Cherry P Fernandez-Colorado1,2, Paula Leona T Cammayo2, Rochelle A Flores2, Binh T Nguyen2, Woo H Kim3, Suk Kim2, Hyun S Lillehoj3, Wongi Min2. 1. Department of Veterinary Paraclinical Sciences, College of Veterinary Medicine, University of the Philippines Los Baños, College, Laguna, Philippines. 2. College of Veterinary Medicine & Institute of Animal Medicine, Gyeongsang National University, Jinju, Republic of Korea. 3. Animal Biosciences and Biotechnology Laboratory, Agricultural Research Service, United States Department of Agriculture, Beltsville, MD, United States of America.
Abstract
3,3'-Diindolylmethane (DIM) is found in cruciferous vegetables and is used to treat various inflammatory diseases because of its potential anti-inflammatory effects. To investigate effects of DIM in Riemerella anatipestifer-infected ducks which induce upregulation of inflammatory cytokines, ducks were treated orally with DIM at dose of 200 mg/kg/day and infected the following day with R. anatipestifer. Infected and DIM-treated ducks exhibited 14% increased survival rate and significantly decreased bacterial burden compared to infected untreated ducks. Next, the effect on the expression level of inflammatory cytokines (interleukin [IL]-17A, IL-17F, IL-6, IL-1β) of both in vitro and in vivo DIM-treated groups was monitored by quantitative reverse-transcription PCR (qRT-PCR). Generally, the expression levels of the cytokines were significantly reduced in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer compared to stimulated untreated splenic lymphocytes. Similarly, the expression levels of the cytokines were significantly reduced in the spleens and livers of DIM-treated R. anatipestifer-infected ducks compared to infected untreated ducks. This study demonstrated the ameliorative effects of DIM in ducks infected with R. anatipestifer. Thus, DIM can potentially be used to prevent and/or treat R. anatipestifer infection via inhibition of inflammatory cytokine expression.
3,3'-Diindolylmethane (DIM) is found in cruciferous vegetables and is used to treat various inflammatory diseases because of its potential anti-inflammatory effects. To investigate effects of DIM in Riemerella anatipestifer-infectedducks which induce upregulation of inflammatory cytokines, ducks were treated orally with DIM at dose of 200 mg/kg/day and infected the following day with R. anatipestifer. Infected and DIM-treated ducks exhibited 14% increased survival rate and significantly decreased bacterial burden compared to infected untreated ducks. Next, the effect on the expression level of inflammatory cytokines (interleukin [IL]-17A, IL-17F, IL-6, IL-1β) of both in vitro and in vivo DIM-treated groups was monitored by quantitative reverse-transcription PCR (qRT-PCR). Generally, the expression levels of the cytokines were significantly reduced in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer compared to stimulated untreated splenic lymphocytes. Similarly, the expression levels of the cytokines were significantly reduced in the spleens and livers of DIM-treated R. anatipestifer-infectedducks compared to infected untreated ducks. This study demonstrated the ameliorative effects of DIM in ducksinfected with R. anatipestifer. Thus, DIM can potentially be used to prevent and/or treat R. anatipestifer infection via inhibition of inflammatory cytokine expression.
Infection with Riemerella anatipestifer, referred to as riemerellosis, is often acute, contagious, and characterized by fibrinous exudates in the pericardial and hepatic cavities, meningitis, airsacculitis, caseous salpingitis, and septicemia [1]. The disease primarily affects domestic ducks, turkeys, geese, chickens, and other wild birds [1,2]. The mortality rate typically ranges from 5% to as high as 75%, depending on the virulence of the strain [1,3]. To date, at least 21 serotypes have been identified [3] and there is no significant serologic cross-protection between serotypes [4]. Although R. anatipestifer infection is contagious and thus poses a significant threat of economic losses in the duck industry worldwide [5,6], little progress has been made in elucidating the mechanism of host protective immunity against R. anatipestifer infection.Considerable efforts to study the host immune response and molecular pathogenesis of R. anatipestifer have centered primarily on identifying virulence factors [7,8], immunogenic proteins [2,5,9], mutant strains that could serve as ideal live or attenuated vaccines [10-12], and common immunoreactive proteins between serotypes [13]. Furthermore, several studies have investigated the expression of cytokine and cytokine-related genes during R. anatipestifer infection. Expression levels of IL-6 and CCL19, cytokines related to inflammatory processes, are upregulated in the livers of ducksinfected with R. anatipestifer [6]. Ducks vaccinated with inactivated R. anatipestifer plus levamisole as an adjuvant showed increased secretion of Th1-type (interferon [IFN]-γ and interleukin [IL]-2) and Th2-type (IL-4 and IL-10) cytokines and enhanced survival following challenge infection with a homologous R. anatipestifer strain [14]. Recent comparative analyses of the expression of immune-related genes between ducks and chickens revealed significantly higher IL-17A levels in both R. anatipestifer–infectedducks and killed R. anatipestifer–stimulated splenic lymphocytes [15,16]. Mice pre-treated with IL-17A or IL-23 prior to infection with R. anatipestifer at a sub-lethal dose exhibited increased bacterial burden and spleen weight compared to untreated infectedmice [17].The Th17 family of cytokines (IL-17A–F) has attracted attention due to its broad range of biological activities against pathogens [18,19]. IL-17A plays a particularly important role in host defense against infection with pathogens such as Staphylococcus aureus and Citrobacter rodentium [20], Chlamydia muridarum [21], and R. anatipestifer [15,16]. The critical involvement of Th1 and Th17 cells in the pathogenesis of various diseases has been demonstrated in a number of studies, and successful suppression of disease development is believed to involve neutralization or suppression of Th1 and Th17 cells [22-24]. Consequently, the use of certain anti-inflammatory agents, such as indoles (indole-3-carbinol [I3C] and 3,3’-diindolylmethane [DIM]), could be beneficial for the treatment of autoimmune diseases [25,26] and Eimeria tenella infection in chickens [27].DIM is a natural bioactive compound derived from cruciferous (Brassica) vegetables, such as cabbage, cauliflower, Brussels sprouts, kale, turnips, and broccoli [28]. DIM has been shown to regulate immune responses and exhibit a broad range of biological activities in several disease models, including various cancers [29,30] and inflammatory diseases such as multiple sclerosis [26], colitis [25,31], and arthritis [32]. Moreover, DIM has shown potential effects against infections with enteric viruses [33] and Staphylococcus aureus [34,35]. The immunomodulatory properties of DIM are associated with its ability to regulate multiple receptors [36,37] and signaling pathways, such as JNK, p38, NF-ĸB, AP-1, and FAK [28,32,38,39], suggesting that the anti-inflammatory properties of DIM are associated with the regulation of T-cell differentiation and inhibition of Th1/Th17 cells. Therefore, this study was performed to investigate the potential use of DIM in alleviating the adverse effects of R. anatipestifer infection in ducks. We also examined the expression levels of inflammatory cytokines in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer and in the spleens and livers of DIM-treated R. anatipestifer–infectedducks in comparison with stimulated untreated splenic lymphocytes and infected untreated ducks.
