCTGTA R: GTGCGAACTATGATCGGACGAA For each loci, the repeat motif, Genbank accession number, primer sequence, and size range (bp) is indicated. Na refers to the number of alleles, Ho to observed heterozygosity (mean ± SE) and He to expected heterozygosity (mean ± SE). From the three sampling areas of W. salutaris 156 alleles were found in the 48 individuals sampled, being the number of alleles higher in LM than in the other two areas (Table 2). The average Shannon’s diversity index (I) was also higher in LM than in TR and FC. Observed and expected heterozygosis had similar average values in LM and TR being slightly lower in FC. The polymorphic information content (PIC) had high average values while inbreeding coefficients (F) were low and showing negative values in the three sampling areas.
Table 2

Genetic diversity of Warburgia salutaris in the three study areas.

LocusLebombo Mountains (LM)Tembe River (TR)Futi Corridor (FC)
NaIHoHePICNaIHoHePICNaIHoHePIC
1-N100213530.8090.5790.4990.49930.8400.6670.4910.49120.3400.2140.1910.191
7-N108259871.4570.5260.6720.67291.7640.8000.7580.75881.5160.5710.6710.671
10-N111052391.9420.8950.8320.83251.4800.7330.7620.76271.6490.9290.7630.763
12-N112667271.7160.8420.7950.79571.7391.0000.7890.78941.0610.5710.5690.569
13-N113283620.5760.4210.3880.38820.2450.1330.1240.12420.5620.3570.3750.375
16-N115062630.4550.1580.2340.23420.6370.6670.4440.44420.1540.0710.0690.069
18-N117370630.9420.5790.5640.56430.6800.4000.4070.40720.4690.2140.2930.293
31-N2284857142.4290.9470.8950.89591.8840.8670.8160.81661.4870.5000.7270.727
33-N347788340.9540.5260.5170.51730.4680.2670.2380.23831.0900.8570.6610.661
43-N1009973111.9800.6320.8010.81091.8270.4000.7980.79851.4380.2860.7240.724
Average ± SE6.300 ± 1.2741.326 ± 0.2130.611 ± 0.0750.620 ± 0.0680.621 ± 0.2165.200 ± 0.9521.156 ± 0.2030.593 ± 0.0890.563 ± 0.0810.563 ± 0.2564.100 ± 0.7220.977 ± 0.1750.457 ± 0.0890.504 ± 0.0800.504 ± 0.252

Na refers to the number of alleles, I to Shannonʼs diversity index, Ho to observed heterozygosity (mean ± SE), He to expected heterozygosity (mean ± SE) and PIC to polymorphic information content.

Genetic diversity of Warburgia salutaris in the three study areas. Na refers to the number of alleles, I to Shannonʼs diversity index, Ho to observed heterozygosity (mean ± SE), He to expected heterozygosity (mean ± SE) and PIC to polymorphic information content.

Population genetic structure and differentiation

The Bayesian clustering program STRUCTURE found the highest LnP(D) and ΔK values for K = 2 (Fig. 2; Fig. S1). One cluster was predominantly found across LM and TR areas, while a second one characterized the FC area. Nevertheless, some individuals in this last area showed signs of genetic admixture between the two genetic groups (* indicated in Fig. 2).
Figure 2

Population structure of Warburgia salutaris based on 10 SSRs and using the best assignment result retrieved by STRUCTURE (K = 2). Each individual sample is represented by a thin vertical line divided into K coloured segments that represent the individual’s estimated membership fractions in K clusters. Populations and main geographical areas are indicated below following Table 4. Asterisks indicate individuals with a probably of membership lower than 90% to the main genetic cluster, as revealed by STRUCTURE.

Population structure of Warburgia salutaris based on 10 SSRs and using the best assignment result retrieved by STRUCTURE (K = 2). Each individual sample is represented by a thin vertical line divided into K coloured segments that represent the individual’s estimated membership fractions in K clusters. Populations and main geographical areas are indicated below following Table 4. Asterisks indicate individuals with a probably of membership lower than 90% to the main genetic cluster, as revealed by STRUCTURE.
Table 4

Sampled accessions and locations of Warburgia salutaris sorted by geographical area.

