Deacidification by FhlA-dependent hydrogenase is involved in urease activity and urinary stone formation in uropathogenic Proteus mirabilis.

Proteus mirabilis is an important uropathogen, featured with urinary stone formation. Formate hydrogenlyase (FHL), consisting of formate dehydrogenase H and hydrogenase for converting proton to hydrogen, has been implicated in virulence. In this study, we investigated the role of P. mirabilis FHL hydrogenase and the FHL activator, FhlA. fhlA and hyfG (encoding hydrogenase large subunit) displayed a defect in acid resistance. fhlA and hyfG mutants displayed a delay in medium deacidification compared to wild-type and ureC mutant failed to deacidify the medium. In addition, loss of fhlA or hyfG decreased urease activity in the pH range of 5-8. The reduction of urease activities in fhlA and hyfG mutants subsided gradually over the pH range and disappeared at pH 9. Furthermore, mutation of fhlA or hyfG resulted in a decrease in urinary stone formation in synthetic urine. These indicate fhlA- and hyf-mediated deacidification affected urease activity and stone formation. Finally, fhlA and hyfG mutants exhibited attenuated colonization in mice. Altogether, we found expression of fhlA and hyf confers medium deacidification via facilitating urease activity, thereby urinary stone formation and mouse colonization. The link of acid resistance to urease activity provides a potential strategy for counteracting urinary tract infections by P. mirabilis.

Introduction

Urinary tract infections (UTIs) are common infectious diseases, afflicting a large proportion of the human population. An estimated 40–50% of women will experience at least one UTI during their lifetime[1,2]. UTIs with usage of indwelling catheters and formation of urinary stones usually cause therapeutic failure[3-5]. Catheter-associated urinary tract infections (CAUTIs) are among the most common nosocomial infections, causing an enormous health and financial burden worldwide. In addition, the rise of antimicrobial resistance in uropathogens has complicated the treatment of UTIs[2,4,6]. Thus, new antibacterial strategies are open for further investigation.

Formate hydrogenlyase activator (FhlA) belongs to one of the RpoN-dependent enhancer binding proteins and is a master regulator of formate hydrogenlyase (FHL) which consists of formate dehydrogenase H (FDH), and hydrogenase multimers, connecting formate oxidation to proton reduction responsible for the H2 production[7-11]. Hydrogenases are enzymes that catalyze the oxidation of molecular hydrogen (H2) into protons or the reduction of protons to molecular hydrogen[12]. The hydrogenase of FHL belongs to [NiFe] hydrogenase involving in converting proton to hydrogen[11,13]. Escherichia coli could produce four distinct [NiFe]-hydrogenase isoenzymes including hydrogenase-1 (Hya), hydrogenase-2 (Hyb), hydrogenase-3 (Hyc) and hydrogenase-4 (Hyf) encoded by hya, hyb, hyc and hyf operon respectively[11,13]. The homologous Hyc and Hyf are energy-converting hydrogenases conserved in gammaproteobacteria such as uropathogenic E. coli (UPEC) and Klebsiella pneumoniae[13]. Hyc and Hyf are made of several components such as electron transfer proteins, membrane-anchored proteins and catalytic hydrogenase subunits[11,14,15]. The transcriptions of both hyc and hyf operons are activated by FhlA and are dependent on RpoN[7-10]. Taking E. coli as an example, Hyc and Hyf would couple with formate dehydrogenase to form FHL-1 and FHL-2, respectively. At slightly acidic pH 6.5, the production of H2 was mostly dependent on FHL-1, while FHL-2 contributes to H2 production at slight alkaline pH 7.5[16]. The FHL-1 of E coli contributes to medium deacidification during mix acid fermentation[17] and acid resistance in the anaerobic environment[18]. In addition, hydrogenases of FHL might play a role in virulence by neutralizing hydroxyl free radicals (OH·), providing energy and maintaining acid–base homeostasis[19]. In this regard, fhlA and FHL-2 genes have been shown to be induced in UPEC during urinary tract infections[20]. Recently, fhlA and the genes encoding the components of FHL-2, were found to be likely to contribute to mouse colonization in uropathogenic Proteus mirabilis by the genome-wide study[21]. In view that enzymes and the maturation machinery required for production of FHL hydrogenases are completely different from human proteins[22], these pathways would be promising targets for the development of new antimicrobial strategies.

Proteus mirabilis is an important pathogen of the urinary tract, especially in patients with indwelling urinary catheters[5]. UTIs and CAUTIs involving P. mirabilis are typically complicated by the formation of bladder and kidney stones due to alkalinization of urine from urease-catalyzed urea hydrolysis, leading to catheter blockage and permanent renal damage[3]. In addition, urinary stones deposit on the catheter surface, facilitating the formation of crystalline biofilms[3]. On the basis of the genome-wide study by Armbruster et al.[21], we investigated if FhlA and FHL hydrogenase are associated with virulence factor expression of P. mirabilis. Here, we show that FhlA-regulated hydrogenase gene expression accelerated medium deacidification, whereby facilitating urease activity and urinary stone formation. Moreover, we confirmed the fitness defect of fhlA and hydrogenase gene (hyfG) mutants in UTI mouse model of P. mirabilis. This is the first report revealing P. mirabilis fhlA and hydrogenase genes participate in urease activity, urinary stone formation and virulence. This finding provides a perspective for development of new therapeutic approaches to counteract UTIs caused by P. mirabilis.