Materials and methods
Animal ethics statement
All animal maintenance and experimental procedures were performed according to Gyeongsang National University Guidelines for the Care and Use of Experimental Animals and approved by the Institutional Animal Care and Use Committee of Gyeongsang National University (GNU-170725-C0031). Humane endpoint criteria were set for all animals such that severe moribund animals exhibiting severe weight loss and tremors or unresponsive and unaware of stimuli were euthanized immediately by atlanto-occipital dislocation. All remaining animals were euthanized at specific time points post-inoculation as described below.
Animals, infection, and treatment
One-day old Pekin ducklings were purchased from Joowon ASTA Ducks, Korea, and raised in wire cages in a temperature-controlled environment with constant light and unlimited access to antibiotic/anticoccidial-free feed and water. The birds were randomly assigned to four groups (n = 25/group) and housed in separate buildings: one group consisted of non-infected and untreated control birds; one group consisted of non-infected/DIM-treated birds; one group consisted of infected and untreated birds and one group consisted of infected/DIM-treated birds. The bacterium used in this study, R. anatipestifer serotype 7, was isolated from a commercial duck farm in Changwon, Gyeongnam Province, Korea, and serotyped at Chonbuk National University [40]. The isolate was grown on blood agar plates with 5% sheep blood (Asan Pharmaceutical, Korea), and a single colony was then cultivated in tryptic soy broth (BD Difco, USA) at 37°C with vigorous shaking, as previously described [15,40]. Viable bacterial counts for the final challenge concentrations were determined by plating serial dilutions (10-fold) onto 5% sheep blood agar plates.Two groups of ducks, at 2 weeks of age, were infected intramuscularly in the thigh muscle using a standard needle (26 gauge) with 5 × 107 colony forming units (CFUs) of R. anatipestifer serotype 7 in 200 μl of phosphate buffered saline (PBS). DIM (Sigma-Aldrich, St. Louis, MO, USA) (200 mg/kg) was administered orally daily beginning 1 day prior to infection and continuing throughout the experiment. Both the uninfected control and infected/untreated groups were administered an equivalent volume of PBS. Five birds in each group were euthanized via atlanto-occipital dislocation for tissue sample collection (i.e., liver and spleen) at 4 days post-infection (dpi). To determine animal susceptibility following R. anatipestifer infection, the survival rates of ducks (n = 25/group) were monitored for both control and treatment groups by recording the number of dead/moribund birds per day until day 10 post-infection.
DIM preparation
DIM (≥98% purity-HPLC) was purchased from Sigma-Aldrich for cell treatment, and DIM capsules were obtained from BioPower (USA) for animal experiments. DIM was dissolved initially in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) for in vitro studies as previously described [41], and mixed with feed for in vivo studies to obtain experimental concentrations (25 μM for cell treatment and 200 mg/kg for animal experiments).
Isolation of duck splenic lymphocytes
The spleens were aseptically removed from 2-week-old healthy ducks and placed in normal Dulbecco’s modified eagle’s medium (HyClone, USA). Tissues were then minced and filtered using a sterile nylon mesh cell strainer (40 μm) (SPL, Korea). The cell suspension was diluted with an equal volume of PBS and carefully layered onto 10 ml of Ficoll-Paque PLUS solution (GE Healthcare, Sweden) for splenic lymphocyte isolation according to the manufacturer’s instructions.
MTT assay
The viability of isolated duck splenic lymphocytes was evaluated using an MTT assay, a colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide or thiazolyl blue staining method following the manufacturer’s instructions. Cells were resuspended to 5 × 106 cells/ml and seeded in a 96-well plate, treated with different concentrations of DIM (0, 3.125, 6.25, 12.5, 25, 50, 75, 100 μM), and incubated for 24 h in a 41°C incubator under 5% CO2. After 24 h of incubation, MTT solution (1 mg/ml) (Sigma-Aldrich) was added, and the cells were further incubated for 4 h. DMSO (150 μl) was added to dissolve the formed dark blue formazan crystals in each well, and the absorbance at 540 nm was determined using a microplate reader. Cell viability was expressed as percent viability of treated cells versus the control (untreated, cultured cells), which was set at 100%.
In vitro stimulation and DIM treatment of duck splenic lymphocytes
Splenic lymphocytes from 2-week-old healthy ducks isolated as described above were stimulated with heat-killed (1 × 106 CFU/ml) R. anatipestifer, treated with DIM (25 μM), and incubated for 4, 8, or 24 h in a 41°C incubator under 5% CO2. Killed R. anatipestifer was prepared by boiling cells in a water bath at 100°C for 5 min. Confirmation that R. anatipestifer cultures were killed prior to use in treating splenic lymphocytes was obtained by plating onto 5% sheep blood agar plates and monitoring for subsequent bacterial growth.
Bacterial recovery
Tissue samples from livers (0.1 g) and spleens (0.05 g) were aseptically removed and homogenized separately in 500 μl of tryptic soy broth using tissue homogenizers. The homogenized samples were then serially diluted (10- or 100-fold) before plating onto 5% sheep blood agar plates. The plates were incubated at 37°C under 5% CO2 for 48 h. Viable bacterial colonies were counted to determine the number of colony forming units (CFUs)/ml.