AccessionsLocationIDLatLongAccessionsLocationIDLatLong
GF1 (1)Goba FronteiraLM− 26.2326632.09810KZT16 (27)KazimatTR− 26.4099432.35490
MAC13 (2)MacandaLM− 26.0352232.12181KZT21 (28)KazimatTR− 26.4039132.36711
MAC14 (3)MacandaLM− 26.0357732.12150KZT22 (29)KazimatTR− 26.4005932.35109
MAC15 (4)MacandaLM− 26.0377832.12730KZT24 (30)KazimatTR− 26.4020632.36188
MAC16 (5)MacandaLM− 26.0369232.12772KZT28 (31)KazimatTR− 26.3673532.37323
MAC17 (6)MacandaLM− 26.0515832.11803KZT35 (32)KazimatTR26.3673732.37266
MAC18 (7)MacandaLM− 26.0515932.11565KZT40 (33)KazimatTR− 26.3687332.37078
MAC19 (8)MacandaLM− 26.8111832.64545KZT41 (34)KazimatTR− 26.3692932.37334
MAC20 (9)MacandaLM− 26.0469632.11979KZT46 (35)KazimatTR− 26.3693532.37321
MAC22 (10)MacandaLM− 26.0450832.11982MON47 (36)MonucuaTR− 26.3695232.32288
MAC24 (11)MacandaLM− 26.0352132.12181Huc16 (44)HucoFC− 26.8501332.60338
GF2 (12)Goba FronteiraLM− 26.2686732.10719Huc17 (45)HucoFC− 26.8615932.60604
GF5 (13)Goba FronteiraLM− 26.2325032.09818Huc18 (46)HucoFC− 26.8616932.60353
GF6 (14)Goba FronteiraLM− 26.2324132.09815Huc19 (47)HucoFC− 26.8612932.60282
GF12 (15)Goba FronteiraLM− 26.2324032.09822Huc20 (48)HucoFC− 26.8602532.60309
GS09 (16)Goba SedeLM− 26.2323832.09822MSL32 (49)MassaleFC− 26.8397932.88339
MAC11 (17)MacandaLM− 26.0450932.11983MSL33 (50)MassaleFC− 26.8645832.60790
GF3 (18)Goba FronteiraLM− 26.2687932.10747MSL34 (51)MassaleFC− 26.8094832.64368
GF4 (19)Goba FronteiraLM− 26.2323332.09818MSL36 (52)MassaleFC− 26.8059032.63823
KZT6 (22)KazimatTR− 26.4130332.36338Pz41 (53)PhuzaFC− 26.7882432.67368
KZT7 (23)KazimatTR− 26.4119032.36422Pz42 (54)PhuzaFC− 26.7881732.67434
KZT9 (24)KazimatTR− 26.4096032.36578Pz43 (55)PhuzaFC− 26.7881432.67383
KZT14 (25)KazimatTR− 26.4041432.35073Pz44 (56)PhuzaFC− 26.7876032.67419
KZT15 (26)KazimatTR− 26.3880632.35008Pz45 (57)PhuzaFC− 26.8114432.66415

LM Lebombo Mountains, TR Tembe River, FC Futi Corridor.

The first two coordinates of the principal coordinate analysis (PCoA) explained 22.9% of the total variation, and populations were spatially separated into the two main groups found by STRUCTURE (Fig. 3). The neighbour-joining tree revealed several small clusters although mostly with a very low support (< 30% BS) and overall, with no association between the clusters found and the three geographic areas (Fig. 4) as reported in the other analyses. However, a clear cluster grouped all the FC geographical area.
Figure 3

Principal Coordinate analysis (PCoA) of the studied Warburgia salutaris using the scored SSRs markers. Percentage of explained variance of each axis is given in parentheses. Population labels follow Table 4. Colour of symbols (circles) indicate the two genetic groups identified by STRUCTURE. Colour of labels follow the three main geographic areas as depicted in Fig. 1. Asterisks as in Fig. 2.

