Literature DB >> 33162464

Requirement of γ-Aminobutyric Acid Chemotaxis for Virulence of Pseudomonas syringae pv. tabaci 6605.

Stephany Angelia Tumewu1, Hidenori Matsui1, Mikihiro Yamamoto1, Yoshiteru Noutoshi1, Kazuhiro Toyoda1, Yuki Ichinose1.   

Abstract

γ-Aminobutyric acid (GABA) is a widely distributed non-proteinogenic amino acid that accumulates in plants under biotic and abiotic stress conditions. Recent studies suggested that GABA also functions as an intracellular signaling molecule in plants and in signals mediating interactions between plants and phytopathogenic bacteria. However, the molecular mechanisms underlying GABA responses to bacterial pathogens remain unknown. In the present study, a GABA receptor, named McpG, was conserved in the highly motile plant-pathogenic bacteria Pseudomonas syringae pv. tabaci 6605 (Pta6605). We generated a deletion mutant of McpG to further investigate its involvement in GABA chemotaxis using quantitative capillary and qualitative plate assays. The wild-type strain of Pta6605 was attracted to GABA, while the ΔmcpG mutant abolished chemotaxis to 10‍ ‍mM GABA. However, ΔmcpG retained chemotaxis to proteinogenic amino acids and succinic semialdehyde, a structural analog of GABA. Furthermore, ΔmcpG was unable to effectively induce disease on host tobacco plants in three plant inoculation assays: flood, dip, and infiltration inoculations. These results revealed that the GABA sensing of Pta6605 is important for the interaction of Pta6605 with its host tobacco plant.

Entities:  

Keywords:  GABA; Pseudomonas; bacterial virulence; chemotaxis; plant-microbe interaction

Mesh:

Substances:

Year:  2020        PMID: 33162464      PMCID: PMC7734410          DOI: 10.1264/jsme2.ME20114

Source DB:  PubMed          Journal:  Microbes Environ        ISSN: 1342-6311            Impact factor:   2.912