Quantitative reverse-transcription PCR (qRT-PCR)
Total RNA was extracted from tissue samples of five ducks from each group (control ducks, ducksinfected with R. anatipestifer but untreated, R. anatipestifer–infected and DIM-treated ducks) as well as duck splenic lymphocytes stimulated with killed R. anatipestifer. RNA was extracted using RiboEx total RNA isolation solution (GeneAll, Korea). Prior to extraction, samples were homogenized using a grinder (Dalhan Sci., Korea) for tissues or a vortex for cells, according to the manufacturers’ instructions. The extracted RNA was purified using an RNeasy Mini kit (Qiagen, Germany), treated with DNase I (Thermo Scientific, USA) to remove any contaminating genomic DNA, and quantified using an Optizen Nano Bio spectrophotometer (Mecasys, Korea). The treated RNA was used to synthesize a single-stranded cDNA using a QuantiTect Reverse Transcription Kit (Qiagen) and random hexamer primers. Quantitative real-time RT-PCR was performed in duplicate using a CFX96 real-time PCR system (Bio-Rad, USA) with the specific primers listed in Table 1. Gene expression was quantified using the comparative ΔΔCT method, with β-actin as a reference for normalization. The fold change in expression of each gene examined from R. anatipestifer–infected birds and in vitro–stimulated cells was calculated relative to the expression level in the same tissue or cells from uninfected or unstimulated samples, as previously described [15,42,49].
Table 1
Sequences of primers used for qRT-PCR analysis of cytokine expression.
Target Gene
Orientation
Sequence (5’-3’)
Reference
IL-17A
Forward
ATGTCTCCAACCCTTCGT
[43]
Reverse
CCGTATCACCTTCCCGTA
IL-17F
Forward
CTGAGAGACTTAATGGAGACTG
[43]
Reverse
AGAATCTGAACGGCTGATG
IL-6
Forward
TTCGACGAGGAGAAATGCTT
[44]
Reverse
CCTTATCGTCGTTGCCAGAT
IL-1β
Forward
TCATCTTCTACCGCCTGGAC
[44]
Reverse
GTAGGTGGCGATGTTGACCT
IFN-γ
Forward
CAACGCTCAACTACTCTC
[45]
Reverse
TGTGGTTAATCTGTCCTTAG
IL-10
Forward
GAGATGATGCGGTTCTACAT
JN786941.1
Reverse
TTATGGTTTTGCTCCTCTTC
β-Actin
Forward
GCTATGTCGCCCTGGATTTC
[46]
Reverse
CACAGGACTCCATACCCAAGAA
Statistical analyses
The statistical significance of differences in data was determined by the Student’s t-test or one-way ANOVA using InStat statistical software (GraphPad, USA). A P-value less than 0.05 was considered to indicate a statistically significant difference. Data are expressed as mean ± standard error (SE).
Results
Effect of DIM on cell viability
MTT assays were carried out to investigate the effect of DIM on the viability of duck splenic lymphocytes (S1 Fig). Duck splenic lymphocytes were isolated from healthy ducks, cultured, and stimulated with different concentrations of DIM (0–100 μM). At a DIM concentration of 25 μM, cell viability was 93%, and this was the highest concentration of DIM that did not significantly affect the cells. Therefore, we used a DIM concentration of 25 μM for all subsequent in vitro experiments (Fig 1).
Fig 1
Viability of splenic lymphocytes to 3,3’-Diindolylmethane.
Splenic lymphocytes were treated with different concentrations of DIM (0–100 μM) for 24 h, and cell viability was determined using an MTT assay. Cell viability is expressed as a percent of the viability of the control (untreated, cultured cells), which was set at 100%. Data represent the mean ± SE from three replicates of four independent experiments with similar results. Asterisks (**) indicate a significant difference relative to the control group (P < 0.01).
Viability of splenic lymphocytes to 3,3’-Diindolylmethane.
Splenic lymphocytes were treated with different concentrations of DIM (0–100 μM) for 24 h, and cell viability was determined using an MTT assay. Cell viability is expressed as a percent of the viability of the control (untreated, cultured cells), which was set at 100%. Data represent the mean ± SE from three replicates of four independent experiments with similar results. Asterisks (**) indicate a significant difference relative to the control group (P < 0.01).
Attenuation of R. anatipestifer infection by DIM treatment
Our previous studies indicated that bacterial burden during R. anatipestifer infection in ducks is the highest on day 4 post-infection [15,16]. Therefore, the bacterial load in the livers and spleens of infected/treated ducks was determined on day 4 post-infection. As shown in Fig 2A, bacterial burden was reduced significantly in the livers and spleens of infected/DIM-treated ducks compared to infected/untreated birds. Survival rate was monitored throughout the experiment, and R. anatipestifer–infectedDIM-treated ducks exhibited a reduced mortality rate compared to untreated R. anatipestifer–infectedducks. Ducksinfected with R. anatipestifer exhibited a 47% morality rate, whereas ducksinfected with R. anatipestifer and treated with DIM exhibited a 33% morality rate, indicating a 14% increase in survival rate. DIM treatment alone had no effect on mortality (Fig 2B).
Fig 2
DIM treatment attenuates R. anatipestifer infection in ducks.
(A) Bacterial load in the spleens and livers. Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) from 1 day prior to infection throughout the experiment. Five ducks were sacrificed at 4 dpi, and the spleen and liver were aseptically removed for bacterial recovery. Data on bacterial recovery represent the mean ± SE of five birds and one representative of two independent experiments. *P < 0.05 for comparison of the infected/untreated group (RA) with the infected/treated group (RA + DIM). (B) Survival rate of ducks (n = 25/group). The survival rate of control and treated ducks was recorded every day for 10 days. Data represent one representative of two independent experiments. NC, uninfected healthy control; RA, R. anatipestifer; DIM, 3,3’-diindolylmethane; CFU, colony formation unit.
DIM treatment attenuates R. anatipestifer infection in ducks.
(A) Bacterial load in the spleens and livers. Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) from 1 day prior to infection throughout the experiment. Five ducks were sacrificed at 4 dpi, and the spleen and liver were aseptically removed for bacterial recovery. Data on bacterial recovery represent the mean ± SE of five birds and one representative of two independent experiments. *P < 0.05 for comparison of the infected/untreated group (RA) with the infected/treated group (RA + DIM). (B) Survival rate of ducks (n = 25/group). The survival rate of control and treated ducks was recorded every day for 10 days. Data represent one representative of two independent experiments. NC, uninfected healthy control; RA, R. anatipestifer; DIM, 3,3’-diindolylmethane; CFU, colony formation unit.