Figure 4

Unrooted neighbour-joining tree of the studied Warburgia salutaris based on Nei’s Da genetic distance. Numbers associated with branches indicate bootstrap values (BS) based on 1000 replications. Only BS above 30 are shown. Colours of branches indicate the two genetic groups identified by STRUCTURE. Colour of circles near each label indicate the three main geographic areas as depicted in Fig. 1. Asterisks as in Fig. 2.

Principal Coordinate analysis (PCoA) of the studied Warburgia salutaris using the scored SSRs markers. Percentage of explained variance of each axis is given in parentheses. Population labels follow Table 4. Colour of symbols (circles) indicate the two genetic groups identified by STRUCTURE. Colour of labels follow the three main geographic areas as depicted in Fig. 1. Asterisks as in Fig. 2. Unrooted neighbour-joining tree of the studied Warburgia salutaris based on Nei’s Da genetic distance. Numbers associated with branches indicate bootstrap values (BS) based on 1000 replications. Only BS above 30 are shown. Colours of branches indicate the two genetic groups identified by STRUCTURE. Colour of circles near each label indicate the three main geographic areas as depicted in Fig. 1. Asterisks as in Fig. 2. The pairwise population FST values varied from 0.049 (TR vs. LM) to 0.114 (FC vs. TR) revealing moderate levels of genetic differentiation between FC and TR and between FC and LM and lower levels between TR and LM (Table 3).
Table 3

Pairwise population FST values for Warburgia salutaris in the three study areas.

PopulationLebombo MountainsTembe RiverFuti Corridor
Lebombo Mountains0.000
Tembe River0.0490.000
Futi Corridor0.0840.1140.000
Pairwise population FST values for Warburgia salutaris in the three study areas.

Discussion

High genetic diversity and admixture in Warburgia salutaris

Assessment of genetic diversity is critical to understand the ability of a species to cope with changing conditions and environments, especially for threatened species[39,64-68]. In this study, we reported for the first time the development of Single Sequence Repeats (SSR) markers in W. salutaris by employing next generation sequencing (Illumina platform). The 10 SSRs markers were validated and found to be highly polymorphic, with values similar to the ones found in other threatened species such as Acer miaotaiense (PIC = 0.604)[69] or Corylus avellana (PIC = 0.778)[70]. These markers are now available to extend W. salutaris population studies to a worldwide level. Additionally, the SSRs developed during this work might potentially be suitable to study genetic diversity in other species within the genus Warburgia, since only a limited number of studies is available and based on Amplified Fragment Length Polymorphism (AFLP)[62,71], a time-consuming and costly technique. To the best of our knowledge, the present study represents the first genome size estimation of W. salutaris and only the second within the Canellaceae family having a genome size 4 × smaller than Canella winterana (2C = 11.7 pg[72,73]). The relatively small genome size of W. salutaris (see methods) is within the range of the non-expanded genomes of currently known magnoliids (Fig. S2) and may facilitate future genomic initiatives although further analyses are needed to determine its ploidy level. Due to the heavy harvesting pressure to which W. salutaris is subjected in Mozambique[28,48], genetic diversity levels were expected to be low. However, we found high levels of genetic diversity in the three surveyed areas in comparison to other narrowly distributed species, as for instance, the tropical tree Paypayrola blanchetiana (Na: 2–5 alleles per locus; Ho: 0.063–0.563 in the two populations; He: 0.063–0.567 in the first population and 0.063–0.627 in the second)[39]. However, genetic diversity indices of W. salutaris were similar to other species where bark has been heavily-exploited, such as Cinchona officinalis (Na: 5.2–7.6 alleles per locus; Ho: 0.580–0.680; He: 0.616–0.717)[74] or even lower than Himatanthus drasticus (Na: 6–24; Ho: 0–0.847, He: 0–0.864)[34]. High levels of heterozygosis may be due to factors including the reproductive system such as self-incompatibility[75] or high gene flow[65,76]. Results from this work revealed a range of the inbreeding coefficient of -0.492 (TR) to -0.363 (LM), which is much lower than those found in e.g. H. drasticus (0.248–0.303)[34], Calotropis gigantea (0.167), C. procera (0.177)[77], or Phoenix theophrasti (0.9)[78]. The negative inbreeding values found here suggest the existence of random mating[79] among individuals of W. salutaris and might also explain the levels of heterozygosis found here. Indeed, the related species Warburgia ugandensis has a mixed mating system being predominantly outcrossing[62]. Additionally, insect pollinators of W. salutaris such as bees are probably able to travel over the large agricultural blocks separating the three geographical areas studied here, promoting gene flow. Genetic admixture between sites might also be facilitated by frugivorous birds that often eat the berries thereby facilitating the dispersion of seeds. In accordance, we found high levels of genetic admixture between populations with only two genetic clusters being found, one grouping the northern populations and the other one, the southern populations. Our study suggests that, although some local populations might have been severely affected by harvesting, the pepper-bark tree might have persisted in sufficient numbers in Mozambique to allow outcrossing between sites, retaining a large proportion of genetic diversity. Although there are no records of the historical distribution of this species, the studied populations could be relicts of once much larger populations that persisted in specific locations. In addition, recent conservation efforts might have diminished trade in Mozambique, avoiding severe barking in these populations. Further research should focus on understanding the factors limiting the regeneration of W. salutaris trees.

