Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer.

The present study investigates if the total replacement of dietary fishmeal (FM) with poultry by-product meal (PBM), supplemented with methionine influences the muscle fatty acids composition, normal gut morphology, histological traits of the liver, muscle, and gill, liver enzymes, immune and antioxidant response, and stress-related gene in juvenile barramundi, Lates calcarifer in relation to growth and feed utilization. Barramundi (3.58±0.01g) were randomly distributed into six 300 L seawater recirculating tanks (25 fish/tank) and fed two formulated isonitrogenous and isolipidic diets for 6 weeks. The control diet had FM as the sole animal protein source, whereas other test diet had only PBM as an animal protein source. Dietary PBM affected the fish performance and feed utilization. Regarding muscle fatty acid profile, total saturated fatty acids and monounsaturated fatty acids elevated while total PUFA particularly n-3 LC-PUFA and EPA decreased in PBM fed fish than control diet fed fish. Liver, muscle, gill, and intestinal histology showed no obvious alteration in control diet fed fish, however, more lipid droplets and hepatic vacuolization in the liver, necrotic myotome in muscle, hyperplasia in secondary lamellae in gill and short and broken folds in the intestine were observed in PBM fed fish. Similar to light microscopy observation of intestinal morphology, the transmission electron microscopy (TEM) analysis revealed shorter and smaller microvilli in fish fed PBM. Histopathological alterations in the liver of PBM fed fish were further associated with the elevated levels of aspartate aminotransferase (AST) and glutamate dehydrogenase (GLDH) and the significant upregulation of stress-related genes, HSP70 and HSP90. Also, a negative influence on lysozyme activity, and antioxidant enzymatic activities were recorded in fish fed PBM. Overall, it can be concluded that a total substitution of FM protein by methionine supplemented PBM negatively influenced the growth performance, liver health, histological traits of different organs, immune and antioxidant response, and expression of stress-related genes in juvenile barramundi.

Introduction

One of the major bottlenecks for carnivorous aquafeed production is the inconsistence supply of global fishmeal (FM) and escalated prices. Therefore, efforts have been exerted over several decades to investigate the feasibility of alternative dietary protein sources replacing FM in carnivore finfish aquaculture [1-4]. Presently, three main categories of FM replacements including terrestrial plant meals, rendered animal by-products, and seafood processing wastes are commercially available and used [5]. However, more than 50% of substitution of FM is now regularly achieved commercially in most carnivorous species [5], including barramundi or Asian sea bass, Lates calcarifer a commercial important carnivorous fish species [6]. Barramundi has good meat quality, ability to tolerate a wide range of salinity, and ability to adapt to the versatile farming environment [7]. It is popularly cultivated both in freshwater and seawater in Malaysia, Thailand, Taiwan, Indonesia, Saudi Arabia, and Australia, contributing USD 320 million globally [8, 9]. In Australia, barramundi farming is heavily dependent on imported FM resulting in incurring around 40% diet related cost which is the main impediment to increase the profitability [10]. Hence, nutritional studies on barramundi have commenced since the 1980s [11] and many of the studies have dedicated to replacing the FM with rendered animal meals [7, 10, 12–18] or plant meals [12, 13, 19–24].

Poultry by-product meal (PBM), an economical and easily available ingredient compared to FM contains a higher level of protein and most of the indispensable amino acids except for lysine and methionine [25-27]. Although, significant research in Australia and New Zealand has been conducted to commercially utilize PBM in various industries, its worldwide utilization is controlled by several regulations, for example the ban in European Union that has been recently lifted to allow the utilization of non-ruminant processed animal protein for aquaculture species [5]. Like other animal-based protein, another major limitation regarding the utilization of PBM is the variable digestibility due to variability in its composition and quality [28]. There have been several studies examining the effect of PBM on barramundi but results are mixed. For instance, Glencross, Blyth [29] reported that the inclusion of poultry meals up to 338g/kg does not influence the growth but beyond this level had a deleterious effect. Besides, a recent study of Simon, Salini [8] found that barramundi growth was impaired despite feeding balanced poultry protein concentrate (5–20%) while PBM along with supplementation of tuna hydrolysate could replace 90% of FM without impairing the growth [16]. In our earlier study, regardless of full-fat black soldier fly larvae supplementation, barramundi fed 90% PBM impacted the growth performance [18]. Similarly, the utilization of PBM above 50% affected the welfare of some marine fish species [25, 26, 30–32]. Imbalanced dietary essential amino acid (EAA) particularly methionine and lysine in PBM based diets are one of the major causes resulting growth depression in many fish [28]. The methionine requirement for barramundi was reported to be 2.2% [11]. In this study, methionine was supplemented to PBM to investigate if supplementation of deficient EAA in PBM could substitute FM totally.

In addition to assessing the growth performance related to non-FM protein ingredients, health aspects including the changes in serum biochemical assays, immune responses, and stress-related oxidative biomarkers are also crucial parameters of interest to aquaculturists. Nutritional factors can influence the production of oxidative enzymes [33]. Oxidative stress is characterized by an increase in malondialdehyde (MDA) and a decrease in glutathione peroxidase (GPx) [34]. The imbalance between antioxidant defences and free radical generation may cause cell damage, which may provoke the leaking of liver enzymes particularly ALT and GLDH in fish [35], associated with liver cell damage. Although published data are available on the effects of plant protein on oxidative biomarkers of barramundi [21, 22, 36, 37], there is less information on the effects of animal protein inclusions. The dietary inclusion of PBM impacted the liver health of barramundi by increasing the levels of ALT and GLDH [18], and animal protein ingredients elevated the levels of AST and ALT in hybrid grouper, Epinephelus fuscoguttatus♀× Epinephelus lanceolatus♂ [38]. Moreover, the equilibrium between oxidants and antioxidants is also important for immune cell function since it preserves the integrity and functionality of the cell membrane. Hence, it is crucial to understand the correlation between the antioxidants, liver enzymes, and immune response when entire dietary FM is replaced by any alternate- protein ingredients.

During dietary modification, it is important to consider that replacement of FM with potential ingredients do not exert adverse effects on the welfare of the tested species, as the welfare of fish in captive condition has been a growing concern over the decades [39-41]. The histological approach is one of the important frontline tools applied to assess the health status that can be achieved by evaluating the morphological status of different organs. The liver is the biggest organs involved in nutrient metabolism and producing biochemical compounds required for digestion. Muscle structure is also important as it reflects the nutritional condition and agility of the fish. The intestine is a primary immune organ in fish participated in digestion and absorption of nutrients as well as defence mechanism against microbes [42]. The evaluation of histopathological changes in these organs is important to assess the non-FM diet. Therefore, the present study aimed to investigate whether methionine supplemented PBM based diet has an ability to substitute FM completely without compromising growth performance, fatty acids composition, histological traits of different organs, serum biochemical response, stress-related genes expression, and antioxidant activities in barramundi.