Effect of DIM treatment on IFN-γ and IL-10 expression levels
Quantitative RT-PCR analysis was conducted to analyze the expression profiles of IFN-γ and IL-10 in splenic lymphocytes stimulated with heat-killed R. anatipestifer in the presence or absence of 25 μM DIM for 4, 8, and 24 h (Fig 3). Expression profiles of these cytokines were also examined in DIM-treated R. anatipestifer–infectedducks (Fig 4).
Fig 3
Effect of DIM on IFN-γ and IL-10 expression in splenic lymphocytes.
Splenic lymphocytes collected from 2-week-old healthy ducks were stimulated with killed-R. anatipestifer and treated simultaneously with DIM (25 μM) for the indicated times. Samples were then subjected to qRT-PCR. The levels of IFN-γ (A) and IL-10 (B) mRNA were normalized to that of β-actin and calibrated using the expression levels of unstimulated cultured splenic lymphocytes (NC). Data are expressed as the mean ± SE from four independent experiments with duplicates. **P < 0.01 compared to NC. P < 0.05, P < 0.01, and P < 0.001 for comparison of stimulated/untreated splenic lymphocytes with stimulated/treated splenic lymphocytes. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.
Fig 4
Effect of DIM on IFN-γ and IL-10 expression in R. anatipestifer–infected ducks.
Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) by gavage daily from 1 day prior to infection throughout the experimental period. Ducks (n = 5/group) were sacrificed on day 4 after infection. The spleen and liver were aseptically removed, homogenized using a grinder, and subjected to qRT-PCR. The levels of IFN-γ (A) and IL-10 (B) mRNA were normalized to that of β-actin and calibrated using the expression levels of uninfected/untreated healthy birds (NC). Data are expressed as the mean ± SE of five birds and one representative of two independent experiments. *P < 0.05 and **P < 0.01 compared to NC. P < 0.01 for comparison of the infected/untreated group with the infected/treated group. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.
Effect of DIM on IFN-γ and IL-10 expression in splenic lymphocytes.
Splenic lymphocytes collected from 2-week-old healthy ducks were stimulated with killed-R. anatipestifer and treated simultaneously with DIM (25 μM) for the indicated times. Samples were then subjected to qRT-PCR. The levels of IFN-γ (A) and IL-10 (B) mRNA were normalized to that of β-actin and calibrated using the expression levels of unstimulated cultured splenic lymphocytes (NC). Data are expressed as the mean ± SE from four independent experiments with duplicates. **P < 0.01 compared to NC. P < 0.05, P < 0.01, and P < 0.001 for comparison of stimulated/untreated splenic lymphocytes with stimulated/treated splenic lymphocytes. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.
Effect of DIM on IFN-γ and IL-10 expression in R. anatipestifer–infected ducks.
Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) by gavage daily from 1 day prior to infection throughout the experimental period. Ducks (n = 5/group) were sacrificed on day 4 after infection. The spleen and liver were aseptically removed, homogenized using a grinder, and subjected to qRT-PCR. The levels of IFN-γ (A) and IL-10 (B) mRNA were normalized to that of β-actin and calibrated using the expression levels of uninfected/untreated healthy birds (NC). Data are expressed as the mean ± SE of five birds and one representative of two independent experiments. *P < 0.05 and **P < 0.01 compared to NC. P < 0.01 for comparison of the infected/untreated group with the infected/treated group. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.Compared to unstimulated cultured (or control) splenic lymphocytes, IFN-γ transcript expression levels increased slightly, by 1.6- and 1.8-fold, in R. anatipestifer–stimulated splenic lymphocytes at 4 and 8 h, respectively, but not at 24 h. IFN-γ expression levels in stimulated and DIM-treated lymphocytes were significantly reduced at 4 and 8 h, whereas the level of IFN-γ expression was significantly enhanced in stimulated and treated lymphocytes at 24 h, compared to stimulated and untreated lymphocytes (Fig 3A). Levels of IL-10 transcripts were significantly increased both in R. anatipestifer–stimulated splenic lymphocytes and R. anatipestifer–stimulated/DIM-treated lymphocytes at all time points compared to control splenic lymphocytes(NC). Levels of IL-10 expression were significantly upregulated in stimulated and treated lymphocytes at 24 h, compared to stimulated and untreated lymphocytes (Fig 3B). DIM treatment alone had no effect on the levels of IFN-γ or IL-10 transcripts at any time point, except for the level of IFN-γ expression at 8 h, which was significantly enhanced (Fig 3A).Compared to uninfected healthy control ducks, the levels of IFN-γ transcripts were significantly higher in the spleens of R. anatipestifer–infected birds as well as R. anatipestifer–infected/DIM-treated birds. IFN-γ expression levels in infected and treated birds were significantly upregulated in the spleen but not the liver, as compared with infected/untreated birds (Fig 4A). Expression levels of IL-10 were significantly increased in the spleens and livers of R. anatipestifer–infected birds compared to uninfected healthy controls. However, IL-10 expression levels in infected/treated birds were significantly reduced in the spleen and liver compared to infected/untreated birds (Fig 4B). DIM treatment alone had no effect on the expression of IFN-γ or IL-10 transcripts in either tissue (Fig 4).
Downregulated expression of IL-17A and related cytokines following DIM treatment
DIM supressed Th17 cell differentiation, resulting in downregulation of IL-17A expression levels [25]. Our previous studies demonstrated upregulated expression of inflammatory cytokines, including IL-17A, in R. anatipestifer–infectedducks [15,42,47]. Thus, the expression profiles of inflammatory cytokines such as IL-17A, IL-17F, IL-6, and IL-1β were investigated by qRT-PCR in splenic lymphocytes stimulated with heat-killed R. anatipestifer in the presence and absence of 25 μM DIM for 4, 8, and 24 h (Fig 5). Expression profiles of these cytokines were also examined in DIM-treated R. anatipestifer–infectedducks (Fig 6).
Fig 5
Effect of DIM on the expression of IL-17A and related cytokines in splenic lymphocytes.
Splenic lymphocytes collected from 2-week-old healthy ducks were stimulated with killed-R. anatipestifer and treated simultaneously with DIM (25 μM) for the indicated times. Samples were then subjected to qRT-PCR. The levels of IL-17A (A), IL-17F (B), IL-6 (C), and IL-1β (D) mRNA were normalized to that of β-actin and calibrated using the expression levels of unstimulated cultured splenic lymphocytes (NC). Data are expressed as the mean ± SE from four independent experiments with duplicates. **P < 0.01 compared to NC. P < 0.05 and P < 0.001 for the comparison of stimulated/untreated splenic lymphocytes with stimulated/treated splenic lymphocytes. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.