Phytopathogenic bacteria encounter harsh environmental conditions as soon as they arrive at the surface of their host, which may decrease their chance of survival. Therefore, these bacteria need to develop a system that enables them to sense environmental stimuli and respond accordingly. Most phytopathogenic bacteria detect and use signals coming from a host plant to their advantage by moving towards nutrient sources or away from potential danger. These sophisticated behaviors are known as chemotaxis (Adler, 1966; Sourjik and Wingreen, 2012). Chemoreceptors are methyl-accepting chemotaxis proteins (MCPs) located outside the cell membrane and in the cytosol. When MCPs perceive environmental compounds, they transduce the signals to their cytoplasmic signaling domain (SD). Bacteria possess 5 to 60 mcp genes encoding MCPs (Alexandre ). Methylation helices, parts of SD, are important for adaptation with contributions from methyltransferase CheR and methylesterase CheB. SD then relays signals to the coupling protein CheW and to two component systems, CheA and CheY. Phosphorylated CheY affects the direction of flagellar motor rotation (clockwise/tumble or counter-clockwise/swim) (Bi and Lai, 2015; Huang ). Some MCPs in plant-associated bacteria have been successfully characterized. MCPs for amino acids and organic acids have been identified in Pseudomonas fluorescens Pf0-1, a plant-protective bacterium (Oku , 2014). Furthermore, the McpS, McpQ, and McpG of Pseudomonas putida KT2440 are chemoreceptors for tricarboxylic cycle intermediates (Lacal ), citrate (Martin-Mora ), and γ-aminobutyric acid (GABA) (Reyes-Darias ), respectively. The identification of bacterial chemoreceptors has expanded to bacterial species with different lifestyles. Pathogenic bacteria employ chemotaxis to enhance pathogenicity and virulence (Matilla and Krell, 2018). In Pseudomonas aeruginosa, an animal pathogen and major model pathogen in the study of chemotaxis, several chemoreceptors were identified for proteinogenic amino acids (Kato ), GABA (Rico-Jiménez ), and α-ketoglutarate (Martin-Mora). Furthermore, specific chemoreceptors for malate, amino acids, and boric acid, which are considered to be important for the mediation of chemotaxis in plant infection, were identified in the tomato bacterial wilt pathogen, (Hida , 2017). As previously reported, Pseudomonas syringae moves towards wounds or natural openings in host plants and induces disease, indicating chemotactic behavior towards molecules leaving these openings (Melotto ). The requirement for adaptation for survival may force pathogens to evolve multiple chemoreceptor proteins, MCPs. In Escherichia coli strain K-12, which possesses only five chemoreceptors, the specificity of ligand recognition within the ligand-binding domain (LBD) has been extensively characterized (Bi and Lai, 2015). Very recently, PscA of P. syringae pv. tomato DC3000 (PtoDC3000) was identified as a chemoreceptor for L-Asp, L-Glu, and D-Asp, and the virulence of the pscA mutant was reduced (Cerna-Vargas ). However, the majority of chemoreceptor functions have not yet been elucidated due to the difficulties associated with functionally analyzing up to 50‍ ‍MCPs. PctC and McpG, chemoreceptors for GABA, were recently reported in P. aeruginosa PAO1 (Rico-Jiménez ) and saprophytic P. putida KT2440 (Reyes-Darias ), respectively, supporting the universal importance of GABA as a signaling molecule. Furthermore, the PscC of the kiwifruit pathogen P. syringae pv. actinidiae NZ-V13 (PsaNZ-V13) has been reported as a potential MCP for GABA based on isothermal titration calorimetric findings showing that GABA bound the LBD of PscC (McKellar ). However, a chemotaxis assay and virulence test were not performed on Psa. Thus, the chemoreceptors of GABA in plant-pathogenic bacteria have not yet been fully characterized. Since GABA controls multiple aspects of microbe-plant interactions, the identification of GABA chemoreceptors in plant-pathogenic bacteria may provide a more detailed understanding of its physiological relevance in plant-pathogen interactions. Plants synthesize various chemical compounds in response to stress conditions. One of the chemicals produced is GABA, a non-proteinogenic amino acid that is widely distributed in prokaryotic and eukaryotic organisms (Fig. 1A) (Dhakal ; Seifikalhor ). GABA is produced inside plant cells and regulates plant growth (Tarkowski ). It is also a plant defense modulator that plays an important role during environmental stress (Tarkowski ). In plants, GABA is synthesized via the GABA shunt in which glutamate decarboxylase (GAD) converts glutamate into GABA (Michaeli and Fromm, 2015). GABA accumulates, particularly in plant apoplasts, when plants encounter biotic (i.e., pathogen invasion) (Rico and Preston, 2008) or abiotic stress (i.e., mechanical damage) (Mei ). Furthermore, GABA levels have been shown to affect stomatal closure (Mekonnen ).
Fig. 1.

GABA structure (A) and maximum likelihood tree based on ligand-binding domains (LBDs) of amino acid (aa) receptors and their homologs in Pseudomonas species (B). Phylogenetic tree of amino acid sequences of the LBD of McpG and McpA, a GABA and amino acid receptor of Pseudomonas putida KT2440; PctC, a GABA receptor and PctA and PctB, amino acid receptors of Pseudomonas aeruginosa PAO1; CtaABC, amino acid receptors of Pseudomonas fluorescens Pf0-1; PscABC, potential receptors for amino acids and GABA of PsaNZ-V13 and amino acid receptor and its paralogs of PtoDC3000; RS26685, RS12400, and RS06980, predicted GABA and amino acid receptors of Pta6605. Corresponding ligands are indicated by bold letters (aa and GABA). Branch length and bootstrap values are indicated on the tree. The tree was generated using MEGA version X software. Schematic structure of three MCP proteins of Pta6605 (C). Transmembrane domains (TMI and TMII), ligand-binding domains (LBD), istidine kinase, denyl cyclase, ethyl-accepting chemotaxis proteins and hosphatase (HAMP) domains, signaling domains (SD), and the scale of 100 amino acids are indicated.