Materials and methods

Animal ethical statement

The experiment was conducted at Curtin Aquatic Research Laboratory (CARL) in Curtin University, Australia in compliance with relevant guidelines and regulations set by the Australian Code of Practice for the care and use of animals for scientific purposes. All methods involving fish were reviewed and approved by the Curtin University Animal Ethics Committee (ARE2018-37). Prior to handling fish, AQUI-S® was used as anaesthesia and an overdose of AQUI-S was used as euthanasia to minimise stress, pain, and discomfort to the fish following the protocol of the Curtin Research Laboratories standard operating procedure (SOP) of anaesthetizing and euthanizing of fish.

Experimental diets

Except PBM, all the ingredients required for formulating test diets were purchased from the Special Feeds, 3150 Great Eastern Hwy, Glen Forrest, WA. Two isonitrogenous and isolipidic containing approximately 48% crude protein and 13% crude lipid were prepared to meet the nutritional requirement of barramundi [43]. FM and PBM were used as the main protein source and canola oil and cod liver oil were used as lipid sources. A control diet was prepared based on FM and another diet was formulated by replacing 100% of FM with PBM supplemented with 0.40% methionine (Table 1) to meet the established methionine requirement for normal growth of barramundi [11, 44]. The diets were formulated in compliance with the standard protocol of CARL. Briefly, all the dry ingredients were mixed homogeneously using a food mixture (Hobart Food equipment, Australia) before blending with fish oil and distilled warm water to make a stiff dough. The dough was passed through a mincer to make 3 mm pellets, then spread out and dried in an oven at 60°C for 36 hours. After drying, pellets were sealed in plastic bags before refrigerating at 4°C until used in the feeding trial. The fatty acid and amino acid profile of test diets and PBM is shown in Table 2 and Table 3, respectively.

Table 1

Formulation and proximate composition of test diets for barramundi.

Ingredientsa (g/100g DM)	Control	100PBM
†FM	72.00	0.00
‡PBMb	0.00	69.50
Canola oil	1.00	3.00
Cod liver oil	0.50	6.00
Corn/wheat starch	7.00	7.00
wheat (10 CP)	16.90	11.50
Lecithin—Soy (70%)	1.00	1.00
Vitamin C	0.05	0.05
Dicalcium Phosphate	0.05	0.05
Methionine	0.00	0.40
Vitamin and mineral premix	0.50	0.50
Salt (NaCl)	1.00	1.00
Proximate composition (% dry weight)c
Moisture	14.96	13.98
Crude Protein	47.88	47.86
Crude Lipid	12.59	12.71
Ash	9.67	10.24
Gross energy (MJ/kg)	20.23	19.95

a Specialty Feeds, Glen Forrest Stockfeeders, 3150 Great Eastern Highway, Glen Forrest, Western Australia 6071.

bKindly provided by Derby Industries Pty Ltd T/A, Talloman Lot Lakes Rd, Hazelmere WA 6055.

cAnalysed according to Association of Official Analytical Chemists (AOAC) [45].

† FM (Fishmeal): 64.0% crude protein, 10.76% crude lipid and 19.12% ash.

‡ PBM (Poultry by-product meal): 67.13% crude protein, 13.52% crude lipid and 13.34% ash.

Table 2

Fatty acids (mg/100g of dry sample) composition of control and test diet replacing FM totally with PBM in barramundi.

	Experimental diets
Fatty acids	Control	100PBM	PBM
C12:0	2.73	7.11	9.39
C14:0	131.63	342.45	73.69
C16:0	1161.21	2090.88	2336.27
∑SFA1	1981.40	3216.29	3344.73
C14:1n5	1.52	11.32	16.26
C16:1n7	165.22	435.58	540.27
C18:1cis+trans	1158.94	3800.14	4410.64
C20:1	79.86	483.71	60.84
∑MUFA2	1482.21	4873.58	5057.95
C18:3n3	120.20	285.67	260.39
C20:5n3 (EPA)	178.50	278.99	16.79
C22:5n3#	63.30	64.60	36.67
C22:6n3 (DHA)	908.53	455.23	27.47
∑n-3 PUFA3	1309.12	1240.95	358.96
C18:3n6	8.84	10.58	23.07
C20:3n6	15.50	18.76	56.76
C20:4n6	112.83	43.18	180.13
C22:4n6#	91.14	16.39	4.78
∑n-6 PUFA	228.31	88.91	264.74
∑n-3/n-6	5.73	13.96	1.36
∑PUFA4	2184.01	2437.48	2386.97
∑n-3 LC-PUFA	1158.61	806.57	85.36

1Contains 10:0, 13:0, 15:0, 17:0, 18:0, 20:0, 21:0, 22:0 and 23:0.

2Contains C15:1, C17:1, C22:1n9 and C24:1.

3Contains C18:4n3, C20:3n3.

4Contains C18:2 trans, C18:2 cis, C20:2, C22:2.

Poultry by-product meal, PBM; saturated fatty acids, SFA; monounsaturated fatty acids, MUFA; polyunsaturated fatty acids, PUFA.

Eicosapentaenoic acid, EPA; DHA, docosahexaenoic acid, sum of saturated fatty acids, ∑SFA; sum of monounsaturated fatty acids, ∑MUFA; sum of polyunsaturated fatty acids, ∑PUFA; sum of omega-3 polyunsaturated fatty acids, ∑n-3 PUFA; sum of omega-6 polyunsaturated fatty acids, ∑n-6 PUFA and LC-PUFA, long-chain polyunsaturated fatty acids (sum of 20:3n-3, 20:5n-3, 22:5n-3 and 22:6n-3).

Table 3

Amino acids (g/100g on dry matter basis) composition of test diets and PBM.

	Experimental diets
Amino acidsa	Control	100PBM	PBM
Hydroxyproline	1.7	3.2	3.2
Histidine	2.4	1.8	1.8
Taurine	0.5	0.5	0.4
Serine	5.3	5.0	5.0
Arginine	4.5	4.8	5.1
Glycine	13.2	16.4	16.5
Aspartic acid	8.8	7.8	7.8
Glutamic acid	11.7	12.1	11.5
Threonine	4.9	4.2	4.3
Alanine	9.4	9.1	9.1
Proline	6.1	7.3	7.0
Lysine	6.2	5.3	5.5
Tyrosine	2.0	1.8	2.0
Methionine	2.4	2.2	1.8
Valine	5.6	5.2	5.1
Isoleucine	4.3	3.8	3.8
Leucine	7.6	6.4	6.9
Phenylalanine	3.3	3.0	3.0

aDetermined including hydroxyproline and taurine analysis following our earlier study [46].