Fig 6
Effect of DIM on the expression of IL-17A and related cytokines in R. anatipestifer–infected ducks.
Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) by gavage daily from 1 day prior to infection throughout the experimental period. Ducks (n = 5/group) were sacrificed on day 4 after infection. The spleen and liver were aseptically removed, homogenized using a grinder, and subjected to qRT-PCR. The levels of IL-17A (A), IL-17F (B), IL-6 (C), and IL-1β (D) mRNA were normalized to that of β-actin and calibrated using the expression levels of uninfected/untreated healthy birds (NC). Data are expressed as the mean ± SE of five birds and one representative of two independent experiments. **P < 0.01 compared to NC. P < 0.01 for the comparison of the infected/untreated group with the infected/treated group. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane; DPI, days post-infection.
Effect of DIM on the expression of IL-17A and related cytokines in splenic lymphocytes.
Splenic lymphocytes collected from 2-week-old healthy ducks were stimulated with killed-R. anatipestifer and treated simultaneously with DIM (25 μM) for the indicated times. Samples were then subjected to qRT-PCR. The levels of IL-17A (A), IL-17F (B), IL-6 (C), and IL-1β (D) mRNA were normalized to that of β-actin and calibrated using the expression levels of unstimulated cultured splenic lymphocytes (NC). Data are expressed as the mean ± SE from four independent experiments with duplicates. **P < 0.01 compared to NC. P < 0.05 and P < 0.001 for the comparison of stimulated/untreated splenic lymphocytes with stimulated/treated splenic lymphocytes. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane.
Effect of DIM on the expression of IL-17A and related cytokines in R. anatipestifer–infected ducks.
Two-week-old ducks were inoculated intramuscularly with 5 × 107 CFU of R. anatipestifer serotype 7 and treated orally with DIM (200 mg/kg/day) by gavage daily from 1 day prior to infection throughout the experimental period. Ducks (n = 5/group) were sacrificed on day 4 after infection. The spleen and liver were aseptically removed, homogenized using a grinder, and subjected to qRT-PCR. The levels of IL-17A (A), IL-17F (B), IL-6 (C), and IL-1β (D) mRNA were normalized to that of β-actin and calibrated using the expression levels of uninfected/untreated healthy birds (NC). Data are expressed as the mean ± SE of five birds and one representative of two independent experiments. **P < 0.01 compared to NC. P < 0.01 for the comparison of the infected/untreated group with the infected/treated group. RA, R. anatipestifer; DIM, 3,3’-diindolylmethane; DPI, days post-infection.As shown in Fig 5, expression levels of IL-17A and related cytokines were dramatically upregulated in both R. anatipestifer–stimulated lymphocytes and R. anatipestifer–stimulated/DIM-treated lymphocytes at all time points compared to cultured untreated control splenic lymphocytes. Interestingly, stimulated/DIM-treated lymphocytes exhibited significant downregulation of IL-17A and IL-17F expression at 8 and 24 h compared with stimulated/untreated lymphocytes (Fig 5A and 5B). Levels of IL-6 expression were significantly reduced in stimulated/treated lymphocytes at 24 h compared to stimulated/untreated lymphocytes (Fig 5C). Similarly, IL-1β expression levels were significantly reduced in stimulated/treated lymphocytes at 8 and 24 h compared to stimulated/untreated lymphocytes (Fig 5D), although IL-6 and IL-1β expression levels were significantly increased only at 4 h (Fig 5C and 5D).The in vitro results described above indicated that DIM has a negative regulatory effect on the expression of Th17-related cytokines. Hence, we further investigated whether the expression levels of inflammatory cytokines were downregulated in the spleens and livers of DIM-treated ducks. The expression of IL-17A and related cytokines was dramatically upregulated in R. anatipestifer–infectedducks compared with uninfected healthy control ducks. Compared to the R. anatipestifer–infectedducks, mRNA expression levels of Th17-related cytokines, including IL-1β, IL-6, and IL-17A were markedly reduced in the livers and spleens of all infected groups treated with DIM (Fig 6A, 6C and 6D). Although the level of IL-17F mRNA was markedly reduced in the liver, it was unchanged in the spleen (Fig 6B). Collectively, these results suggest that DIM treatment significantly suppresses the production of inflammatory cytokines both in vitro in stimulated duck splenic lymphocytes and in vivo in ducksinfected with R. anatipestifer.