Results

Counterparts of the FHL hydrogenase hyc locus, fhlA and fdhF genes in P. mirabilis N2

To investigate the role of FhlA and FHL in uropathogenic P. mirabilis, we searched the genome of P. mirabilis HI4320 for the homologous genes of FhlA, FHL hydrogenase and formate dehydrogenase H (FDH-H encoded by fdhF). Only a putative FHL hydrogenase 4 operon (hyf) is present in P. mirabilis HI4320. No similar FHL hydrogenase 3 operon (hyc) was found in P. mirabilis HI4320. We amplified the entire DNA fragment (11,956 bp) containing hyfABCDEFGHIJhycI and the upstream region of hyfA from the genomic DNA of P. mirabilis N2 using the KOD DNA polymerase of high fidelity and efficiency by primers designed from P. mirabilis HI4320 (Table 1) and the sequence of the product was determined. hyfA and hyfH may encode electron carrier proteins containing 4Fe-4S domain; hyfB, hyfD and hyfF may encode proton-conducting membrane transporters; hyfC and hyfE may encode membrane-anchored subunits; hyfG and hyfI may encode [NiFe] hydrogenase large and small subunits respectively; hyfJ and hycI may encode proteins for maturation of HyfG. As shown in Fig. 1a, the P. mirabilis N2 hyf locus consists of hyfABCDEFGHIJhycI. The putative proteins encoded by hyf locus of P. mirabilis N2 shared 59–86% similarities with their respective orthologues in E. coli MG1655 and CFT073 respectively, with highest similarity between hydrogenase large subunit (HyfG vs HycE) (Fig. 1a). The nucleotide sequences of fhlA (2572 bp) and fdhF (2810 bp) containing the upstream promoter region were also acquired by amplification with primers designed from P. mirabilis HI4320 (Table 1) and sequencing the product. The BLAST search revealed FhlA and FDH-H orthologues with 71% and 85% similarities to that of uropathogenic E. coli CFT073 and nonpathogenic E. coli MG1655 respectively (Fig. 1a). The nucleotide sequences of fhlA, hyf locus and fdhF were assigned accession number MT492462, MT492463 and MT492464 respectively by the GenBank database.

Table 1

Primers used in this study.

Primer	Sequence (5′–3′)	Description
fhlA_com_F	GGATCCATAAGAAAATAGCGGTTTGG	For fhlA complementation. Paired with “fhlA_com_R”
fhlA_com_R	GTCGACCTAAAGAATTTCAGGAATGGA	For fhlA gene locus sequencing. Paired with “fhlA_promoter_F”
hyfG_com_F	TCGGTTCAGGAGAAGTAACG	For hyfG complementation. Paired with “hyfG_com_R”
hyfG_com_R	CTCACTTGAGCGGCGAAT
rpoN_com_F	GAG CTCAAGAGGATCCATCGCATC	For rpoN complementation. Paired with “rpoN_com_R”
rpoN_com_R	CTCGAGCCATAGTGTCTTCCTTCT
hyfA_promoter_F	GCATGCAGATCCTTCAGGTTATG	For hyfA reporter assay. Paired with “hyfA_promoter_R”
hyfA_promoter_R	CTGCAGTCGCCACATCCTCCGAGA
fhlA_promoter_F	TTAGAACAATAAATCAGCG	For fhlA reporter assay. Paired with “fhlA_promoter_R”
fhlA_promoter_R	TCTAGACATGACACCACCGATTGC
fdhF_promoter_F	GCATGCGGCACACAGAATTCTCACAA	For fdhF reporter assay. Paired with “fdhF_promoter_R”
fdhF_promoter_R	CTGCAGCAACATTGCTCCTGTGTTCA
fdhF_R	TTAGCCTTCAGCGGCTTCTCTTA	For fdhF gene locus sequencing. Paired with “fdhF_promoter_F”
hyf_R	CTATTCTTCGATATCGTCTTC	For hyf operon genes locus sequencing. Paired with “hyfA_promoter_F”
fhlA_site_direct_F	CGGGTGCAACACATGCCC	For fhlAcSD strain construction. Paired with “fhlA_site_direct_R”
fhlA_site_direct_R	AAATAGCGCCTTTATCATGTCC

The underlined sequences represent restriction endonuclease cutting sites.

Figure 1

P. mirabilis hyf locus and involvement of FHL-related genes in acid resistance. (a) (i) The P. mirabilis FHL hydrogenase gene locus (hyfA-J-hycI) corresponds to the well characterized hyc locus in E. coli K-12 MG1655 and UPEC CFT073 with corresponding genes in shadows. An amino acid sequence analysis of the hyf locus in P. mirabilis N2 and its counterparts in E. coli K-12 MG1655 and E. coli CFT073 was performed using position-specific iterative BLAST. The eight proteins of the hyf locus in P. mirabilis N2 are similar to the HycB, HycC, HycD, HycE, HycF. HycG, HycH and HycI in E. coli K-12 MG1655 and E. coli CFT073. The percent amino acid similarities between P. mirabilis N2 and E. coli K-12 MG1655 or E. coli CFT073 were shown below each gene. The number inside white arrow represents the amino acid length of each protein. (ii) The P. mirabilis fhlA and fdhF loci correspond to those of E. coli K-12 MG1655 and UPEC CFT073 with corresponding genes in shadows. An amino acid sequence analysis was carried out the same as above. The predicted amino acid sequences of fhlA and fdhF in P. mirabilis N2 are similar to FhlA and formate dehydrogenase-H respectively in E. coli K-12 MG1655 and E. coli CFT073. The percent amino acid similarities between P. mirabilis N2 and E. coli K-12 MG1655 or E. coli CFT073 were shown below each gene. The number inside white arrow represents the amino acid length of each protein. (b) The survival rate of the wild-type, mutants (fhlA, hyfG and rpoN), complemented strains (fhlAc, hyfGc and rpoNc) and fhlAcSD strain after exposure to acid (pH 3). Acid survival rate (expressed as percent) was calculated with the following formula: 100 × (CFU after acid treatment/CFU before acid treatment). Significant differences from the wild-type bacteria were determined by using the one-way ANOVA with Tukey’s multiple-comparison test (*P < 0.05, **P < 0.01). The data are averages and standard deviations of three independent experiments. wt, wild-type; fhlA, fhlA mutant; hyfG, hyfG mutant; fhlAc, fhlA complemented strain; hyfGc, hyfG complemented strain; fhlAcSD, fhlA mutant containing altered FhlA (F291I, T292S) in pGEM-T Easy; rpoN, rpoN mutant; rpoNc, rpoN complemented strain.