Fish husbandry and management

Three hundred and fifty barramundi were obtained from the Australian Centre for Applied Aquaculture Research (ACAAR), Fremantle, Australia in oxygenated plastic bags. Prior to commencing the trial, all fish were stocked into two fiberglass tanks (300 L) filled with ocean water and fed a commercial diet (470 g protein kg−1 diet and 20.0 MJ kg−1dietary gross energy) twice daily for two weeks to acclimate them to CARL experimental facilities and conditions. Following acclimation, 150 normal and visually healthy fish averaging (3.58±0.01g) were randomly distributed into six 300-L tanks, containing 250 L water in each tank. Therefore, stocking number of barramundi in each tank was 25. Each tank was equipped with an aerator, electric heater, and external bio-filter (Astro® 2212, China) to maintain DO, temperature, and other water quality parameters at an optimal level. Hence, the temperature was maintained at 27.90–29.20°C, dissolved oxygen (DO) at 5.92–7.42 mgL−1, salinity at 32–36 ppt, and photoperiod as 14:10 h LD. Commercial test kits were used to test ammonia nitrogen (<0.50 mgL−1) and nitrite (<0.50 mgL−1) level regularly. Each test diet had three replicates and fed by hand twice daily at 8.00 am and 6.00 pm to visual satiety levels for 42 days. Uneaten feed, if any, was collected by siphoning to calculate feed intake, and the number of dead fish were monitored daily to assess the fish survival rate. After 42 days, all fish were starved for 24 h prior to weighing total biomass to analyse the growth performance.

Fatty acids profile

Fish muscles in the form of three samples per dietary treatment were used for fatty acids analysis. Four fish muscle was filleted, wrapped with aluminium foil, freeze-dried, and pooled together. The fatty acids profile of experimental diets and fish flesh was carried out following the protocol of O'Fallon, Busboom [47], and Siddik, Chungu [7]. Approximately 0.5g of sample was hydrolysed at 55°C for 1.5 hrs with 0.1ml of internal standard (1.2g nonadecanoic acid in 100ml chloroform), 0.7ml of 10N KOH and 5.3ml of methanol. The sample was then methylated at 55°C for 1.5hrs with 0.6mL of 24N of sulphuric acid. The FAMES was extracted into 1ml of hexane and then quantified gas chromatography with flame ionization detection. The column used was a capillary column HP INNOWax GC column (60m x 0.25mm ID film 0.50 micron) with hydrogen as the carrier gas. Each sample were run in triplicate and results are expressed as an average.

Histological and Transmission Electron Micrograph (TEM) analysis

After 42 days of feeding, one fish from each tank was randomly euthanized with AQUI-S at 175 mg/L to excise liver, muscle, gill, and intestine for histological and TEM evaluation in response to test diets. For histological analysis, samples of all organs were fixed immediately in 10% buffered formalin, subsequently dehydrated with series of ethanol, infiltrated in xylene, and embedded in paraffin wax, as per standard histological protocols. Section of approximately 5 μm thickness was stained with Periodic Acid-Schiff (PAS) and digitally photographed under a light microscope (BX40F4, Olympus, Tokyo, Japan).

For TEM analysis, freshly collected intestinal samples washed in 2.5% glutaraldehyde buffered in 1x PBS at pH 7.4 before performing secondary fixation in 1% OsO4 (80 W 2 min on, 2 min off, 2 min on), dehydrating in ethanol (50, 70, 95 and 100% at 250 W, 40 seach) and infiltrating finally with epoxy resin in acetone (Procure 812, Proscitech) (1:3, 1:1, 3:1ratios at 250 W, 3 min each). Samples were processed as described in the earlier study in our lab [16] and screened a LaB6 TEM (JEOL2100, Japan) at 120 kV. The electron micrographs obtained from TEM analysis at 30,000 magnification were analysed using ImageJ (National Institute of Health, USA) to determine microvilli length and diameter.

Antioxidant status assessment

The enzyme activities of serum malondialdehyde (MDA) was determined using commercial assay kits following the manufacturer's instructions (Bockit, BIOQUOCHEM SL, 33428 Llanera-Asturias, Spain) and glutathione peroxidase (GPx) was measured with the Randox Laboratories test combination (Ransel, Antrim, United Kingdom) following the protocol of earlier study in our laboratory [22].

Serum biochemistry and immunity

Fish were captured gently at 42 days post-feeding, immediately dipped in a bucket containing 8 mg l−1 of AQUI-S®, and blood was taken by puncturing caudal vessels using 1 mL non-heparinized syringes (22G). Blood was allowed to clot for 24 h at 4°C, centrifuged for 15 min at 3000 rpm and 4°C, the serum collected and stored immediately at—80°C for the analysis of serum biochemical parameters, oxidative biomarkers, and immune parameters. Serum clinical chemistry and immune-related parameters were analysed according to the protocol of our earlier study [18, 46].

RNA extraction and qRT-PCR analysis

Liver from control and PBM fed fish were aseptically collected after euthanizing (AQUI-S, 175 mg l−1) the fish and preserved in RNA Later (Sigma-Aldrich, Germany) at—80°C until RNA extraction. Five milligrams of liver tissue stored in RNA Later was used for RNA extraction using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer protocol. The quality of RNA was checked by gel electrophoresis and, the purity and quantity were determined gel electrophoresis before synthesizing complementary DNA (cDNA) from 1 μg of total RNA using Omnicript RT kit (Qiagen, Hilden, Germany) following the instruction of manufacturer’s company. qRT-PCR on stress-related genes were performed by PowerUpTM Cyber Green Master Mix (Thermo Scientific, USA) with 7500 Real-Time PCR System (Applied Biosystems, USA) and data were normalised against housekeeping genes, 18S rRNA and Ef1-a, (Table 4) and analysed using REST© software [48].

Table 4

Primers of qPCR used in the experiment.

Genes	Sequences (5ʹ - 3ʹ)	Product size	Tm (°C)
Heat shock protein kDa70, HSP70	F: AAGGCAGAGGATGATGTC	186	59	Mohd-Shaharuddin, Mohd-Adnan [48]
	R: TGCAGTCTGGTTCTTGTC
Heat shock protein kDa90, HSP90	F: ACCTCCCTCACAGAATACC	197	59	Mohd-Shaharuddin, Mohd-Adnan [48]
	R: CTCTTGCCATCAAACTCC
18S rRNA, 18S	F: TGGTTAATTCCGATAACGAACGA	94	59/60	Mohd-Shaharuddin, Mohd-Adnan [48]
	R: CGCCACTTGTCCCTCTAAGAA
Elongation factor-1α, ef1α	F: AAATTGGCGGTATTGGAAC	83	59/60	Mohd-Shaharuddin, Mohd-Adnan [48]
	R: GGGAGCAAAGGTGACGAC

Calculation and statistics

Specific growth rate (SGR), feed conversion ratio (FCR) and total feed intake (TFI) were calculated using the following equations-

All data were represented as mean±SE. The differences between control and PBM fed fish in all data were determined by unpaired student t-test at the significance level of 0.05 < P < 0.001. Percent survival at the termination of the feeding trial was plotted using the Kaplan-Meier survival method with the Log-rank (Mantel-Cox) test.