In Agrobacterium tumefaciens, GABA mediates quorum sensing by stimulating the inactivation of quorum-sensing molecules (Chevrot ). Furthermore, in A. tumefaciens, reductions in GABA concentrations by the introduction of gabT, a gene encoding GABA transaminase, enhanced the transfer efficiency of Ti plasmids to tomato plants (Nonaka ), and elevated GABA levels in transgenic tobacco plants reduced sensitivity to A. tumefaciens infection (Chevrot ). On the other hand, the accumulation of GABA in Pseudomonas protegens appeared to enhance its colonization ability (Takeuchi, 2018). GABA has been found to reduce the ability of PtoDC3000 to infect host plants (Park ; Chatnaparat ; McCraw ). Another study demonstrated that Phaseolus vulgaris accumulated extracellular GABA during incompatible interactions with P. syringae pv. phaseolicola (O’Leary ). Therefore, GABA functions may vary specifically among species; however, it generally serves to mediate inter-kingdom communication in both cases. In the present study, the highly chemotactic Pseudomonas syringae pv. tabaci 6605 (Pta6605), which possesses approximately 50 MCPs, exhibited strong chemotaxis towards GABA and was found to possess a GABA chemoreceptor. As previously reported, chemotaxis is indispensable for Pta6605 virulence (unpublished data). Therefore, we hypothesized that sensing GABA may modulate Pta6605 interactions with its host plant. Using a deletion mutant of the predicted GABA receptors, different virulence assay methods were conducted to investigate the importance of GABA chemotaxis for Pta6605.

Materials and Methods

Bacterial strains and plasmids

Bacterial strains and plasmids are listed in Table 1. Pta6605 strains were grown in King’s B (KB) medium supplemented with 50‍ ‍μg mL–1 nalidixic acid (Nal) at 27°C (King ; Taguchi ). E. coli strains were grown in Luria Bertani (LB) medium supplemented with appropriate antibiotics (50‍ ‍μg mL–1) at 37°C.
Table 1.

Bacterial strains and plasmids used in the present study

Bacterial strain, plasmidRelevant characteristicsReference or source
Escherichia coli
 DH5αFλ ϕ80dLacZ ΔM15 Δ(lacZYA-argF)U169 recA1 endA1 bhsdR17(rK mK+) supE44 thi-1 gyrA relA1Nippon Gene
 S17-1thi pro hsdR hsdR hsdM+ recA(chr::RP4-2-Tc::Mu-Km::Tn7)Schäfer et al., 1994
Pseudomonas syringae pv. tabaci
 Isolate 6605Wild-type isolated from tobacco, NalrIchinose et al., 2020
 6605-ΔRS26685Isolate 6605 ΔPS26685 (ΔmcpG), NalrThis study
 6605-ΔRS06980Isolate 6605 ΔRS06980, NalrThis study
 6605-ΔRS12400Isolate 6605 ΔRS12400, NalrThis study
 6605-ΔmcpG-CpD-mcpG containing ΔmcpG, Nalr KmrThis study
Plasmid
 pGEM-T EasyCloning vector, AmprPromega
 pG-RS26685RS26685 fragment-containing pGEM-TEasy, AmprThis study
 pG-RS06980RS06980 fragment-containing pGEM-TEasy, AmprThis study
 pG-RS12400RS12400 fragment-containing pGEM-TEasy, AmprThis study
 pK18mobsacBSmall mobilizable vector, Kmr, sucrose sensitive (sacB)Schäfer et al., 1994
 pK18-ΔRS26685RS26685 deleted DNA-containing pK18mobsacB, KmrThis study
 pK18-ΔRS06980RS06980 deleted DNA-containing pK18mobsacB, KmrThis study
 pK18-ΔRS12400RS12400 deleted DNA-containing pK18mobsacB, KmrThis study
 pDSK519Broad host range cloning vector, KmrKeen et al., 1988
 pD-mcpGpDSK519 possessing expressible mcpG, KmrThis study

Nalr, nalidixic acid resistant; Ampr, ampicillin resistant; Kmr, kanamycin resistant.