fhlA and hyf are involved in acid resistance

Knowing FhlA is the transcriptional activator for the expression of the genes encoding FHL components of E. coli[8,10] and E. coli hycE (encoding catalytic large subunit of hydrogenase 3) mutant has been shown to display reduced acid survival compared to the wild-type strain[18], we first investigated whether FhlA and Hyf hydrogenase affect acid resistance in P. mirabilis N2. We performed homologous recombination to construct kanamycin-resistant fhlA and hyfG mutants, followed by Southern blotting to verify the mutant clone. In view that the large subunit of hydrogenase is critical for hydrogenase activity[18], hyfG deletion stands for functional loss of Hyf activity in the study. There was no difference between the growth of the wild-type bacteria and respective mutants (Fig. 6c). We then tested the ability of the wild-type strain, fhlA and hyfG mutants and respective complemented strains to survive the acid exposure. We found that the survival rate of both fhlA and hyfG mutants was significantly lower than that of the wild-type strain and the respective complemented strains (Fig. 1b). The results indicate that FhlA and Hyf are involved in resistance to extreme acid exposure in P. mirabilis. FhlA was reported as an enhancer binding protein which could hydrolyze ATP to activate RpoN-dependent transcriptions through the RpoN-interacting motif, GAFTGA[23]. Thus, we constructed the site-directed mutant, fhlAcSD strain (the fhlA mutant containing an altered FhlA with the conserved RpoN-interacting motif GAFTGA changing into GAISGA in the pGEM-T Easy vector) which exhibited no growth defect compared to the wild-type bacteria. Then we assessed the survival in acid using the fhlAcSD strain, rpoN mutant and the rpoN-complemented strain. The survival of fhlAcSD strain and rpoN mutant was reduced relative to the wild-type and the rpoN-complemented strain. We concluded that FhlA (requiring the GAFTGA motif for RpoN-interaction), RpoN and HyfG contribute to the acid resistance (Fig. 1b).

Figure 6

Proton motive force-related phenotypes in P. mirabilis. (a) The swarming migration distance of wild-type and fhlA and hyfG mutants was monitored by following swarm fronts of the bacterial cells and recording progress at 1-h intervals. (b) The swimming migration distance of wild-type and mutants of fhlA and hyfG was recorded at 18 h after inoculation. (c) Growth of the wild-type and mutants (fhlA and hyfG) cultured in LB broth with and without CCCP (7.5 μM) was monitored by measurement of OD600. The data are averages and standard deviations of three independent experiments. wt, wild type; fhlA, fhlA mutant; hyfG, hyfG mutant.

hyf and fdhF are regulated by FhlA and induced by formate and anaerobiosis

In E. coli, the transcription of both fdhF and hyf operons is regulated by FhlA[8,10]. To identify conserved promoter elements for FhlA-dependent transcriptions, we submitted position weight matrices of FhlA and RpoN from characterized FhlA- and RpoN-dependent promoters (Table 2) to the Regulatory Sequence Analysis Tools (RSAT) sever[24]. TGGCACGNNNNTTGCA/T and the palindromic sequence TGA/TC-A/GAA/TA/GAT-GA/TCA were shown to be the conserved binding sites for RpoN and FhlA respectively. We found two putative FhlA and one RpoN conserved regulatory sequences present in the promoter regions of all the determined fhlA, hyf and fdhF sequences (Fig. 2a). We therefore performed the reporter assay to examine if fhlA, hyf and fdhF are regulated by FhlA and RpoN. We found hyf and fdhF promoter activities were reduced in the fhlA and rpoN mutants relative to the wild-type and respective complemented strains at 3, 5, 7, and 24 h after incubation (Fig. 2b,c). In addition, the RpoN-interacting domain of FhlA is responsible for regulation of hyf and fdhF promoter activities (Fig. 2b,c). According to the RpoN conserved regulatory sequence not in the fhlA gene direction, the reporter assay showed loss of rpoN or RpoN-dependent fhlA had no effect on fhlA promoter activity during the time period tested (Fig. 2d). It is known fdhF, hyf and fhlA could be induced by either formate or anaerobiosis in E. coli[8,10,25]. We tested the effect of 30 mM formate or anaerobic condition on the promoter activities of fhlA, fdhF and hyf after incubation for 5 h. We found P. mirabilis fdhF and hyf were induced significantly by 30 mM formate and anaerobiosis respectively (Fig. 2f,g) while formate and anaerobiosis seemed not have a significant effect on fhlA promoter activity (Fig. 2e). The results of fhlA promoter activity contrasted with previous reports that showed formate and anaerobiosis could trigger expression of FhlA-regulated hypABCDE-fhlA in E. coli[10,26]. Figure 2b–d showed the wild-type P. mirabilis displayed hyf, fdhF and fhlA promoter activities under the aerobic condition at 3, 5, 7 and 24 h after incubation. In summary, promoter activities of fdhF and hyf were under the control of FhlA in response to formate and anaerobiosis.

Table 2

Position-weight matrices of FhlA and RpoN binding sequences.

FhlA	1	2	3	4	5	6	7	8	9	10	11	12	13	14
A	1	0	4	2	5	7	5	5	9	0	0	6	1	7
C	0	1	1	10	2	2	1	0	1	0	2	1	11	1
G	2	12	1	0	5	1	2	5	2	0	10	1	1	4
T	10	0	7	1	1	3	5	3	1	13	1	5	0	2

These weight matrices based on 13 characterized FhlA-dependent promoters[10,59] and 186 characterized RpoN-dependent promoters[60].