Results

Growth performance, feed utilization and survival

Fish growth, feed intake, and survival rate in response to 42 days feeding trial are presented in Table 5 and Fig 1. The mean final body weight (FBW) and specific growth rate (SGR) of fish fed PBM were significantly lower than the FBG and SGR of fish fed the control diet. FCR in PBM fed fish increased with lower feed intake in PBM fed fish. Survival rate (Fig 1), as drawn by Kaplan-Meier survival analysis with 95% confidence at the end of the 42 days trial decreased significantly in PBM fed fish (81.33%) than the control (93.33%) (χ2100PBM = 4.514, df = 1, P = 0.034).

Table 5

Fish performance including Final Body Weight (FBW), Weight Gain (WG), Specific Growth Rate (SGR), Feed Intake (FI), and Feed Conversion Ratio (FCR) of barramundi when fed control and PBM based diet over a period of 42 days.

Growth performance	Experimental diets		Unpaired t-test
	Control	100PBM	t-value	P-value
IW (g)	3.52±0.02	3.49±0.06	0.82	0.46
FBW (g)	54.91±0.55a	32.67±0.23b	37.38	0.00
WG (g)	51.39±0.53a	29.18±0.23b	38.93	0.00
SGR (%/d)	6.54±0.01a	5.33±0.02b	55.36	0.00
FI (g/fish d-1)	1.21±0.12a	0.86±0.01b	3.051	0.04
FCR (FCR)	0.99±0.15a	1.24±0.01b	-2.97	0.04

Results are expressed as mean ± SE (standard error) (n = 3).

Fig 1

Survival rate based on Kaplan-Meier survival analysis with Log-rank (Mantel-Cox) test of barramundi after 42 days feeding with either basal diet or PBM based diet.

Dotted line in survival plot indicates 95% confidence interval and P value indicate significant at 0.05.

Muscle fatty acids composition

The FAs profile of barramundi muscle at the termination of 42 days trial was influenced by the PBM based diet (Table 6). The dietary inclusion of PBM significantly augmented total SFA. All SFA including capric acid (C10:0), lauric acid (C12:0), myristic acid (C14:0), palmitic acid (C16:0), margaric acid (C17:0), stearic acid (C18:0), arachidic acid (C20:0), heneicosylic acid (C21:0), behenic acid (C22:0) and tricosylic acid (C23:0) except for tridecylic acid (C13:0), and pentadecylic acid (C15:0) were significantly higher in the muscles of fish fed PBM. Similarly, total MUFA concentration increased in the muscle of PBM fed fish. PUFA differed significantly between the test diets, with lower concentration of n-3 LC-PUFA and C22:4n6 in PBM fed fish than the fish fed the control diet. Similar result was recorded in ∑n-3/∑n-6 ratio.

Table 6

Fatty acids (mg/100g on dry matter basis) of barramundi muscle when fed control and PBM based diet over a period of 42 days.

Fatty acid	Experimental diets		Unpaired t-test
	Control	100PBM	t-value	P-value
C12:0	1.02±0.09a	291.96±1.27b	-228.29	0.00
C14:0	67.46±0.77a	213.36±0.48b	-158.64	0.00
C16:0	713.65±10.19a	1253.24±68.93b	-7.75	0.00
∑SFA1	1153.45±15.15	2320.11±65.41	-17.38	0.00
C16:1n7	130.78±1.90a	286.88±2.21b	-53.82	0.00
C20:1	36.62±0.38a	111.68±2.97b	-25.07	0.00
C14:1n5	0.97±0.03a	6.30±0.06b	-84.46	0.00
C18:1cis+trans	859.76±5.73a	2961.30±69.99b	-29.93	0.00
∑MUFA2	1066.66±8.25a	3412.55±74.01b	-31.50	0.00
C18:3n3	55.12±0.38a	213.57±3.10b	-50.94	0.00
C20:5n3 (EPA)	109.31±1.78	113.69±1.31	-1.97	0.12
C22:5n3	71.50±0.95a	78.82±0.44b	-7.14	0.00
C22:6n3 (DHA)	683.13±12.43a	370.84±1.99b	24.82	0.00
∑n-3 PUFA3	940.67±15.93a	821.03±11.05b	5.24	0.01
C20:3n6	25.68±0.57a	49.16±2.84b	-8.07	0.00
C20:4n6	92.29±1.90a	114.06±3.54b	-5.43	0.01
C18:3n6	17.51±1.42a	51.44±6.52b	-5.08	0.01
C22:4n6	62.67±1.07a	23.06±0.26b	36.20	0.00
∑n-6 PUFA	198.15±3.86a	237.72±12.61b	-9.15	0.00
∑n-3/∑n-6	4.75±0.04a	3.47±0.18b	6.78	0.00
∑PUFA4	1485.98±24.56	1311.18±9.36	2.86	0.05
∑n-3 LC-PUFA3	868.55±15.25	569.45±2.78	19.29	0.00

Results are expressed as mean ± SE (standard error) (n = 3).

1Contains 10:0, 13:0, 15:0, 17:0, 18:0, 20:0, 21:0, 22:0 and 23:0.

2Contains C15:1, C17:1, C22:1n9 and C24:1.

3Contains C18:4n3, C20:3n3.

4Contains C18:2 trans, C18:2 cis, C20:2, C22:2.

Poultry by-product meal, PBM; saturated fatty acids, SFA; monounsaturated fatty acids, MUFA; polyunsaturated fatty acids, PUFA and LC-PUFA, long-chain polyunsaturated fatty acids (sum of 20:3n-3, 20:5n-3, 22:5n-3 and 22:6n-3).

Different superscripts letter indicate significant difference at P < 0.05, 0.01 and 0.001, followed by an unpaired student t-test.

Histopathology of liver, muscle, gill and intestine

Total replacement of FM with PBM dysregulated the histological structure of liver, muscle, gills, and intestine (Fig 2A–2H). The liver of control (Fig 2A) fed fish showed higher pigmentation of hepatocyte cytoplasm, indicating a higher amount of glycogen, while the liver of PBM fed fish (Fig 2B) showed less hepatocyte cytoplasm pigmentation, indicating less amount of glycogen with more lipid vacuolization. Healthy and normal myotome were observed in the muscle of the fish fed the control diet (Fig 2C) but necrotic myotome was found in the fish fed PBM diet (Fig 2D). Control fed fish showed normal gill structure (Fig 2E) but hyperplasia in secondary lamellae was recorded in PBM fed fish (Fig 2F). All the examined fish fed control (Fig 2G) presented normal intestinal structure whilst broken and short fold were found in fish fed PBM (Fig 2H).

Fig 2

Liver (A-B), muscle (C-D), gill (E-F) (PAS stain; 40 × magnification; scale bar = 50 μm) and distal intestine (G-H) (PAS stain; 4 × magnification; scale bar = 500 μm) sections of barramundi fed control and PBM based diet at the end of 42 days of feeding trial. Lipid droplet, LD; healthy myotome, HM; necrotic myotome, NM; secondary lamellae, SL; hyperplasia in secondary gill lamellae, HSL and broken fold, BF.