Population differentiation between geographic areas

Population differentiation of endangered species is variable. For example, low differentiation was found between populations of Platanthera leucophaea (FST < 0.02 over distances < 2 km[80]) while in H. drasticus the differentiation levels were high (FST from 0.036 to 0.077 over short distances)[34]. In contrast, the endangered Paeoma rockii revealed a high differentiation between populations (FST varied from 0.780 to 0.982)[81]. Despite the narrow distributional area of W. salutaris in Mozambique, this study revealed a high genetic differentiation between the northern populations located in LM and TR and the southern populations located in FC (Fig. 1). Pairwise FST comparisons showed lower genetic differentiation between LM and TR (0.049), which are separated by only 28 km, than either between LM and FC areas (0.084, separated by 81 km) or between TR and FC (0.114, separated by 49 km). STRUCTURE analyses also found a distinct genetic cluster in the FC area, which was also supported by PCoA analyses and the NJ tree. Contrary to LM and TR areas, where W. salutaris occurs in slopes and forest patches, in the FC area this species occurs near seasonal pans in thicket vegetation associated with termitaria on clay soils[82,83]. This might imply differences in reproductive ecology, particularly regarding flowering phenology and the activity of pollinators, which would affect gene flow with the other sites, explaining the genetic structure and population differentiation found between the studied sites. Thus, the differentiated FC genetic clusters could be harbouring novel and important alleles and should be given priority in in situ and ex situ conservation strategies in Mozambique[77,84,85].

How to conserve a species widely exploited and needed?

Several populations of W. salutaris are threatened by fire from slash and burn agriculture, as they occur in adjacent patches or in agricultural lands[48]. Equally, burning of natural vegetation to improve livestock fodder, poaching, and opening of new areas for settlements are also potential threats to the species (e.g.[86-88]). Vegetative propagation of W. salutaris is possible through tissue culture[63] although expensive. This species is being largely cultivated ex situ in South Africa[89] and in small scale in Zimbabwe[53] and Mozambique (unpublished data), to encourage the sustainable use of the species. Home gardening would also be important for this species although that requires the involvement of local communities and understanding their perceptions towards the conservation of this species. Considering the confined distribution and threatened status, the long-term persistence of W. salutaris should be secured by conserving the maximum genetic diversity of the species. As it is impossible to designate every natural wild plant habitat as a protected area, nurseries could be implemented to ensure production stability. The disclosure of genetic variation and understanding of genetic relatedness within populations is useful for their sustainable uses[90]. Knowledge of genetic diversity from other countries as the one reported here would also help to implement conservation strategies including re-introduction programs, selecting the most suitable material to be used. Understanding the degree of genetic variation between Mozambique and the neighbouring countries would facilitate transborder conservation actions. Further studies must also be conducted to detect and understand how reductions of natural regeneration or fitness are affected by harvesting. Finally, efforts to educate the local population and landowners on the importance of conserving the natural populations of W. salutaris should continue.