Discussion
Different species of birds exhibit differences in susceptibility to R. anatipestifer infection and differences in the elicited immune response, as demonstrated by our previous study, particularly in ducks and chickens [15]. Comparative analyses of the expression of immune-related cytokines revealed a significant association between upregulated expression of inflammatory cytokines such as IL-17A, IL-6, and IL-1β and R. anatipestifer infection in ducks but not chickens [15]. IL-17A is crucial for host protective immunity against various microbial pathogens, whereas Th17 cells expressing IL-17A are emerging as critical mediators of autoimmune diseases, thus increasing interest and research into the development of strategies to treat these autoimmune diseases. Recent studies examining the involvement of Th17 cells in the pathogenesis of various diseases revealed that neutralization or suppression of these cells suppresses disease development [22-24].Few studies demonstrated that suppression of proinflammatory cytokine expression alleviates R. anatipestifer infection [42,44,48]. Chickensinfected with R. anatipestifer exhibited lower susceptibility compared to infectedducks. This difference was attributed to upregulated expression of IL-4, the hallmark Th2 cytokine, in the livers and spleens of infectedchickens, suggesting that IL-4 is involved in suppressing the expression of proinflammatory cytokines, including IL-17A [15]. Consequently, recombinant duck IL-4 significantly downregulated the expression of proinflammatory cytokines in R. anatipestifer–stimulated and IL-4–treated duck splenic lymphocytes [48]. Moreover, the use of an anti-inflammatory agent such as berberine not only increased the survival rate and decreased the bacterial burden, it also downregulated the expression of proinflammatory cytokines in ducksinfected with R. anatipestifer compared with R. anatipestifer–infectedducks not treated with berberine [42]. These findings suggest that inhibiting the expression of proinflammatory cytokines, including IL-17A, can reduce the severity of R. anatipestifer infection in ducks. Here, we report ameliorative effects of DIM in R. anatipestifer–infectedducks.Our present study demonstrated that DIM treatment significantly reduces the bacterial burden in the livers and spleens of R. anatipestifer–infectedducks (Fig 2A). It is interesting to note that I3C, which is converted to DIM when given orally, exhibited antibacterial activity against clinical isolates of antibiotic-resistant organisms such as Escherichia coli, S. aureus, and Pseudomonas aeruginosa and antifungal activity against Candida albicans [49,50]. DIM derivatives have been shown to exert antibacterial effects against various gram-negative and gram-positive bacteria, indicating that drugs based on DIM could be efficacious against a number of infectious diseases [51]. The findings of our study suggest that DIM also exhibits antibacterial activity against R. anatipestifer. Generally, infection with R. anatipestifer is associated with a mortality rate ranging from 5–75%, as previously reported in ducks [15,42,52]. In the present study, DIM treatment of R. anatipestifer–infectedducks led to a 14% increase in the survival rate (Fig 2B). The survival rate was also significantly increased by DIM treatment in mice with hematopoietic injury induced by total body irradiation [53] and in rats pre-treated with DIM prior to radiation exposure [54].Th1 and Th2 cytokines are reportedly negative regulators of Th17 immune responses [55]. Therefore, in this study, we also investigated whether DIM affects the expression of Th1 (IFN-γ) and Th2 (IL-10) cytokines. The expression of IFN-γ was significantly upregulated only at 24 h in R. anatipestifer–stimulated DIM-treated splenic lymphocytes and in the spleens of R. anatipestifer–infectedDIM-treated ducks (Figs 3A and 4A). DIM has been shown to increase expression of the IFN-γ gene in MCF-7humanbreast cancer cells, MDA-MB-231 cells, and Jurkat T cells. However, increased expression of the IFN-γ gene was not detected at all time points in a previous study [38]. Oral administration of DIM was shown to increase serum levels of IFN-γ in mice [33]. In contrast, DIM treatment did not result in a significant increase in IFN-γ expression during oxazolone-induced colitis in mice [25]. Peritoneal administration of DIM in mice did not affect serum levels of IFN-γ [33]. Expression of IFN-γ was significantly reduced in the colon of dextran sodium sulfate (DSS)-exposed mice treated with DIM [56]. IL-10 expression in present study was significantly upregulated at 24 h in R. anatipestifer–stimulated DIM-treated duck splenic lymphocytes in the present study (Fig 3B). In another study, the expression of IL-10 mRNA was significantly increased at 24 h in ConA-stimulated chicken splenic lymphocytes treated with DIM or I3C [27]. Furthermore, expression of IL-10 mRNA was significantly increased in the cecal tonsils of chickens treated daily with DIM or I3C for 14 days. IL-10 mRNA expression was frequently, but not always, upregulated in the cecal tonsils of Eimeria tenella–infectedDIM-treated chickens compared to E. tenella–infected untreated chickens [27]. However, in an earlier study, Kim et al., [56] found that IL-10 expression was either unchanged or reduced in the colon of DSS-exposed DIM-treated mice, depending on the DIM concentration. In our study, IL-10 expression was reduced in the spleens and livers of R. anatipestifer–infectedDIM-treated ducks compared with R. anatipestifer–infected untreated ducks (Fig 4B). Considered collectively, the discrepancies between the results of our study and others regarding IFN-γ and IL-10 expression may be associated with differences between in vivo and in vitro experiments, different infection target sites, and animal and disease models. In the present study, the physiologic relevance of IFN-γ and IL-10 expression in DIM-treated R. anatipestifer–stimulated splenic lymphocytes and R. anatipestifer–infectedducks is unclear; thus, further studies are necessary to better characterize the effects of DIM on the expression of these cytokines.In vitro and in vivo analyses indicated significant reductions in the expression of inflammatory cytokines, including IL-17A, IL-7F, IL-1β, and IL-6, at 24 h after DIM treatment in duck splenic lymphocytes stimulated with R. anatipestifer and in the spleens and livers of R. anatipestifer–infectedducks. Similarly, recent studies have suggested that DIM exerts anti-inflammatory effects against autoimmune diseases via multiple signaling pathways, such as suppression of Th17 cell differentiation, which leads to a decrease in inflammatory cytokine expression [25,28,39,57]. The downregulated expression of IL-17A and IL-6 after DIM treatment was similar to that observed in mice with autoimmune diseases such as colitis [56] and experimental autoimmune encephalomyelitis [58], in which IL-17A and IL-6 expression was also suppressed by DIM treatment. IL-6 expression was shown to be downregulated in inflamed ears of mice treated with topical DIM [59]. DIM significantly downregulated the expression of IL-6 and IL-1β in lipopolysaccharide-stimulated RAW264.7murine macrophages [28]. In avian species, the expression of IL-17A mRNA was shown to be significantly downregulated at 24 h in mitogen-stimulated chicken splenic lymphocytes treated with DIM or I3C. Levels of IL-17A and IL-1F mRNA were significantly reduced in the cecal tonsils of chickens treated daily with DIM or I3C for 14 days [27]. In addition, in chickens challenged with the parasite E. tenella, DIM treatment resulted in a significant decrease Th17 cells, leading to downregulation of IL-17A expression in the later stages of [27]. These data suggest that DIM inhibits Th17-related cytokine production both in vitro and in vivo following R. anatipestifer stimulation or infection.In conclusion, DIM treatment appears to suppress the development of riemerellosis by reducing the bacterial burden and the expression of inflammatory cytokines in tissues of R. anatipestifer–infectedducks, resulting in higher survival rates. Moreover, given the marked upregulation of inflammatory cytokine expression in both R. anatipestifer–stimulated splenic lymphocytes and R. anatipestifer–infectedducks in our previous studies [15,16,42,48], the results of the present study further suggest that inhibition of inflammatory cytokine expression could significantly reduce economic losses associated with R. anatipestifer infection in farmed ducks.
Chemical structure of 3,3’-diindolylmethane (DIM).