Intestinal morphology

The distal intestine of barramundi fed control (Fig 3A) and PBM (Fig 3B) were examined by transmission electron microscope. Microvilli height (Fig 3D) (t = 6.727, df = 28, P < 0.0001) and diameter (Fig 3E) (t = 3.494, df = 28, P = 0.0016) of barramundi fed PBM diet was significantly lower than barramundi fed control diet.

Fig 3

Observation of TEM in the intestine of barramundi fed Control (A) and PBM (B) at the end of 42 days of feeding trial. (C) Microvilli height and diameter measurement and comparison of microvilli height and diameter (panel D & E), performed by an unpaired student t-test at P <0.05 and 0.01. Microvilli, MV; Microvilli height, MVH; tight junction, TJ; microvilli diameter, MVD.

Liver enzymes, immunity and stress related genes

Liver enzymes (AST and GLDH), immune response including serum lysozyme and bactericidal activity and stress related genes (HSP70 and HSP90) were significantly induced by the experimental diets (Fig 4). AST and GLDH in PBM fed fish was significantly higher than the control (t = 2.268, df = 10, P = 0.047 and t = 3.199, df = 10, P = 0.010) (Fig 4A and 4B), while serum lysozyme decreased significantly in PBM fed fish compared to control (t = 2.842, df = 10, P = 0.018) (Fig 4C). Meanwhile, none of the diets had significant effects on bactericidal activity (t = 1.572, df = 10, P = 0.147) (Fig 4D). In line with liver enzymes, similar results were observed in HSP70 and HSP90 when compared with control (t = 2.905, df = 10, P = 0.016 and t = 5.102, df = 10, P = 0.001) (Fig 4E and 4F).

Fig 4

AST, aspartate aminotransferase (A) and GLDH, glutamate dehydrogenase (B), lysozyme (C), bactericidal activity (D) and heat shock related gene including HSP70 (E) and HSP90 (F) in barramundi after 42 days feeding with either control diet or PBM based diet. P values indicate significant at P < 0.05, 0.01 and 0.001, followed by an unpaired student t-test.

Antioxidant activity

Antioxidant activities of blood serum were significantly affected by total inclusion of PBM. Serum GPx activity declined significantly in PBM fed fish (t = 2.833, df = 10, P = 0.017) (Fig 5A), while MDA increased significant in PBM (t = 2.251, df = 10, P = 0.048) (Fig 5B) with respect to control.

Fig 5

(A) GPx (Ug-1 Hb) and (B) MDA (nmol mL-1) in the serum of barramundi after 42 days feeding with either control diet or PBM based diet. P values indicate significant at P < 0.05, 0.01 and 0.001, followed by an unpaired student t-test.

Discussion

A good number of studies have been devoted over the years to incorporate different levels of PBM, at the expense of FM in the diet of finfish and shellfish aquaculture [28] but most of the studies were performed on the basic nutritional aspects including proximate composition, amino acids, and fatty acid content, and its potential effect on the growth performance of the host fish [49-51]. In depth investigations are still lacking pertaining to the effects of PBM on the integrity of different organs, stress-related genes expression, or antioxidative responses in barramundi.

Establishing protein derived from animal industry as an ideal feed for finfish aquaculture, a series of studies have been conducted in Australia especially on barramundi. For instance, dietary inclusion of high-quality poultry protein concentrate from 5 to 20% demonstrated a reduced growth performance despite providing balanced amino acids in the diet but the reverse trend was observed when supplemented with phosphorous [8]. On the contrary, Siddik, Howieson [16] were able to replace 90% FM with either bioprocessed or unprocessed PBM along with supplementation of fish protein hydrolysate with no apparent effects on the growth performance. In the present study, barramundi fed PBM supplemented with methionine affected the growth, feed utilization, FCR, and survival rate. Similarly, feeding barramundi non-FM based diet containing 450 g kg-1 PBM and 285 g kg-1 soybean meal impacted the growth, feed intake, and FCR despite supplementing taurine and the presumable reasons were palatability [29]. Deterioration in the growth performance of gibel carp, Carassius auratus gibelio was also observed when fed 100% animal protein containing PBM and meat and bone meal despite supplementation with methionine and lysine [52]. The possible reasons were the nutritional superiority or enhanced palatability in FM that could not be met up by PBM and MBM. Methionine, lysine and arginine levels in the 100PBM diet were at optimum level for barramundi growth [11] but histidine, isoleucine, and phenylalanine were lower compare to FM based diet which may suppress the growth performance. Similarly, deficiency of histidine, methionine, isoleucine, lysine, and phenylalanine were identified to reduce the growth performance of spotted rose snapper, Lutjanus guttatus with higher inclusion of PBM [53]. Moreover, the abundance of MUFA and n-6 PUFA coupled with a deficiency of EFA particularly n-3 LC-PUFA, EPA and DHA in PBM were highlighted as one of the reasons for the reduced growth in Totoaba [54], catfish, Ictalurus punctatus [55], black sea turbot, Psetta maeotica [30] and gilthead sea bream, Sparus aurata L [56]. Similarly, higher MUFA content and lower levels of PUFA, in particular, n-3 LC-PUFA and EPA contents were found in 100PBM diets that could be responsible for the negative influence on growth, survival feed utilization and FCR. In addition, n-3 PUFA have been reported as an indispensable FAs for optimum growth and survival of many marine fish species [28, 56]. However, these findings contradict with the results of Panicz, Żochowska‐Kujawska [57], Gunben, Senoo [58] and Shapawi, Ng [32] who reported no adverse effects of 100PBM on the growth and biometry indices of female tenches, Tinca tinca, tiger grouper juveniles, Epinephelus fuscoguttatus and humpback grouper, Cromileptes altivelis. This heterogeneity might be due to use different fish species and culture system or variability in nutritional composition palatability, and digestibility of PBM as it varies from batch to batch or among supplier companies [18, 28].

FAs composition of diet affects the FAs composition of fish muscle or meat which have been reported in many fish species [59-61]. In the present study, FAs of barramundi fillet were affected by the PBM diet. Total muscle SFA concentration was significantly higher in PBM fed fish may be due to the abundance of palmitic acid and myristic acid in fish muscle that are reflected in the PBM diet. A higher concentration of total SFA due to a high abundance of palmitic acid was observed in juvenile black sea bass fed 100PBM [62]. Muscle MUFA content in the present study increased in PBM fed fish which could be due to higher proportion MUFA in the diet. This finding was similar to our earlier study [46]. Lower concentration of n-3 LC-PUFA and adrenic acid in fish muscle resulted in low total PUFA and n-3/n-6 ratio which are similar to the findings in barramundi fed high levels of PBM [7]. Similarly, 100PBM was lacking in essential fatty acids (EFAs) and also worsened the EFAs in the muscle of totoaba juveniles, Totoaba macdonaldi [54]. These results demonstrated that the total substitution of FM with PBM decreased PUFA levels in barramundi, which may consequently affect the nutritional value in terms of fatty acids available for human consumption.