Methods

Study species

Warburgia salutaris is an evergreen tree, generally 5–10 m tall, but occasionally up to 20 m[57]. The flowers are small (< 7 mm in diameter), white to greenish in colour, generally solitary or in tight, few-flowered heads, borne on short, robust stalks in the axils of the leaves from autumn to winter (April–June). Flowers are bisexual, actinomorphic (having symmetrically arranged perianth parts of similar size or shape that are divisible into 3 or more equal halves). Flowers are visited by many insect species, most especially bees. The flowers develop rounded, oval berries (30 mm in diameter), usually dark-green and turning purple during ripening that occurs throughout winter an into early summer (July to December). Dispersion occurs by frugivorous birds that disperse the seeds, although fruits can also drop near the maternal tree. Leaves are glossy and dark green, with a bitter, peppery taste. The stem is covered by a brown bark marked with corky lenticels and is bitter and peppery and is widely used medicinally. The active compounds (drimanes and sesquiterpenoides) are mostly found in the inner part of the stem and root bark.

Study area

The present study was carried out in the districts of Matutuine and Namaacha (Mozambique), in the three areas of known occurrence of W. salutaris[48]: (1) Lebombo Mountains (LM) also named the western area, (2) Tembe River (TR) or centre, and (3) Futi Corridor (FC) or eastern area (Fig. 1). The climate is subtropical to tropical, encompassing a wet (October–April) and dry season (May–September). The mean annual temperature ranges from 21 to over 24 °C, and the mean annual rainfall from 600 to 1000 mm[88,91]. In LM, W. salutaris is accompanied by Acacia nigrescens Oliv., Acacia burkei Benth. and Combretum apiculatum Sond, although Aloe marlothii A. Berger, Ficus spp. and Euphorbia spp. are found in shallow soils, and Olea africana Miller and Combretum spp. in steeper stony slopes[92,93]. In TR, W. salutaris is found in sand forest patches together with Pteleopsis myrtifolia (M.A.Lawson) Engl. & Diels, Cleistanthus schlechteri Pax (Hutch.), Hymenocardia ulmoides Oliv. and Monodora junodii Engl. & Diels[94]. The open savanna woodland links the patches of W. salutaris, being composed mainly by Strychnos spp., Terminalia sericea Burch. ex DC., Acacia burkei Benth., Combretum molle R. Br. ex G.Don and Albizia versicolor Oliv.[95]. In FC, W. salutaris occurs near seasonal pans[96] in thicket vegetation associated to termitaria in clay soils[82]. Common tree species found in this community include Berchemia zeyheri (Sond.) Grubov, Pappea capensis Eckl. & Zeyh. and Olea europaea subsp. africana (Miller) P.S. Green[97]. The primary economic activities of local residents are subsistence agriculture, livestock rearing, trade of non-timber forest products and migrant labour to South Africa[87,98,99].