(DOCX)Click here for additional data file.16 Oct 2020PONE-D-20-21347Anti-inflammatory activity of diindolylmethane alleviates Riemerella anatipestifer infection in ducksPLOS ONEDear Dr. Min,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Notably, you will see that both reviewers have suggested that you add additional information regarding your study.Please submit your revised manuscript by Nov 30 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,François Blachier, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The article is good written, meets scientific principles, is systematic and clear.Needs a little revision of the abstract and an explanation of the treatment groups. The results of the study will be more comprehensive, if the duck mortality data is added.Reviewer #2: Line 32 - 36, the sentence is too lengthy and confusing, require to rephrase the sentence.Does the author have any idea about the pharmacokinetic data of DIM in the animal and the potential metabolites that might have contributed to the anti-inflammatory effect?**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: Anti-inflammatory activity of diindolymethane alleviates Riemerella anatipestifer infection in ducks.docxClick here for additional data file.Submitted filename: Review_RA(DIM)-paper-final.docxClick here for additional data file.26 Oct 2020PONE-D-20-21347: Anti-inflammatory activity of diindolylmethane alleviates Riemerella anatipestifer infection in ducksWe very much appreciate the reviewer’s incisive comments and thank Sir/Madam for a very thorough examination of our data and recommendations for improvement. Below are our point-for-point responses. We really hope these will meet your approval.Comments from the editors and reviewers:Reviewer #1Comment: The article is good written, meets scientific principles, is systematic and clear. Needs a little revision of the abstract and an explanation of the treatment groups. The results of the study will be more comprehensive, if the duck mortality data is added.Response: The Abstract was modified as “3,3’-Diindolylmethane (DIM) is found in cruciferous vegetables and is used to treat various inflammatory diseases because of its potential anti-inflammatory effects. To investigate effects of DIM in Riemerella anatipestifer-infectedducks which induce upregulation of inflammatory cytokines, ducks were treated orally with DIM at dose of 200 mg/kg/day and infected the following day with R. anatipestifer. Infected and DIM-treated ducks exhibited 14% increased survival rate and significantly decreased bacterial burden compared to infected untreated ducks. Next, the effect on the expression level of inflammatory cytokines (interleukin [IL]-17A, IL-17F, IL-6, IL-1β) of both in vitro and in vivo DIM-treated groups was monitored by quantitative reverse-transcription PCR (qRT-PCR). Generally, the expression levels of the cytokines were significantly reduced in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer compared to stimulated untreated splenic lymphocytes. Similarly, the expression levels of the cytokines were significantly reduced in the spleens and livers of DIM-treated R. anatipestifer–infectedducks compared to infected untreated ducks. This study demonstrated the ameliorative effects of DIM in ducksinfected with R. anatipestifer. Thus, DIM can potentially be used to prevent and/or treat R. anatipestifer infection via inhibition of inflammatory cytokine expression”In lines 216-219, the sentence was modified with the duck mortality data as “Ducksinfected with R. anatipestifer exhibited a 47% morality rate, whereas ducksinfected with R. anatipestifer and treated with DIM exhibited a 33% morality rate, indicating a 14% increase in survival rate. DIM treatment alone had no effect on mortality (Fig 2B)”Comment: There are 3 group?Response: In lines 111-114, the sentence “The birds were randomly assigned to four groups (n = 25/group) and housed in separate buildings: one group consisted of infected and untreated birds; one group consisted of infected/DIM-treated birds; and one group consisted of non-infected control birds” was changed with “The birds were randomly assigned to four groups (n = 25/group) and housed in separate buildings: one group consisted of non-infected and untreated control birds; one group consisted of non-infected/DIM-treated birds; one group consisted of infected and untreated birds and one group consisted of infected/DIM-treated birds”Reviewer #2Comment-1: Line 32 - 36, the sentence is too lengthy and confusing, require to rephrase the sentence.Response: The indicated sentence “Generally, the expression levels of inflammatory cytokines (interleukin [IL]-17A, IL-17F, IL-6, IL-1β) were significantly reduced both in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer and in the spleens and livers of DIM-treated R. anatipestifer–infectedducks compared to stimulated untreated splenic lymphocytes and infected untreated ducks” was changed as “Next, the effect on the expression level of inflammatory cytokines (interleukin [IL]-17A, IL-17F, IL-6, IL-1β) of both in vitro and in vivo DIM-treated groups was monitored by quantitative reverse-transcription PCR (qRT-PCR). Generally, the expression levels of the cytokines were significantly reduced in DIM-treated splenic lymphocytes stimulated with killed R. anatipestifer compared to stimulated untreated splenic lymphocytes. Furthermore, the expression levels of the cytokines were significantly reduced in the spleens and livers of DIM-treated R. anatipestifer–infectedducks compared to infected untreated ducks”Comment-2: Does the author have any idea about the pharmacokinetic data of DIM in the animal and the potential metabolites that might have contributed to the anti-inflammatory effect?Response: There is still a lack or limited information on the effects and pharmacokinetic of DIM in poultry research. The pharmacokinetic data of DIM in ducks in particular have not been reported or studied elsewhere. However, several studies on the pharmacokinetic of DIM have been demonstrated in other animal models like mice or rats. 3,3’-Diindolylmethane (DIM) is a bioactive metabolite of indole-3-carbinol, a phytochemical produced by the breakdown of the glucosinolate glucobrassicin found in cruciferous vegetables. In mice, DIM is distributed to all tissues after oral administration, with the liver exhibiting the highest concentration. The highest concentration in the liver is reached about 25 minutes after oral administration of DIM and is gradually decreased over time(Anderton et al., Pharmacokinetics and tissue disposition of indole-3-carbinol and its acid condensation products after oral administration to mice. Clinical Cancer Research. 2004. 10. 