It is well known that AST and GLDH are two important enzymes which primarily exist in liver at lower levels under normal condition but can leak into the blood rapidly when liver cells are damaged due to various stressors [63, 64]. In the present study, the PBM diet significantly increased the levels of AST and GLDH in the serum of barramundi, concomitant with the histopathological damage of liver tissue. Likewise, plasma ALT was negatively impacted by the inclusion of animal protein blend (APB) (20% to 80%) in the diet of hybrid grouper while AST augmented significantly in 80% APB fed fish [38]. However, Panicz, Żochowska‐Kujawska [57] reported no effects on blood biochemical parameters of juvenile tenches, Tinca tinca fed graded levels of PBM (25.7 to 100%).

To further clarify the effects of PBM on the liver function of barramundi, heat shock-related genes including HSP70 and HSP90 were examined. HSP70 and HSP90 are two important stress-related protein and their expression level elevate significantly when fish are exposed to different stressors, including pathogenic infection, crowding, poor water quality, and nutritionally deficient diet [65-67]. In the present study, both HSP70 and HSP90 upregulated significantly in the liver of barramundi that received 100PBM, indicating that 100% inclusion of PBM could act as a stressor.

In fish, immune functions of immune organs are strongly associated with the presence and activity of a unique array of molecules including lysozyme, complement proteins, immunoglobulins [68-70], and bactericidal activity that are influenced by the dietary modifications. Serum lysozyme was negatively triggered by PBM diet that support the findings of Subhadra, Lochmann [71, 72], who reported aggravated levels of complement and lysozyme activity in PBM fed largemouth bass, Micropterus salmoides.

Substitution of 100% FM with PBM resulted in lipidosis with clearly visible inflammation in the liver of juvenile tenches, Tinca tinca [57], supporting our present findings as hepatocyte lipid vacuolization with less amount of glycogen was observed in the liver tissue of barramundi fed PBM. The excessive amount of fat deposition in the liver negatively impacted the growth and immune response of fish [73] that are synchronous with the immunological results in the present study. Similarly, Siddik, Chungu [7] fed juvenile barramundi with different levels of PBM for 42 days and reported irregular liver arrangement with lipid deposition in the 100% PBM and bioprocessed PBM groups. Furthermore, higher administration of animal protein blend affected the morphology of the liver of hybrid grouper, characterized by hepatic vacuoles and a high amounts of lipid droplets which is a sign of hepatic steatosis [38]. The lipid accumulation in the liver may occur when dietary lipid exceeds the capacity of the hepatic cells to oxidize which lead to synthesize and deposit larger amounts of triglyceride in vacuoles [38, 73, 74].

Muscle structure is the determinant of fish growth and can be affected by nutritionally-deprived diet [75]. For example, nutritional deficiency altered the muscle structure of Atlantic salmon, Salmo salar including myodegeneration [76]. Similarly, fish fed PBM diet showed necrosis and fibre degeneration in muscle. Gill is one of the important immune organs in fish and its structure can be affected by stress and diet [77]. In the present study, hyperplasia in secondary gill lamellae was in PBM fed fish but the possible reasons are not well understood, deserving further study.

Evaluating intestinal morphology in response to dietary changes is important to determine the health status and welfare of fish. Intestinal morphology, in particular, villous structure, and microvillus height and diameter is related to absorption and assimilation of nutrient and immunological function [16, 78, 79]. Histological analysis showed that broken and short fold in the present study in PBM fed groups are in line with TEM results, showing significantly smaller with a shorter diameter of microvilli, which are responsible for the lower efficiency of nutrient uptake, thus suppressing the growth and survival. Similar results were reported by Siddik, Howieson [16] who found significantly lower microvilli height in the distal intestine of barramundi after 56 days post-feeding with 10% supplemented 90PBM. Hence total replacement of FM with PBM impacted the welfare of barramundi, as reflected by the histological and TEM analysis.

Antioxidant status in fish, as determined by several antioxidant enzymes including CAT, SOD, GPx, and MDA have been considered as the first line of defensive biomarkers to protect cells and tissues from oxidative damage, caused by some free radicals such as superoxide anion (O2-), hydrogen peroxide (H2O2) and hydroxyl radical (OH) [80, 81]. Glutathione peroxidase, GPx is an important antioxidant enzyme showing strong radical-scavenging capacity against free radicals and lipid peroxides [82]. The present study detected a significantly lower activity of GPx in the serum of barramundi fed with PBM, which may due to the lower levels of n-3 LC-PUFA and DHA in 100PBM diet. Liu, Mai [83] reported that marine fish are susceptible to oxidative stress due to their high demand for LC-PUFA. However, elevated serum GPx activity in barramundi fed 90% fermented PBM supplemented with tuna hydrolysate [17] might be due to the antioxidant capacity of fish protein hydrolysate [84]. It has been reported that the GPx activity is well correlated with the concentration of MDA [85]. MDA is a natural biomarker and main ending product of lipid peroxidation [86, 87] and its elevation indicates oxidative injury [88] and associates with the pathological state of animals including cell structure damage and function [86, 87]. A lower activity of GPx with the higher level of MDA indicates that PBM based diet may provoke the oxidative damage of barramundi which was further proven by the presence of hepatocyte lipid vacuolization.

In summary, regardless of methionine supplementation, the total replacement of FM with PBM is not nutritionally adequate for barramundi, as indicated by depressed growth performance and immune response. An unfavourable effect of a PBM based diet was observed on antioxidant enzymes. Also, adding PBM induced the lipid droplet in the liver for barramundi via affecting the expression levels of heat shock related genes and liver enzymes. Feeding PBM not only triggered the fiber degeneration and necrosis in muscle and hyperplasia in gills but also induced the intestinal villus morphology by decreasing intestinal microvilli morphology, which may suggest that high levels of PBM could impair the welfare of barramundi. Further studies need to be conducted along with supplementation of other EAA and/or EFA with PBM to investigate the welfare of farmed barramundi.

30 Apr 2020

PONE-D-20-07405

Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer

PLOS ONE

Dear Mr Chaklader,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jun 14 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements:

1.    Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 1 in your text; if accepted, production will need this reference to link the reader to the Table.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors present an interesting and well-constructed experiment evaluating fishmeal and poultry meal based diets fed to juvenile barramundi. There are consistent issues throughout with the writing style not being in a scientific contest, the description of results, discussion and conclusions need to be improved. Quiet clear is the lack of appropriate citation relevant to the study.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-20-07405_reviewer (1).pdf

Click here for additional data file.

Submitted filename: Plos One Review PONE.pdf

Click here for additional data file.