Figure 2

The transcription regulations of hyf, fdhF and fhlA genes in P. mirabilis. (a) Schematic promoter region of fhlA, fdhF and hyf. FhlA and RpoN binding sites were predicted by Regulatory Sequence Analysis Tools[24]. Promoter activities of (b) hyf, (c) fdhF and (d) fhlA in wild-type, mutants (fhlA and rpoN), complemented strains (fhlAc and rpoNc) and fhlAcSD strain. The activity of XylE in the hyf-, fdhF- or fhlA-xylE reporter plasmid-transformed bacterial strain was determined using the reporter assay at 3, 5, 7 and 24 h after incubation. (e–g) Inductivity of promoter activities of fhlA, fdhF and hyf in wild-type strain by formate or anaerobiosis. The overnight cultures of fhlA-, fdhF- or hyf-xylE reporter plasmid-transformed wild-type strain were regrown for 5 h. The activity of XylE in the reporter plasmid-transformed wild-type strain was determined after treatment of formate or anaerobiosis for 30 min. nil, aerobic condition; formate, 30 mM formate; anaerobic, anaerobic condition. Significant differences from the wild-type bacteria were determined by using two-way ANOVA (in b–d) and by one-way ANOVA (in e–g) with Tukey’s multiple-comparison test (*P < 0.05; **P < 0.01; ***P < 0.001). The data are averages and standard deviations of three independent experiments. wt, wild-type; fhlA, fhlA mutant; fhlAc, fhlA complemented strain; fhlAcSD, fhlA mutant altered FhlA (F291I, T292S) in pGEM-T Easy; rpoN, rpoN mutant; rpoNc, rpoN complemented strain.

The deacidification of the medium requires fhlA and hyf

It has been known that formate, a product of mixed-acid fermentation, can be converted to H2 and CO2 by the FHL complex, in a process consuming protons and resulting in medium deacidification, thereby increasing bacterial survival[17]. We hypothesized that uropathogenic P. mirabilis could use the FHL system to consume protons, leading to deacidification of the environment. Therefore, we performed deacidification experiments using the synthetic urine at pH 4.8 (± 0.2) to test if loss of hyfG or fhlA affects the deacidification ability. The data showed both hyfG and fhlA mutants displayed a significant delay in deacidification, especially for hyfG mutant, compared to the wild-type and respective complemented strains (Fig. 3a). A similar reduction in deacidification ability of fhlA mutant was observed in the fhlAcSD mutant while rpoN mutant had a similar deacidification pattern to the wild-type strain (Fig. 3a).

Figure 3

Urease activity and urea are required for P. mirabilis medium deacidification mediated by fhlA and hyfG. (a) Overnight cultures of the wild-type, mutants (fhlA, hyfG, rpoN, fhlAcSD and ureC) and complemented strains (fhlAc, hyfGc and rpoNc) were regrown for 5 h and resuspended in synthetic urine (pH 4.8 ± 0.2). The pH value was monitored during 30–90 min at 10-min intervals. (b) Overnight cultures of the wild-type and mutants of fhlA, hyfG and ureC were regrown for 5 h and resuspended in synthetic urine (pH 6.0 ± 0.2) in which the urea has been replaced by an equivalent amount of NH4Cl. The pH value was monitored at 30-min intervals over 90 min. The data are averages and standard deviations of three independent experiments. wt, wild-type; fhlA, fhlA mutant; hyfG, hyfG mutant; fhlAc, fhlA complemented strain; hyfGc, hyfG complemented strain; fhlAcSD, fhlA mutant containing altered FhlA (F291I, T292S) in pGEM-T Easy; rpoN, rpoN mutant; rpoNc, rpoN complemented strain; ureC, ureC mutant (without urease activity).

Urease activity of P. mirabilis is pH-dependent and loss of hyf or fhlA gene affects urease activity and urinary stone formation

Urease can catalyze the hydrolysis of urea into ammonia, rising pH value and promoting urinary stone formation[27,28]. The urease activity changes with different pH value in Helicobacter pylori, being activated by acidic pH down to pH 2.5 and 3[29]. To understand whether urease activity of P. mirabilis is affected by pH value, we monitored the urease activity in LB broth at different pH values and found that urease activity was very low at pH 4, increased gradually in the pH range from 5 to 9 and dropped suddenly at pH 10 (Fig. 4a). Knowing fhlA and hyfG contributed to acid resistance, we assessed the urease activity in wild-type strain, hyfG and fhlA mutants and respective complemented strains in the pH range from 5 to 9. The data showed that urease activity of hyfG and fhlA mutants were lower than the wild-type and respective complemented strains in the pH range from 5 to 8 (Fig. 4b). Likewise, fhlAcSD strain and rpoN mutant had reduced urease activity relative to the wild-type bacteria in this pH range (Fig. 4b). The rpoN mutant could restore the activity to a certain level from pH 5 to 9 after rpoN-complementation (Fig. 4b). Interestingly, we found the urease activity of hyfG, fhlA and fhlAcSD mutants was not different from that of the wild-type strain at pH 9 while urease activity of rpoN mutant still decreased relative to the wild-type bacteria (Fig. 4b). The results show that both urease activity and the involvement of fhlA and hyfG in the urease activity is pH-dependent in P. mirabilis. Subsequently, we assessed the urinary stone formation using the same synthetic urine at pH 5.8. We found that the ability of stone formation in fhlA and hyfG mutants was significantly lower than that of wild-type strain and respective complemented strains (Fig. 4c). The ability to form urinary stones of fhlAcSD mutant significantly decreased relative to the wild-type, in contrast to that of rpoN mutant being comparable to the wild-type strain.