Construction of predicted GABA receptor mutants in Pta6605

Three deletion mutants were generated for the locus tags, A3SK_RS0126685, A3SK_RS0106980, and A3SK_RS0112400 in Pta6605. Since they are not yet annotated, we hereafter use the tentative names RS26685, RS06980, and RS12400, respectively, for each locus tag. Several primer pairs (listed in Table 2) were used to amplify the corresponding regions with surrounding sequences from Pta6605 genomic DNA. The resulting PCR products were inserted into a pGEM T-Easy Vector (Promega), and inverse PCR was performed with appropriate primer pairs to delete each open reading frame of mcp (Fig. S1). Following XbaI digestion and self-ligation, mutated DNA fragments were subcloned into pK18mobsacB via a NotI site (Schäfer ) and transformed into E. coli S17-1 for conjugation and subsequent homologous recombination with Pta6605 wild-type (WT), as previously reported (Ichinose ). Colony PCR of the conjugants was performed using the respective primer pairs for confirmation. Deletion mutants were designated as ΔRS26685 (ΔmcpG), ΔRS06980, and ΔRS12400.
Table 2.

Primer sequences used in the present study

Primer NameSequence (5′-3′)Description
RS26685_1GAGCCCGAAATAACCGAAGAAmplification of RS26685 and the surrounding region
RS26685_2CTGGCAATAAACGCGCTGAT
RS26685_3GCtctagaTGCCGATAAGGGCCTTTAGADeletion of RS26685 ORF
RS26685_4GCtctagaCAAGCCGCTGCCAGAGAA
RS06980_1GTTGCGGCCTTGAAGCTCTAmplification of RS06980 and the surrounding region
RS06980_2CCCACGGATGCAGAATAGAC
RS06980_3GCtctagaAGACAATATTTTGCCGCACCDeletion of RS06980 ORF
RS06980_4GCtctagaCATCCAGTAACAGAGGTCGG
RS12400_1GACGATCTTTGGCAGCGGTAmplification of RS12400 and the surrounding region
RS12400_2GGAACTGTTTGCTGAGATCC
RS12400_3GCtctagaATAGCGGTTACTTCCACGGCDeletion of RS12400 ORF
RS12400_4GCtctagaGATGTACAGGTCCCGATGGG

Lowercase letters indicate the artificial nucleotide sequence for XbaI in RS26685_3, RS26685_4, RS06980_3, RS06980_4, RS12400_3, and RS12400_4.

Complementation of Pta6605 ΔmcpG

To investigate the ability of mcpG to restore the phenotype of ΔmcpG, complementation strains were constructed by introducing the full length of the mcpG gene along with its native promoter in the expression vector pDSK519 (Keen ) at NotI sites. The plasmid constructed was transformed into E. coli S17-1 and introduced into ΔmcpG by conjugation. Conjugants were selected with the Nal- and kanamycin-containing KB plates.

Chemotaxis assays

Quantitative chemotaxis assays were performed using the microtiter plate multi-capillaries method (Reyes-Darias ) with minor modifications. Bacteria were cultured overnight in 3‍ ‍mL LB with 10‍ ‍mM MgCl2, washed, and resuspended in 3‍ ‍mL minimal medium (MM: 50‍ ‍mM potassium phosphate, 7.6‍ ‍mM [NH4]2SO4, 1.7‍ ‍mM MgCl2, and 1.7‍ ‍mM NaCl). One hundred and fifty microliters of the bacterial suspension was then inoculated into 3‍ ‍mL of fresh MM supplemented with 10‍ ‍mM of mannitol and fructose (MMMF) for a further 5-h incubation. Bacterial cells were washed twice and resuspended with 10‍ ‍mM HEPES (pH 7.4) to OD600 of 0.05. Capillary preparation was conducted as follows: one end of a 5-μL capillary (Drummond Scientific Company) was sealed by heating with a flame. The capillary body was dipped into a potential chemoattractant solution or 10‍ ‍mM HEPES buffer as a control. A rubber collar was used to support the capillary during the assay. Two hundred microliters of the bacterial suspension was pipetted into three wells of a round-bottomed Falcon® microtiter plate (Corning). The chemical-filled capillary was dipped into the wells and incubated at 27°C for 30‍ ‍min. After rinsing with sterile distilled water, 5‍ ‍μL of the capillary content was squirted into 45‍ ‍μL of 0.9% NaCl. A series of 10-fold dilutions was performed, and 10‍ ‍μL of the diluted bacterial suspension was plated onto a KB plate with 50‍ ‍μg mL–1 Nal. After a 2-day incubation at 27°C, the number of colonies was counted. A qualitative chemotaxis assay was performed by observing the ability of WT and mutant strains to swim on MM plates supplemented with 1‍ ‍mM of GABA (Wako Pure Chemicals) and 0.25% Bacto agar (Difco). Briefly, overnight bacterial cultures in LB with 10‍ ‍mM MgCl2 were washed and resuspended in liquid MM to OD600 of 0.1. Three microliters of the bacterial suspension was dropped carefully on the center of a freshly made chemotaxis swimming plate. Photographs were taken after the incubation at 23°C for 3 d.