Population sampling, DNA extraction, genome size value, and SSR development

Based on the areas of occurrence (Senkoro et al., unpublished data), 48 individuals were sampled: 19 individuals from LM, 15 from TR and 14 from LM (Table 4). Fresh, young undamaged leaves were collected for each individual plant and frozen at − 80 °C until DNA isolation. Total genomic DNA was extracted from 50 mg of ground leaves using the InnuSPEED Plant DNA Kit (Analytik Jena Innuscreen GmbH, Germany) according to the manufacturer’s protocol. The average yield and purity were assessed spectrophotometrically by OD230, OD260 and OD280 readings (Nanodrop 2000, Thermo Fisher Scientific, Waltham, MA, USA) and visualized by electrophoresis in 1% agarose gels under UV light. Normalized DNA from five individuals of each population was used to develop the SSR markers at CD Genomics (cd-genomics.com/hi-ssrseq.html). Sampled accessions and locations of Warburgia salutaris sorted by geographical area. LM Lebombo Mountains, TR Tembe River, FC Futi Corridor. For the development of the markers, we first estimated the nuclear DNA content of W. salutaris by flow cytometry using fresh young leaves that were chopped using a razor blade together with an internal standard in a Petri dish containing 1 mL of Woody Plant Buffer[100] following the protocol described in[101]. Solanum lycopersicum ‘Stupické’ (2C = 1.96 pg)[102] was used as internal standard. The nuclear suspension was then filtered through a 30 μm nylon filter, and 50 μg/mL of propidium iodide (PI; Sigma-Aldrich, St. Louis, USA) and 50 μg/mL of RNase (Sigma-Aldrich) were added to stain the DNA only. The fluorescence intensity of nuclei was analysed using a CyFlow Space flow cytometer (Sysmex, Kobe, Japan). Four independent replicates collected from Kazimat (TR) were measured. Conversion of mass values into numbers of base pairs was done according to the factor 1 pg = 978 Mbp[103]. The mean 2C-value of W. salutaris was found to be 2.91 pg (± 0.068), corresponding to an average genome size of 2845 Mbp (Fig. S2). Samples had an average coefficient of variation of 4.18%. Genomic libraries were constructed using the KAPAHyper prep kit and sequenced by Illumina Hiseq 2500. We firstly used SSRHunter1.3 to screen the potential SSRs from the sequenced data that had at least five repeats (penta-) for 3–5 bp units. Based on the obtained sequences, primers were designed with Primer Premier 5.0 software (Table 1). Fourteen geographically representative samples of W. salutaris (LM, TR and FC; Fig. 1) were first used to test microsatellite amplification and to troubleshoot amplification conditions. Amplifications were performed in 15 μl reactions containing: 1.25U TaKaRa Hot startTaq polymerase, 1X Buffer I, 1 mM dNTPs, 5 μM Primer F and R and 100 ng DNA. The PCR amplification conditions were run as follows: 95 °C for 5 min, 94 °C for 30 s, 30 cycles of 56 °C for 30 s, 72 °C for 30 s, 94 °C for 30 s, 10 cycles of 53 °C for 30 s, 72 °C for 30 s and final extension at 60 °C for 30 min. We then considered 10 markers that presented > 20% polymorphism, which were used to amplify all samples within this study (Table 1). The amplified fragments were analysed on a 3730 × 1 gene analyzer (Thermo Fischer Scientific) and examined manually for microsatellite peaks. Allele sizes were determined using GeneMapper 3.2 (Applied Biosystems).

Estimates of genetic diversity

For each microsatellite locus, genetic polymorphism was assessed in 48 individuals by calculating the number of alleles (Na), observed heterozygosis (Ho), expected heterozygosis (He), Shannon’s diversity index (I), and inbreeding coefficient (F) using GenALEX software version 6.5[104]. The polymorphic information content (PIC) was calculated as PIC = 1 − ΣPi2, where Pi is the allele frequency for each SSR marker locus[105,106]. Values of PIC above 0.5 were considered highly informative, between 0.5 and 0.25 moderately informative, and below 0.25 less informative[107]. The Bayesian program STRUCTURE v.2.3.4[108] was used to infer the population structure and to assign individual plants to subpopulations. Models with a putative numbers of populations (K) from 1–5, imposing ancestral admixture and correlated allele frequencies priors, were considered. Ten independent runs with 50 000 burn-in steps, followed by run lengths of 1 000 000 interactions for each K, were computed. The number of clusters in the data was estimated using STRUCTURE HARVESTER[109], which identifies the optimal K based both on the posterior probability of the data for a given K and the ΔK[110]. To correctly assess the membership proportions (q values) for clusters identified in STRUCTURE, the results of the replicates at the best fit K were post-processed using CLUMPP 1.1.2[111]. GenALEX software version 6.5[104] was used to calculate the Nei’s genetic distance[112] among individuals. A Principle Coordinate Analysis (PCoA)[113] was performed to detect genetic variations between W. salutaris individuals. POPULATION 1.2[114] was used to construct an unrooted neighbour-joining tree with 1000 bootstrap replicates. The Wright’s FST value was computed to estimate population differentiation[104]. Lower genetic differentiation was considered for FST below 0.05, moderate from 0.05 to 0.15 and high genetic differentiation above 0.25[115]. Supplementary infomation. Supplementary infomation Supplementary infomation
  40 in total

Review 1.  Plant DNA flow cytometry and estimation of nuclear genome size.