Figure 4

The pH-dependent urease activity and the effect of fhlA, hyfG or rpoN mutation on urease activity and stone formation in P. mirabilis. (a) The urease activity of wild-type bacteria regrown in LB for 5 h was determined by phenol-hypochlorite assay at pH 5–9. The relative urease activity is calculated with the following formula: OD625 of test/OD625 of wt at pH 7. Significant differences from the result at pH 7 were determined by using the Student’s t test (*P < 0.05). (b) Urease activities of the wild-type, mutants (fhlA, hyfG and rpoN), complemented strains (fhlAc, hyfGc and rpoNc) and fhlAcSD strain regrown in LB for 5 h were measured at different pH values. The relative urease activity is calculated with the following formula: OD625 of test/OD625 of wt at pH 7. Significant differences from the wild-type bacteria at each pH were determined by using two-way ANOVA with Tukey’s multiple-comparison test (*P < 0.05; **P < 0.01). (c) Stone formation of the wild-type, mutants (fhlA, hyfG and rpoN), complemented strains (fhlAc, hyfGc and rpoNc) and fhlAcSD strain. Bacteria were regrown and adjusted to 2 × 108 CFU/ml with synthetic urine and incubated for 1 h at 37 ℃. The optical density at 630 nm of suspensions was measured as the intensity of stone formation. The relative urinary stone formation is calculated with the following formula: OD630 of test/ OD630 of wt. Significant differences from the wild-type bacteria were determined by using one-way ANOVA with Tukey’s multiple-comparison test (*P < 0.05; **P < 0.01). The data are averages and standard deviations of three independent experiments. wt, wild-type; fhlA, fhlA mutant; hyfG, hyfG mutant; fhlAc, fhlA complemented strain; hyfGc, hyfG complemented strain; fhlAcSD, fhlA mutant containing altered FhlA (F291I, T292S) in pGEM-T Easy; rpoN, rpoN mutant; rpoNc, rpoN complemented strain.

To differentiate between direct proton consumption and modulation of urease activity for the role of hyf and fhlA in medium deacidification, we included the ureC (encoding urease subunit) mutant in deacidification assay in synthetic urine. No medium deacidification but slight acidification by the ureC mutant was observed (Fig. 3a). In addition, using synthetic urine medium in which urea has been replace by an equivalent amount of NH4Cl, the medium deacidification did not occur in wild-type and mutants of hyfG, fhlA and ureC (Fig. 3b). Slight acidification was observed for wild-type and the mutants. The data suggest that urea hydrolyzed by urease is an essential process to deacidify synthetic urine medium for P. mirabilis and the role of hyfG and fhlA in medium deacidification is mainly dependent on modulation of urease activity. These results suggest that fhlA-regulated hyf expression could help P. mirabilis to deacidify the environment via facilitating urease activity and subsequent urinary stone formation.

fhlA-regulated hyf expression assists bacterial colonization in the mouse urinary tract

To confirm the finding that FHL and FhlA were responsible for mouse colonization in P. mirabilis[21], we investigated if fhlA and hyfG are associated with UTIs caused by P. mirabilis. The colonization ability was assessed in wild-type strain and mutants of hyfG and fhlA using the UTI mouse model[30]. In the bladder, the colonization ability of fhlA and hyfG mutant were significantly lower than wild-type strain (Fig. 5a). Both fhlA and hyfG mutants exhibited a significantly low ability of colonization in the kidney relative to the wild-type strain (Fig. 5b).

Figure 5

Colonization in mice by the wild-type P. mirabilis, hyfG mutant or fhlA mutant. ICR mice were inoculated transurethrally with bacteria at a dose of 1.5 × 107 CFU per mouse. Bacterial loads (CFU) in the (a) bladders and (b) kidneys were determined on day 3 after inoculation. Horizontal bars indicate the average for each group, and the limit of detection was 100 CFU/g organ. Significant differences were determined using the Wilcoxon rank sum test (*P < 0.05; **P < 0.01). wt, wild-type; hyfG, hyfG mutant; fhlA, fhlA mutant.

Loss of fhlA or hyf does not affect proton motive force-related motility, drug susceptibility and growth under carbonyl cyanide m-chlorophenyl hydrazone (CCCP)

Previous studies showed that Hyf complex is similar to respiratory NADH dehydrogenase complex I[11,13,14] and the complex I was shown to provide the proton motive force (PMF)[31], which could affect acid resistance, susceptibilities of polymyxin B and aminoglycosides, motility and growth under treatment of the PMF uncoupler[32-37]. We monitored the PMF-related phenotypes including drug susceptibilities and motility in the wild-type bacteria and fhlA and hyfG mutants. Neither the MICs of the drugs (polymyxin B, streptomycin and gentamicin) used nor the swarming and swimming motility was different between wild-type strain and respective mutants (Table 3; Fig. 6a,b). We also examined the effect of CCCP, a PMF uncoupler, on growth of the wild-type, hyfG mutant and fhlA mutant. The growth curves of all strains showed no difference in the presence or the absence of CCCP (Fig. 6c). These results indicate that mutation of fhlA or hyfG did not affect the PMF-related phenotypes examined except acid resistance. It implies that the consumption of protons may be the main reason for FhlA-regulated hyf expression in acid resistance.

Table 3

Minimal inhibitory concentration of gentamicin (Gm), polymyxin B (PB) and streptomycin (Sm) in wild-type (wt) and mutants (hyfG and fhlA).