17 Jul 2020

RESPONSE TO REVIEWER

General comments:

The authors present an interesting and well-constructed manuscript evaluating fishmeal and poultry meal based diets fed to juvenile barramundi. There are consistent issues throughout with the writing style in a scientific contest, the description of results, discussion and conclusions need to be improved. Quiet clear is the lack of appropriate citation and relevance to the study. My most obvious concern with the work is the lack of understanding in the field, in particular with the species in question. The barramundi is a very well understood species, with a lot of very old publication and work undertaken by various labs predominantly in Australian and south east Asia. This dates back around 30 years. I can find specific reference to the use of poultry meal in barramundi diets published in 1998. So, this is by no means a novel raw material for barramundi. The use of terrestrial meals as protein in barramundi is fundamentally well understood, and taking a deep dive we can see that there are studies that even evaluate multiple poultry meal types and their level of processing on the performance of barramundi. So this is not a new area of research. Moreover, their selection of relevant references is odd given there are numerous papers specifically on barramundi yet they chose to cite authors working on vastly different fish in the introduction. Its just a comment rather than criticism but I think should be revised.

Response: We have revised introduction and discussion with relevant citations. We fully acknowledge the fact that the PBM is not a novel raw material used in barramundi and their inclusion in the diet of aquaculture species is not a new area of research. To date, many of the studies, have focused on the nutritional value of PBM, including proximate composition, amino acids and fatty acids contents and its effect on fish growth. Though, research on the utilization of PBM started 30 years before, still there is no consistency in the results when PBM is fed to barramundi or other carnivorous fish species. The results, so far, have been mixed in terms of effective quantities of dietary inclusion of PBM, relationship between inclusion levels with growth performance of the host species, including barramundi, nutritional profiles of the PBM included diets, etc. However, there surely exists lack of information and the understanding on the effects of PBM on the architecture of different organs or other physiological parameters including stress related oxidative biomarkers and stress related genes. A recent studies in our laboratory was able to replace 90% of fishmeal with PBM assisted with the supplementation of fish protein hydrolysate (Siddik et al., 2019) while other study was able to include only 20% of fishmeal, with high quality poultry protein along with phosphorous supplementation (Simon et al., 2019). In addition, a recent study of Ye et al., (2019) reported that feeding graded levels of animal protein blend (20-80%) containing poultry by-product meal, shrimp meal and spray-dried blood meal negatively impacted the growth, feed efficiency and protein efficiency ratio, nutrient composition of lipid, liver structure and plasma biochemical parameters of juvenile hybrid grouper (Epinephelus fuscoguttatus♀× Epinephelus lanceolatus♂). Hence, this inconsistence in previous studies reinforced with molecular data have motivated us to conduct this research in order to improve the utilization of PBM in barramundi diet. The outcome of this research being the current MS was aimed to replace one hundred percent of fishmeal with PBM not only using growth but other physiological and molecular approaches.

Siddik MAB, Howieson J, Fotedar R. Beneficial effects of tuna hydrolysate in poultry by-product meal diets on growth, immune response, intestinal health and disease resistance to Vibrio harveyi in juvenile barramundi, Lates calcarifer. Fish and Shellfish Immunology. 2019;89:61–70.

Simon CJ, Salini MJ, Irvin S, Blyth D, Bourne N, Smullen R. The effect of poultry protein concentrate and phosphorus supplementation on growth, digestibility and nutrient retention efficiency in barramundi Lates calcarifer. Aquaculture. 2019;498:305-14.

Ye H, Zhou Y, Su N, Wang A, Tan X, Sun Z, et al. Effects of replacing fish meal with rendered animal protein blend on growth performance, hepatic steatosis and immune status in hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Aquaculture. 2019;511:734203.

Introduction

The introduction is written in a way that requires attention. It is going all over the place from rendered animal meals, unusual reference to unrelated obscure species, LC-PUFAs, lysine content, growth hormones, methionine metabolism, health status (immune, antioxidant), aquatic pollution. This distracts from the main purpose and history of R&D on barramundi in Australia and elsewhere.

Reponses: we have completely revised the introduction. Please see lines 65-132.

Methods

• The Diet formulas are presented in table 1, however the title indicates the test diets were supplemented with protein hydrolysates. This is clearly from another study and cut and paste.

Response: We are sorry for unintentional mistake. This sentence was included here by mistake as we were completing our MS which has been now published. We have corrected the Table 1 now.

• The Fatty Acid analysis section lacks a lot of detail.

Response: We have updated the methodology of fatty acids analysis. Please see lines 223-230.

• Ive never seen fatty acids and amino acids presented side by side like that. Its odd.

Response: We have separated the fatty acids and amino acids in different tables now. We have also added amino acids profile of PBM in Table 3.

• Antioxidant status assessment lacks a lot of detail

Response: We have revised and please see line 249-252.

• In the calculation, there are 2 things requiring attention, AI and TI.

Response: We have deleted AI and TI from all text.

Results

• You really need a table of results here that clearly show the values +/- SE for your data. The figure 1 is not satisfactory. FBG acronym not explained. Fig 1 appears to have individual fish (n=64) in some and tank replication in the other (n=3). Not clear as to why this is done differently.

Response: We have deleted Figure 1 and have presented growth related data in Table 5 adding mean ± SE.

• Muscle FA section poorly written.

Response: we have elaborated and re-written the muscle FA section. Please see lines 336-342.

• Table 3. Units? Also, check stats. Row C18:1cis+trans are very different values whereas C17:0 are almost the same (44 v 40) yet highly significant.

Response: We have mentioned units in Table 2 and Table 6, and also double checked the statistical analysis.

• Table 3. What have AI and TI got to do with the FAME?

Response: We have deleted AI and TI from all over the text.

• In Histomorphology no mention of the gill and intestine result (Fig 2)

Response: Corrected. Please see line 364-367.

Discussion

• A few studies? There are dozens specifically investigating this material in fish and prawns.

Response: Agreed. We have rewritten the whole paragraph. Please see lines 477-517.

• Have they already done this study ref 32?

Response: No, we have not done this.

• In terms of Methionine supplementation, the authors ended up with different levels of Met in the diets despite their attempts to balance. Either way the inclusion in both diets is well above the known requirement for the species and I doubt this would be a relevant reason for the differences observed. Need to discuss the results in more detail with a focus on the things that are explainable.

Response: According to the Millamena (1994) and Glencross (2006), the requirements for methionine, lysine and arginine was reported to be about 22, 49 and 38 g kg-1 of dietary protein, respectively. We have not added methionine in the control diet since the control diet has a sufficient level of methionine for barramundi normal growth (Table 3). But methionine was lacking in PBM in the present study (Table 3) and we added 0.40% in the test diet to meet the required level for barramundi growth. However, we have thoroughly revised the discussion. Please see lines 497-511.

Millamena, O.M. (1994) Review of SEAFDEC/AQD fish nutrition and feed development research. In:Feeds for Small-Scale Aquaculture, Proceedings of the National Seminar-Workshop on Fish Nutrition and Feeds(Santiago, C.B., Coloso, R.M., Millamena, O.M. & Borlongan, I.G. eds), pp. 52–63. SEAFDEC Aquaculture Department, Iloilo, Philippines.