Surface motility assay

Surface motility assays measured swimming and swarming abilities on semi-solid agar plates. Bacteria cultured overnight in 3‍ ‍mL LB with 10‍ ‍mM MgCl2 were washed and resuspended in 10‍ ‍mM MgSO4 to an OD600 of 0.1. Three microliters of the bacterial suspension was spotted onto the center of the plate. Swimming plates (MMMF with 0.25% agar) were incubated at 23°C, while swarming plates (0.5% peptone, 0.3% yeast extract, and 0.45% agar) were incubated at 27°C. Photographs were taken on the 2‍ ‍d for the swarming assay and on the 3‍ ‍d for the swimming assay after the inoculation.

Bacterial growth in vitro

Bacteria were cultured overnight in 3‍ ‍mL KB with 50‍ ‍μg mL–1 Nal, washed with KB or MMMF, and resuspended in the same fresh medium to a starting OD595 of 0.1. Each bacterial suspension was pipetted into a flat-bottomed 96-well microtiter plate and incubated at 27°C with shaking. Bacterial cell density (OD595) was measured using an iMarkTM Microplate Absorbance Reader (Bio-Rad Laboratories) every 2 h to generate growth curves.

Virulence assays and in planta bacterial populations

To thoroughly assess the involvement of McpG in Pta6605 virulence, three plant inoculation assays: flood, dip, and infiltration inoculations, were performed. A flood inoculation method (Ishiga ) was modified for tobacco seedlings. Sterilized tobacco seeds (Nicotiana tabacum L. var. Xanthi NC) were sown on Murashige-Skoog (MS) 0.8% agar plates containing 1% sucrose and vitamin stock solution (thiamin hydrochloride 3‍ ‍mg L–1, nicotinic acid 5‍ ‍mg L–1, and pyridoxine hydrochloride 0.5‍ ‍mg L–1). Sown plates were incubated at 28°C under 16-h light/8-h dark conditions. After 2‍ ‍weeks, 8 seedlings were transplanted to one MS 0.8% agar plate containing 0.1% sucrose and vitamin stock solution and further incubated for 2 d. To prepare the inoculum, bacteria cultured overnight in LB medium with 10‍ ‍mM MgCl2 were washed and adjusted to OD600=0.004 (8×106 colony-forming units [CFU] mL–1) with 10‍ ‍mM MgSO4 (approx. 30‍ ‍mL) and 0.025% (v/v) Silwet L-77 (OSI Specialties). The inoculum was flooded onto the seedlings and swirled to spread it evenly. After decanting the bacterial suspension, the plate was air-dried on a clean bench for 15‍ ‍min. Seedlings on the plates were incubated under 16-h light/8-h dark conditions at 22°C. To count bacterial populations, leaf disks were punched out using a disposable biopsy hole punch and then ground with a mortar and pestle. Leaf disks were collected 3 h post inoculation (hpi), homogenates were mixed with 1‍ ‍mL of sterile water, and 100‍ ‍μL was then spread on KB with Nal plates. After 10-fold serial dilutions 3‍ ‍d post inoculation (dpi), 10‍ ‍μL was dropped on KB with Nal plates. After an incubation at 27°C for 2‍ ‍d, the bacterial population was measured. The dip inoculation method was also performed using detached tobacco leaves (Taguchi and Ichinose, 2011). The inoculum preparation was basically the same as that for the flood inoculation method, except that the inoculum density was adjusted to OD600 of 0.1 (the approximate density of bacteria was 2×108 CFU mL–1) with 0.04% (v/v) Silwet L-77 for this method. In this method, the detached leaves of 8-week-old tobacco plants were dipped into the bacterial suspension for 2‍ ‍min and placed in a tray covered with plastic wrap. Cut petioles were wrapped with water-soaked cotton. The tray was incubated under 16-h light/8-h dark conditions at 22°C for 10 d. The same inoculum preparation was also performed for the infiltration method. Eight-week-old tobacco leaves (attached leaves) were infiltrated by bacterial cells at a density of 2×105 CFU mL–1 using a needleless syringe. Inoculated tobacco plants were incubated in a domed tray at 22°C with a long-day photoperiod (16-h light/8-h dark) for 14 d.