Strain	MIC (μg/ml)
	PB	Gm	Sm
wt	50,000	8	32
hyfG	50,000	8	32
fhlA	50,000	8	32

Discussion

To our knowledge, this study is the first to demonstrate that RpoN-dependent FhlA and hydrogenase Hyf participate in acid tolerance by medium deacidification and facilitate urease activity, urinary stone formation and mouse colonization. A typical characteristic of P. mirabilis UTIs is the development of urinary stones. P. mirabilis would rapidly invade bladder epithelium cells and start to form extracellular clusters within the bladder lumen adjacent to the urothelium[38,39]. The concentrated urease activity within extracellular clusters would cause mineral deposition that serves as an early step in urinary stone formation[38]. Urease decomposes urea to produce ammonia, damaging renal epithelial cells[40] and facilitating the formation of infectious urinary stones, carbonate apatite and struvite[38]. P. mirabilis extracellular clusters draw a massive neutrophil response and provide the environment to form biofilms[39]. The formation of extracellular clusters is critical to prevent clearance of bacteria by neutrophils and would influence the severity of infection[38,39]. In addition, medium deacidification has been shown to be involved in acid resistance of Salmonella enterica serovar Typhimurium[41]. We found FhlA and HyfG not only participated in medium deacidification and acid resistance (Figs. 1b, 3) but also affected urease activity and urinary stone formation in P. mirabilis (Fig. 4b). We identified that urease activity was pH-dependent, increasing in the pH range from 5 to 9 (Fig. 4a) and was dependent on FhlA and Hyf in the pH range from 5 to 8 (Fig. 4b). We showed that FhlA and Hyf-mediated deacidification or urine alkalization assisted in urease activity, stone formation and mouse colonization (Figs. 3a, 4b,c, 5), suggesting that FhlA and Hyf play a role in P. mirabilis virulence factor expression and virulence. In this regard, the data of transposon insertion-site sequencing (Tn-Seq) by Armbruster et al. have showed P. mirabilis hyfB, hyfC, hyfD, hyfE, hyfF, hyfG, fdhF, and fhlA are all likely to contribute to colonization in vivo[21].

The published Proteus genomes including P. mirabilis HI4320, P. mirabilis BB2000, P. hauseri, P. penneri and P. vulgaris contain only a hydrogenase 4-like operon but not the hydrogenase 3-like operon. It is likely that hydrogenase 4-like operon is the functional counterpart of hydrogenase 3-like operon for encoding the protein complex joining with FDH-H to form FHL in Proteus species. The facts that PCR produced a product of 4228 bp but not the predicted 524 bp using P. mirabilis N2 genomic DNA as the template with primers annealing to the conserved region of hycD and hycE (data not shown) and P. mirabilis hyfG mutant displayed reduced survival against acid exposure (Fig. 1b) as the hyc mutant[18] reinforce the notion. Hyf belongs to group 4a hydrogenase and is highly conserved in gammaproteobacteria[13]. The key role of Hyf is to convert proton to hydrogen, namely deacidification[11,13]. The structure of Hyf is similar to respiratory complex I, indicating Hyf is probably involved in the formation of proton gradient and energy production[13,19]. We found hyfG and fhlA are required for the full extent of acid tolerance in P. mirabilis (Fig. 1b). The dye DiOC2 commonly used to detect membrane proton gradient does not work in P. mirabilis N2 as is the case for P. mirabilis HI4320[33]. Instead, we determined other PMF-related phenotypes, motility and drug susceptibility, to know whether Hyf is involved in conservation of the proton gradient and PMF. No difference of swarming motility, swimming and drug susceptibility between wild-type strain and hyfG or fhlA mutant may indicate that the formation of PMF by FhlA-Hyf is negligible or compensable in these conditions. Although proton consumption should be the main reason for fhlA and hyf-involved acid tolerance. Possibly, it cannot be ruled out that the extent of PMF provided by FhlA-regulated Hyf may contribute to acid resistance of P. mirabilis. Recent studies showed that FHL-2 (FDH+Hyf) might couple with ATPase to generate PMF[42,43] and formate affects ATPase activity and changes the number of thiol groups[43]. Hyf activity is ATP-dependent, while the formate can increase the F0F1-ATPase activity[42]. It is worth noting that the effect of formate on ATPase activity disappeared in hyf mutant or under the respiratory condition[44]. In addition, the formate dehydrogenase-H activity was dependent on Hyf and F0F1-ATPase[16]. These studies indicate FHL-2 may contribute to regulation of formate-associated ATPase under fermentative condition. In this regard, our finding that P. mirabilis Hyf did not play an important role in generating PMF under aerobic condition may attribute to coupling of ATPase with FHL-2 only under fermentative or formate-rich conditions. Thus, it could not be ruled out that Hyf is involved in PMF formation under oxygen-limited condition during infection and contribute to virulence.

Unlike fhlA and hyfG mutants, the urease activity of rpoN mutant still significantly decreased compared to the wild-type strain at pH 9 (Fig. 4b). Apparently, RpoN would have other regulatory pathways to affect urease activity at pH 9. In P. mirabilis, urease subunits and accessory proteins encoded by ureDABCEFG operon has been shown to be regulated positively by UreR and negatively by H-NS in the transcription level[45]. Previous study showed that RpoN and its cognate enhancer binding protein NtrC regulated expression of urease gene operon indirectly through control nac, encoding a transcriptional factor Nac which could activate urease gene operon in K. pneumonia[46]. We will investigate if other enhancer binding proteins such as NtrC, QseF and PspF are involved in the pathways of RpoN-regulated urease expression. In addition, we will examine whether UreR and H-NS are subject to the control of RpoN.

We found urinary stone formation ability of rpoN mutant was not impaired while fhlA mutant (lacking the enhancer binding protein, FhlA) was. In this regard, it was established that amino acids have effects on stone formation. For example, serine and asparagine could serve as the catalysts of this process[47]. Addition of asparagine did increase stone formation of wild-type P. mirabilis (data not shown). In addition, expression of asparagine synthetase gene (asnA) was downregulated by RpoN in wild-type P. mirabilis (data not shown). It is likely that loss of rpoN increases the asparagine level, compensating for the effect of rpoN loss.