Glencross B. The nutritional management of barramundi, Lates calcarifer – a review. Aquaculture Nutrition. 2006;12(4):291-309.

• Similarly, with EFA story there are reports on fatty acids nutrition specifically in barramundi but these have largely been ignored in favour of other more obscure species. Moreover, this study is primarily an evaluation of a protein rich ingredient to replace fishmeal, so we are crossing over a lot here with lipid specific studies.

Response: we have thoroughly revised the fatty acids section in discussion part with relevant citations particularly on barramundi and other closely related species. Please see lines 519-531.

• Generally, the authors are describing their methods here but not relating it to or explaining in light of the present study. Take the CAT, SOD, GPX section for example.

Response: We have thoroughly revised the paragraph with relevant citation and underlying reasons behind the influence of antioxidant enzymes. Please see the line 586-601.

Acknowlegements

• Its Dr Fran Stephens. This clearly indicates your lack of understanding and probably had a lot of help. Fran is an expert in her field and should at least have her name correctly acknowledged. If she has helped in this analysis and interpretation of data, maybe consider her as a co-author?

Response: We are extremely sorry for making mistake to write Dr Fran Stephens’s name. Please see line 617. All histological analysis and data interpretation have done by authors. Only we have outsourced work from her related to histological slides only.

Submitted filename: Response to Reviewer.docx

Click here for additional data file.

9 Oct 2020

PONE-D-20-07405R1

Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer

PLOS ONE

Dear Dr. Chaklader,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 23 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Mahmoud A.O. Dawood, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

The authors are encouraged to revise the manuscript in the light of reviewer 3 comments.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This revision is greatly improved. Well done. If i had to be picky i would have said that the methionine requirement in barramundi was revised a few years back and there are a couple of references on the subject, so the older reference #8 cited is actually quite outdated. Having said that the MS reads well and is ready for publication.

Reviewer #2: (No Response)

Reviewer #3: The Manuscript is well designed and conducted and presents an interesting subject to the marine aquaculture industry. However, it did not tell the optimum inclusion level of poultry by product meal with and without methionine supplementation, which is a very important issue for the journal readers and for application.

Minor comments

The proximate composition of diets lacks information on the mineral contents and energy values. Also, all values in Tables 1-3 miss +/- SE (SD)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr. Md. Tawheed Hasan

Reviewer #3: Yes: Mabrouk ELSABAGH

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

21 Oct 2020

Response to Reviewer 1

Reviewer #1: This revision is greatly improved. Well done. If i had to be picky i would have said that the methionine requirement in barramundi was revised a few years back and there are a couple of references on the subject, so the older reference #8 cited is actually quite outdated. Having said that the MS reads well and is ready for publication.

Response: We have added updated reference. Please see line 151.

Response to Reviewer 3

Reviewer #3: The Manuscript is well designed and conducted and presents an interesting subject to the marine aquaculture industry. However, it did not tell the optimum inclusion level of poultry by product meal with and without methionine supplementation, which is a very important issue for the journal readers and for application.

Minor comments

The proximate composition of diets lacks information on the mineral contents and energy values. Also, all values in Tables 1-3 miss +/- SE (SD)

Response:

Thank you for your complements regarding the design of the experiment and its conduction. Our published earlier article (Chaklader et al., 2020) has proved that 90% poultry by product meal along with the supplementation of fish protein hydrolysate can replace the fishmeal with some positive physiological outcomes for barramundi. As we found that methionine was lacking in the poultry by product meal for enhancing the growth of barramundi and therefore the current study was aimed to investigate if methionine supplementation alone in poultry by product meal could replace fishmeal entirely from the diet of barramundi. However, the current results clearly indicated that methionine alone is not able to replace the contribution of fish protein hydrolysate in barramundi diet. As fish protein hydrolysate have other nutrient ingredients (such as biologically active low molecular weight peptides) those in combination with poultry by product meal are able to replace fishmeal entirely in barramundi diets.

The results of previously published article and current article under review clearly indicate although methionine is essential for barramundi’s physiological performance, fish hydrolysate in addition to methionine has other beneficial micro nutrient embedded in it. Hence, optimum level of poultry by product meal in barramundi diet is 90% of the protein source along with fish hydrolysate without any addition of pure methionine. The optimum inclusion level of poultry by product meal with purified methionine supplementation is yet to be investigated.

Chaklader MR, Fotedar R, Howieson J, Siddik MAB, Foysal MJ. 2020. The ameliorative effects of various fish protein hydrolysates in poultry by-product meal diets on muscle quality, serum biochemistry and immunity in juvenile barramundi, Lates calcarifer. Fish & Shellfish Immunology, 104:567-578. https://doi.org/10.1016/j.fsi.2020.06.014

Proximate composition has been revised (Table 1). Table 1 is the calculation of feed formulation with analysed proximate composition while amino acid (Table 2) and fatty acid composition (Table 3) was analysed for one sample repeated in triplicate. One sample/treatment particularly for diets is accepted in aquaculture study as it is depicted in various publication (Siddik et al., 2019, Chaklader 2020, Ye et al., 2019 and Sabbagh et al., 2020).

Siddik MAB, Chungu P, Fotedar R, Howieson J (2019) Bioprocessed poultry byproduct meals on growth, gut health and fatty acid synthesis of juvenile barramundi, Lates calcarifer (Bloch). PLoS ONE 14(4): e0215025. https://doi. org/10.1371/journal.pone.0215025

Chaklader MR, Fotedar R, Howieson J, Siddik MAB, Foysal MJ. 2020. The ameliorative effects of various fish protein hydrolysates in poultry by-product meal diets on muscle quality, serum biochemistry and immunity in juvenile barramundi, Lates calcarifer. Fish & Shellfish Immunology, 104:567-578. https://doi.org/10.1016/j.fsi.2020.06.014

Ye, H., Zhou, Y., Su, N., Wang, A., Tan, X., Sun, Z., Zou, C., Liu, Q., Ye, C., 2019. Effects of replacing fish meal with rendered animal protein blend on growth performance, hepatic steatosis and immune status in hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Aquaculture 511, 734203. 10.1016/j.aquaculture.2019.734203.

Sabbagh, M., Schiavone, R., Brizzi, G., Sicuro, B., Zilli, L., Vilella, S., 2019. Poultry by-product meal as an alternative to fish meal in the juvenile gilthead seabream (Sparus aurata) diet. Aquaculture 511, 734220.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

27 Oct 2020

Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer

PONE-D-20-07405R2

Dear Dr. Chaklader,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mahmoud A.O. Dawood, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

3 Nov 2020

PONE-D-20-07405R2

Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer

Dear Dr. Chaklader:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Mahmoud A.O. Dawood

Academic Editor

PLOS ONE