Data analyses

The bacterial population counts of chemotaxis and virulence assays were expressed as means with standard errors. One-way/two-way ANOVA followed by Dunnett’s or Tukey’s highly significant difference tests were performed using GraphPad Prism ver. 8 (GraphPad Software). P<0.05 was considered to be significant.

Results

Pta6605 was predicted to have three GABA receptor homologs

An MCP typically has LBD, transmembrane domains (TMD), a cytoplasmic istidine kinase, denyl cyclase, ethyl-accepting chemotaxis proteins, and hosphatase (HAMP) domain, and SD (Ud-Din and Roujeinikova, 2017). A BLAST search with the LBD of McpG (PP1371), a GABA receptor in P. putida KT2440 (Reyes-Darias ) revealed three GABA chemoreceptor homologs in Pta6605 with 64.9% (RS26685), 59.9% (RS06980), and 59.4% (RS12400) amino acid sequence identities. The amino acid sequences of the LBDs of GABA chemoreceptors in P. aeruginosa PAO1 (PctC and its paralogs PctA and PctB) (Taguchi ) and P. putida KT2440 (McpG) (Reyes-Darias ), amino acid receptors in P. fluorescens Pf0-1 (CtaA, CtaB, and CtaC) (Oku ), amino acid receptors in PsaNZ-V13 (PscA and PscB) (McKellar ), a potential GABA receptor in PsaNZ-V13 (PscC) (McKellar ), amino acid receptors in PtoDC3000 (PscA and its paralogs PscB and PscC) (Cerna-Vargas ), and three suspected GABA receptor homologs in Pta6605 were aligned (Fig. S2) to generate a phylogenetic tree (Fig. 1B). RS12400 was clustered together with the PscA of PtoDC3000 and PsaNZ-V13, and the RS06980 of Pta6605 was clustered together with the PscB of PtoDC3000 and PsaNZ-V13. However, the RS26685 of Pta6605 appeared to cluster separately from the LBDs of other MCPs, suggesting that any of the three MCPs in MCPs may be classified into seven topology types (Ia, Ib, II, IIIm, IIIc, IVa, and IVb) based on the number of TMD, the presence or absence of LBD, and its localization (Ud-Din and Roujeinikova, 2017). Three GABA receptor homologs in Pta6605 belong to type Ia MCP. Type Ia MCPs consist of an N-terminal TMD followed by a periplasmic LBD, a second TMD, HAMP, and a C-terminal cytoplasmic SD (Fig. 1C). We confirmed that all MCPs for GABA and amino acids listed in Fig. 1B belonged to type Ia.

Identification of McpG as a GABA chemoreceptor in Pta6605

Quantitative capillary assays were conducted to investigate how the mutation of each predicted GABA receptor affects Pta6605 chemotaxis to GABA. Quantified results showed significant reductions in ΔRS26685 chemotaxis to 10‍ ‍mM GABA, while ΔRS06980 and ΔRS12400 retained similar chemotaxis to GABA to WT (Fig. 2A). ΔRS26685 did not lose its general chemotaxis ability because ΔRS26685 was attracted to 1% yeast extract, similar to WT, ΔRS06980, and ΔRS12400 (Fig. 2B). These results indicated that RS26685 encodes the chemoreceptor for GABA in Pta6605, and we designated it as McpG.
Fig. 2.

Screening for GABA receptors. Chemotaxis to 10‍ ‍mM GABA (A) and 1% yeast extract (B). Asterisks indicate a significant difference from the WT strain (ns: not significant; *** P<0.001 by a one-way ANOVA followed by Dunnett’s multiple comparisons test). Error bars represent standard errors from 2 independent experiments conducted in triplicate. (C) Surface motility assay of WT and ΔmcpG. A swarming assay on SWM plates with 0.45% agar at 27°C for 2‍ ‍d and a swimming assay on MMMF plates with 0.25% agar at 23°C for 3 d. The photographs show representative results obtained from three independent experiments with two replicates.