This study showed P. mirabilis fdhF and hyf but not fhlA were induced significantly by formate and anaerobiosis respectively (Fig. 2e–g). Previous reports showed formate and anaerobiosis could trigger transcription of FhlA-regulated hypABCDE-fhlA operon in E. coli[10,26]. Two reasons could account for the discrepancy of fhlA expression in response to formate. First, In E. coli, hypABCDE-fhlA constitute an operon subject to the control of FhlA, namely self-regulation of FhlA[10]. This is not the case for P. mirabilis, whose fhlA promoter is not dependent on RpoN and FhlA (Fig. 2a). Second, formate serves as a ligand to activate FhlA, thus leading to transcription of FhlA-dependent genes including hypABCDE-fhlA operon in E. coli[48] but not fhlA in P. mirabilis. As for anaerobic induction of fhlA, there are an FNR binding site in the promoter region and an OxyS-interacting site in the 5′UTR of fhlA in E. coli[26,49]. FNR is a global regulatory protein that regulates gene expression in response to oxygen deprivation in E. coli and it was shown that FNR acts as an anaerobic activator of hypABCDE-fhlA operon expression to control the expression of the hydrogenase maturation genes (Hyp)[26] and FhlA. OxyS, a small regulatory RNA (sRNA) which is induced in response to the oxygen and oxidative stress in E. coli, inhibits fhlA translation by pairing with a short sequence overlapping the Shine-Dalgarno sequence, thereby blocking ribosome binding and translation[49]. Neither corresponding OxyS was found after searching for P. mirabilis sRNAs in the Bacterial Small Regulatory RNA Database (BSRD, https://kwanlab.bio.cuhk.edu.hk/BSRD/), nor FNR binding site was present in the P. mirabilis fhlA promoter region analyzed by RSAT. Therefore, unlike E. coli fhlA which is regulated by OxyS sRNA and transcription factor FNR sensing oxygen availability, the P. mirabilis promoter of fhlA was unresponsive to anaerobiosis (Fig. 2e).

This study implies that the proton-consuming acid resistance mechanism such as glutamate- and arginine-dependent acid resistance[50] may also contribute to urease activity in the presence of glutamate or arginine. Our preliminary data showed urease activity of wild-type P. mirabilis was induced by arginine and glutamate. What is the biological significance of the proton-consuming acid resistance of FHL? The different metabolites or signals would trigger different acid resistance system. Under stationary phase or the presence of extracellular glutamate, glutamate-dependent acid resistance would be important to bacterial acid response[51]. Likewise, arginine-dependent acid resistance is triggered by extracellular arginine[50]. However, FHL is the amino acid-independent acid resistance induced by formate or anaerobiosis[50]. In this study, we found that fdhF, hyfG and fhlA of FHL genes of wild-type P. mirabilis were expressed when cultured in the aerobic condition (Fig. 2b–d) and the expression of fdhF and hyf could also be induced by formate or anaerobiosis (Fig. 2f,g).

In this study, we showed FhlA-dependent hyf expression accelerates deacidification to facilitate urease activity and infectious urinary stone formation of P. mirabilis (Fig. 7) and subsequently mouse colonization. This is the first report investigating how P. mirabilis FHL-associated genes are involved in virulence and linking the ability of acid resistance to urease activity of P. mirabilis. The formate-induced FHL pathway provides a perspective for development of new approaches to counteract P. mirabilis UTIs. The prohibition against food producing formate could be a preventive measure to combat P. mirabilis UTIs. For example, uptake of aspartame increases urine formate level[52], which could trigger FHL system to facilitate urease activity and subsequently urinary stone formation and in vivo colonization. In addition, our findings support the notion that manipulation of the urine pHn (the pH above which calcium and magnesium phosphates come out of solution in urine) could form the basis of a strategy to prevent catheter encrustation in those with urinary tract colonization by urease-positive bacteria[53].

Figure 7

Putative FhlA-dependent Hyf expression accelerates deacidification to facilitate urease activity and urinary stone formation during the early stage of urinary tract infection. hyf operon expression requires RpoN (σN) and the FhlA activator. (Left) When bacteria enter the urinary tract of about pH 5.0, the urease activity is limited. Deacidification by FhlA-dependent Hyf increases urease activity to rise the urine pH value. (Right) Higher urine pH leads to higher urease activity further alkalizing urine to facilitate infectious urinary stone formation. Rectangle, FhlA; oval, urease; cylinder, proton channel; a right-angled arrow, RpoN-dependent transcription start.

Materials and methods

Bacterial strains, plasmids, primers, reagents and growth conditions

The bacterial strains, plasmids and primers used in this study are listed in Tables 1 and 4. All chemicals were obtained from the Sigma-Aldrich unless otherwise indicated. Bacteria were routinely cultured in Luria–Bertani (LB) broth at 37 ℃ with shaking at 200–250 rpm. The LSW− agar [54] was used to prevent the phenotypic expression of swarming motility for selecting mutant clones and determining CFU. Ampicillin (100 μg/ml), chloramphenicol (40 μg/ml), kanamycin (100 μg/ml), tetracycline (20 μg/ml), streptomycin (100 μg/ml) was added to the medium as needed.

Table 4

Strains and plasmids.

Strain or plasmid	Genotype or relevant phenotype	Source or reference
P. mirabilis
wt	P. mirabilis N2; wild-type strain; Tcr	Clinical isolate
rpoN	wt derivative; rpoN-knockout mutant; Kmr	This study
fhlA	wt derivative; fhlA-knockout mutant; Kmr	This study
hyfG	wt derivative; hyfG-knockout mutant; Kmr	This study
fhlAc	fhlA mutant containing pGEM-T Easy-fhlA; Ampr Kmr	This study
hyfGc	hyfG mutant containing pGEM-T Easy-hyfG; Ampr Kmr	This study
fhlAcSD	fhlA mutant containing pGEM-T Easy-fhlA(F291I, T292S); Ampr Kmr	This study
Plasmids
pGEM-T Easy	TA cloning vector; Ampr	Promega
pGEM-T Easy-rpoN	pGEM-T Easy containing intact rpoN sequence including its RBS; Ampr	This study
pGEM-T Easy-fhlA	pGEM-T Easy containing intact fhlA sequence including its RBS; Ampr	This study
pGEM-T Easy-hyfG	pGEM-T Easy containing intact hyfG sequence including its RBS; Ampr	This study
pGEM-T Easy-fhlA(F291I,T292S)	pGEM-T Easy containing an altered FhlA with the conserved RpoN-interacting motif GAFTGA changing into GAISGA; Ampr	This study
pACYC184-fhlA-xylE	fhlA reporter plasmid, pACYC184 containing intact fhlA promoter sequence before xylE; Cmr	This study
pACYC184-fdhF-xylE	fdhF reporter plasmid, pACYC184 containing intact fdhF promoter sequence before xylE; Cmr	This study
pACYC184-hyf-xylE	hyf reporter plasmid, pACYC184 containing intact hyf operon promoter sequence before xylE; Cmr	This study