5233-5241). The pharmacokinetic of DIM was also demonstrated in rats treated intravenously with 10mg/kg DIM and results showed that DIM has a fast metabolism and elimination of DIM with a terminal half-life of 0.737h (Wu et al., 2015 in Journal of Pharmacokinetics and Pharmacodynamics, DOI 10.1007/s10928-015-9421-5).Generally, DIM significantly decreased the release of nitric oxide (NO), prostaglandin (PG) E2, tumor necrosis factor alpha, interleukin (IL)-6, and IL-1beta which are related with inflammatory response (Cho et al., 3,3'-Diindolylmethane suppresses the inflammatory response to lipopolysaccharide in murine macrophages. The Journal of Nutrition. 2008. 138. 17-23). Furthermore, on the anti-inflammatory effects of IC3 and its metabolite, DIM, have been studied on CD4+ T cell population and in chickensinfected with Eimeria tenella (Kim et al., Indole Treatment Alleviates Intestinal Tissue Damage Induced by ChickenCoccidiosis Through Activation of the Aryl Hydrocarbon Receptor. Frontiers in Immunology. 2019. 10. 560). In the mentioned study, it was suggested that DIM is a ligand for chickenaryl hydrocarbon receptor (AhR) where once activated by DIM and IC3, it will exhibit anti-inflammatory properties.Q1. DIM has effects on the expression of these cytokines, also DIM was associated with signaling pathways such as JNK, p38, NF-κB, AP-1, and FAK. Which signal pathway is mainly? Also can you explain that how DIM kills bacteria on ducks?Response: Several studies have demonstrated the association of signaling pathways in the expression of cytokines caused by indoles (DIM, IC3). IC3 has been reported to modulate pathogen-induced intestinal inflammation caused by the bacterium Citrobacter rodentium through aryl hydrocarbon receptor (AhR) activation (Kiss et al., 2011; Schiering et al., 2017). Recently, indoles (DIM, IC3) also exhibited the involvement of AhR in chickensinfected with Eimeria tenella which resulted in an increase in the number of Treg cells and suppression of Th17 cells (Kim et al., 2019). Interestingly, the authors of the current study also performed mRNA expression analysis of MyD88, STAT3, TAK1 and NF-κB genes in R. anatipestifer-stimulated splenic lymphocytes as well as in DIM-treated stimulated splenic lymphocytes for 4, 8 and 24 h. Results showed that expression levels of MyD88, STAT3 and TAK1 were unchanged or statistically not significant (ns) between R. anatipestifer-stimulated and DIM-treated stimulated splenic lymphocytes after 24 h. However, expression level of NF-κB was downregulated after 24 h in DIM-treated stimulated splenic lymphocytes compared with R. anatipestifer-stimulated untreated splenic lymphocytes. Thus, we hypothesize that DIM is mainly associated with NF-κB and AP-1 signaling pathways as demonstrated in the following figure. However, we need to conduct more study to verify the exact mechanisms.3,3’-Diindolylmethane (DIM) is a bioactive metabolite of indole-3-carbinol (I3C). Plasma and tissue I3C concentrations in mice administered by the oral route (250 mg/kg) are generally less than 24 ug/ml (Anderton et al., Pharmacokinetics and tissue disposition of indole-3-carbinol and its acid condensation products after oral administration to mice. Clinical Cancer Research. 2004. 10. 5233-5241). In addition, after oral administration to rats and human at dose of 200 mg/kg/DIM, the actual plasma concentrations of DIM are 150-230 ng/ml in rats and about 83 ng/ml in human (Paltsev, M. et al. Comparative preclinical pharmacokinetics study of 3,3′-diindolylmethane formulations: is personalized treatment and targeted chemoprevention in the horizon? The EPMA journal, 2013. 4. 25; Reed, G. et al. Single-Dose Pharmacokinetics and Tolerability of Absorption Enhanced 3, 3′-Diindolylmethane in Healthy Subjects. Cancer Epidemiology, Biomarkers and prevention, 2008. 17. 2619-2624). Based on these papers, we first tested if DIM directly kills R. anatipestifer at 0 μg/ml, 5 μg/ml and 10 μg/ml concentration on Tryptic Soy Agar (TSA) agar plates. It was 34-120 times higher than the actual plasma concentrations of DIM administrated with dose of 200 mg/kg.Both concentrations showed similar numbers of bacteria compared to DIM-untreated control group. Accordingly, it is believed that DIM can kill bacteria by altering the immune status of ducksinfected with R. anatipestifer.Q2. On the Fig.2A, in the RA infected group from liver, it displays lower bacterial load on three ducks, even close to zero. Did it mean that ducks clear bacterium by themselves, but has nothing to do with DIM treatment? Maybe you increase the number of ducks.Response: LD50 was used in this study and the time point of significant changes, such as mortality and immune changes, are observed 4 days after R. anatipestifer infection. Thus, we expect 50% birds to be more vulnerable and the remaining 50% to be resistant. Fig. 2A indicated that the three ducks immunity either eliminated the bacteria themselves or the organ contained less than 100 bacteria. On the other hand, vulnerable birds in infected and DIM-treated group shown to have a reduced bacterial count. Although the figure legend mentioned that we performed two independent experiments in this study, at least four or five independent experiments were conducted and showed similar results.Q3. On the Fig.2B, only 14% survival rate is contributed by DIM, is there a signification on the clinical treatment? Maybe we increase infectious dose, whether the survival rate of ducksinfected with RA and DIM treatment is lower same as survival rate of ducksinfected with RA?Response: Although there is no direct data for field trials, we believe that it can reduce the cost of damage (ex, mortality and antibiotics) caused by ducksinfected with R. anatipestifer. When ducks were infected with high dose (10 times of LD50), ducks mostly died in both infected/DIM-treated group and infected/non-treated group.Q4. All cytokines detected are by RT-qPCR method, can you detect them by other methods, such as ELISA, WB?Response: Compared to mice, there is a very limited or minimal studies on poultry research due to the availability of reagents and/or antibodies specifically for ducks. Hence, all cytokines in this study were detected by qRT-PCR. Given that the antibodies for cytokine detection are available commercially, we will try our best to do ELISA and WB.Suggestion 1. Can you move Figure 1A to the supplementary results.Response: Figure 1A was moved to the supplementary results as suggested by the reviewer.Suggestion 2. The Fig.6D was wrong, can you correct it.Response: Fig.6D was corrected as suggested by the reviewer in the revised manuscript.Submitted filename: PONE-D-20-21347 Response to Reviewers comments.docxClick here for additional data file.29 Oct 2020Anti-inflammatory activity of diindolylmethane alleviates Riemerella anatipestifer infection in ducksPONE-D-20-21347R1Dear Dr. Min,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,François Blachier, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional): The authors have given timely responses to the reviewer's comments, and have modified their manuscript accordingly.3 Nov 2020PONE-D-20-21347R1Anti-inflammatory activity of diindolylmethane alleviates Riemerella anatipestiferinfection in ducksDear Dr. Min:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. François BlachierAcademic EditorPLOS ONE