Authors:  Jaroslav Dolezel; Jan Bartos
Journal:  Ann Bot       Date:  2005-01       Impact factor: 4.357

2.  Estimation of average heterozygosity and genetic distance from a small number of individuals.

Authors:  M Nei
Journal:  Genetics       Date:  1978-07       Impact factor: 4.562

3.  Genetic diversity of the endangered and narrow endemic Piperia yadonii (Orchidaceae) assessed with ISSR polymorphisms.

Authors:  Sheeja George; Jyotsna Sharma; Vern L Yadon
Journal:  Am J Bot       Date:  2009-10-26       Impact factor: 3.844

4.  Assessment of genetic variation in tomato (Solanum lycopersicum L.) inbred lines using SSR molecular markers.

Authors:  Solomon Benor; Mengyu Zhang; Zhoufei Wang; Hongsheng Zhang
Journal:  J Genet Genomics       Date:  2008-06       Impact factor: 4.275

Review 5.  Construction of a genetic linkage map in man using restriction fragment length polymorphisms.

Authors:  D Botstein; R L White; M Skolnick; R W Davis
Journal:  Am J Hum Genet       Date:  1980-05       Impact factor: 11.025

6.  Labdane and Clerodane Diterpenoids from Colophospermum mopane.

Authors:  Kun Du; Maria De Mieri; Markus Neuburger; Pieter C Zietsman; Andrew Marston; Sandy F van Vuuren; Daneel Ferreira; Matthias Hamburger; Jan H van der Westhuizen
Journal:  J Nat Prod       Date:  2015-10-07       Impact factor: 4.050

7.  Transcriptome analysis and codominant markers development in caper, a drought tolerant orphan crop with medicinal value.

Authors:  Francesco Mercati; Ignazio Fontana; Alessandro Silvestre Gristina; Adriana Martorana; Mahran El Nagar; Roberto De Michele; Silvio Fici; Francesco Carimi
Journal:  Sci Rep       Date:  2019-07-18       Impact factor: 4.379

8.  Genetic Diversity Analysis Reveals Genetic Differentiation and Strong Population Structure in Calotropis Plants.

Authors:  Nkatha G Muriira; Alice Muchugi; Anmin Yu; Jianchu Xu; Aizhong Liu
Journal:  Sci Rep       Date:  2018-05-18       Impact factor: 4.379

9.  Genetic diversity and population structure of the endangered basal angiosperm Brasenia schreberi (Cabombaceae) in China.

Authors:  Zhi-Zhong Li; Andrew W Gichira; Qing-Feng Wang; Jin-Ming Chen
Journal:  PeerJ       Date:  2018-07-13       Impact factor: 2.984

10.  Genetic diversity and population structure of Miscanthus lutarioriparius, an endemic plant of China.

Authors:  Sai Yang; Shuai Xue; Weiwei Kang; Zhuxi Qian; Zili Yi
Journal:  PLoS One       Date:  2019-02-01       Impact factor: 3.240

View more
  1 in total

1.  An updated checklist of Mozambique's vascular plants.

Authors:  Délcio Odorico; Enrico Nicosia; Castigo Datizua; Clayton Langa; Raquel Raiva; Joelma Souane; Sofia Nhalungo; Aurélio Banze; Belkiss Caetano; Vânia Nhauando; Hélio Ragú; Mário Machunguene Jr; Jónata Caminho; Leonel Mutemba; Efigénio Matusse; Jo Osborne; Bart Wursten; John Burrows; Silvio Cianciullo; Luca Malatesta; Fabio Attorre
Journal:  PhytoKeys       Date:  2022-01-28       Impact factor: 1.635

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.