Synthetic urine was prepared according to a recipe previously described[27,28] containing the following components (g/l): CaCl2·2H2O, 0.651; MgCl2·6H2O, 0.651; NaCl, 4.6; Na2SO4, 2.3; sodium citrate, 0.65; sodium oxalate, 0.02; KH2PO4, 2.8; KCl, 1.6; NH4Cl, 1.0; urea, 25.0; creatine, 1.1 and tryptic soy broth, 10.0. pH was adjusted to 5.8 and urine was sterilized by passing through a 0.2 μm pore-size filter.

The anaerobiosis was established and maintained in the anaerobic chamber (Whitley A35 anaerobic workstation, 5% H2–5% CO2–90% N2).

Acid resistance assay

Acid resistance assay was performed as described by Wu et al.[55] with some modifications. Overnight bacterial cultures were diluted 500-fold with fresh LB broth in centrifuge tubes and incubated at 37 °C with shaking at 220 rpm for 4 h. Cells were incubated in LB medium at pH 3.0 (± 0.1) for 2 h. Acid-treated cells and the untreated control (cells before the acid treatment) then were washed with phosphate-buffered saline (PBS), serially diluted in PBS and plated on LSW− agar plates to determine the CFU. Acid survival rate (expressed as percent) was calculated with the following formula: 100 × (CFU after acid treatment/CFU before acid treatment).

Swarming assay

The swarming assay was performed on LB agar (tryptone, 10 g/l; yeast extract, 5 g/l; NaCl, 0.5 g/l; agar, 1.5%, w/v) plates as described previously[30]. The swarming migration distance was monitored by following swarm fronts of the bacterial cells and recording progress every hour.

Swimming assay

The swimming assay was performed on LB agar (agar, 0.3%, w/v) plates as described previously[30]. The swimming migration distance was recorded at 18 h after inoculation.

MIC assay

MICs of antibiotics for wild-type and mutant strains were determined by the broth microdilution method according to the guidelines proposed by the Clinical and Laboratory Standards Institute.

Growth curve analysis

Bacteria were grown overnight at 37 ℃, the cultures were diluted to an initial optical density at 600 nm (OD600) of 0.01 in LB with or without 7.5 μM CCCP and then the OD600 values were measured at 1-h intervals up to 8 h with a spectrophotometer.

Urease activity (phenol-hypochlorite) assay

Phenol-hypochlorite assay is based on the detection of ammonia released during urea hydrolysis. Ammonia can react with phenol-hypochlorite at high pH to form blue indophenol[56]. Bacteria grown to log phase (5 h after subculture) were adjusted to 2 × 10[9] CFU using LB and incubated statically in LB containing urea at 0.5 M for 2 h at 37 ℃. Supernatants were collected (70 μl per well of 96-well microplates) for urease activity measurement after centrifugation at 12,000 rpm for 5 min. Urease activity was determined by measuring ammonia production after 2-h incubation in LB containing urea at 0.5 M. Briefly, 70 μl of phenol reagent (2%(w/v) phenol in 75% ethanol) and 70 μl of alkali reagent (0.28 M sodium hydroxide and 100 mM sodium hypochlorite) were added to each well. After one hour, the absorbance at 625 nm was measured using a microplate reader (SpectraMax M2, USA).

Urinary stone formation assay

Urinary stone formation assay was performed as described previously[27,28] with some modifications. Wild-type and mutant strains were grown overnight in LB broth and diluted 100-fold in the same medium. After incubation for 5 h, bacteria were adjusted to 2 × 108 CFU/ml with synthetic urine and incubated for another 1 h in the static condition at 37 ℃. The optical density at 630 nm of well-suspended suspensions was measured as the intensity of stone formation.

UTI mouse model

The mouse model of UTIs was used as described previously[57]. Six- to eight-week old female ICR mice were injected transurethrally with overnight cultures of bacteria at a dose of 1.5 × 107 CFU per mouse. On day 3 after injection, mice were sacrificed and bladder and kidney samples were collected to determine the viable bacterial count. All animal experiments were performed in strict accordance to the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Laboratory Animal Center (Taiwan), and the protocol was approved by the Institutional Animal Care and Use Committee of National Taiwan University College of Medicine.

Reporter assay

The reporter plasmid-transformed wild-type and mutant strains were grown overnight in LB broth with chloramphenicol (40 μg/ml) and diluted (100-fold) into 10 ml LB broth. Promoter activity was measured as described previously[58]. For monitoring expression profiles, the XylE activity was monitored at 3, 5, 7 and 24 h after incubation. For signal induction, overnight bacterial cultures were regrown for 5 h and 30-min induction was performed in different conditions before the XylE activity was measured.

Deacidification assay

Overnight cultures were diluted 100-fold in fresh LB medium and incubated at 37 °C with shaking at 220 rpm for 5 h. Bacterial pellet was resuspended in synthetic urine (pH 4.8 ± 0.2). The pH value was monitored during 30–90 min at 10-min intervals by a pH meter (Jencomodel 6173, USA).

Statistical analysis

Statistical analyses were performed using GraphPad Prism software, version 6.01 or Microsoft Excel 2016. The specific statistical tests used are described in the figure legends.