ΔmcpG swims and swarms on soft agar at the WT level

The surface motilities of WT and ΔmcpG (ΔRS26685) were examined using low-agar-concentration plates. ΔmcpG exhibited the same swimming and swarming abilities as WT ( to respond to GABA was not due to a lack of motility.

ΔmcpG chemotaxis to GABA with different concentration and complementation tests

We investigated the chemotaxis of both WT and ΔmcpG to different concentrations of GABA. While WT responded to GABA in a dose-dependent manner, ΔmcpG showed significant reductions at all concentrations (Fig. 3A). Complementation by the introduction of full-length mcpG with its native promoter into ΔmcpG restored chemotaxis to GABA (Fig. 3B). We also qualitatively investigated ΔmcpG chemotaxis using 0.25% agar MM supplemented with 1‍ ‍mM GABA. ΔmcpG was unable to expand its growth from its inoculation point 2 or even 3 dpi, while its complemented and WT strains expanded at similar levels (Fig. 3C).
Fig. 3.

Chemotaxis assays. (A) Quantitative chemotaxis assay of WT and ΔmcpG towards different GABA concentrations. (B) Chemotaxis of ΔmcpG and its complementation strain (ΔmcpG-C) to 10‍ ‍mM GABA. Asterisks indicate significant differences from the WT strain (** P<0.01 by a one-way ANOVA followed by Dunnett’s Multiple Comparisons Test). Error bars represent standard errors from 2 independent experiments conducted in triplicate. (C) Qualitative chemotaxis plate assay on 0.25% agar minimal media supplemented with 1‍ ‍mM of GABA 2 and 3 dpi at 23°C. The photographs show representative results from three independent experiments with 2 plates each.

McpG is the specific chemoreceptor for GABA

We tested the chemotaxis ability of WT and ΔmcpG to 20 proteinogenic amino acids, butyric acid, and succinic semialdehyde (SSA), which share similar structures to GABA. Quantitative chemotaxis assay results demonstrated that Pta6605 was attracted to most proteinogenic amino acids, except for tyrosine. Pta6605 was also attracted to SSA, but not to butyric acid (Fig. 4). Furthermore, no significant differences were observed in chemotactic ability between WT and ΔmcpG to all amino acids and SSA. These results indicate that the McpG of Pta6605 is a specific chemoreceptor for GABA.
Fig. 4.

Quantitative chemotaxis assay to assess McpG specificity. (A) Chemotactic responses to 20 proteinogenic amino acids (1‍ ‍mM) and (B) chemotactic responses to GABA, butyric acid, and SSA (1‍ ‍mM). Error bars represent standard errors from 2 independent experiments conducted in triplicate.

Growth characteristics of ΔmcpG

The growth characteristics of WT and ΔmcpG were assessed to clarify whether mutations affect their growth and to confirm that the lack of chemotaxis in ΔmcpG was not due to a growth defect. Growth experiments were conducted in KB (nutrient rich) and MMMF liquid medium (Fig. S3A), and in MM supplemented with GABA as a sole source of carbon and nitrogen (Fig. S3B). The growth of ΔmcpG in KB and MMMF liquid medium was not significantly different from that of WT. In MM supplemented with GABA, although the growth of ΔmcpG appeared to be slower than that of WT, the difference was not significant at any time points, indicating that the phenotypic difference between them was not due to a growth defect.

ΔmcpG had reduced virulence on host tobacco plants

Plant inoculation assays were performed to elucidate how McpG-mediated chemotaxis affects Pta6605 virulence in host tobacco plants. Virulence was initially tested using the flood inoculation assay method. The photographs in Fig. 5A clearly show that ΔmcpG-inoculated seedlings still survived 7 dpi, but were smaller than those with the mock treatment. On the other hand, the complemented strain restored full virulence. We also counted bacterial populations inside the leaves. The number of bacteria recovered from ΔmcpG-inoculated leaves was significantly lower at both 3 hpi and 3 dpi (Fig. 5B), indicating that GABA sensing was required for the early stage of virulence in Pta6605.
Fig. 5.

Inoculation experiments by the flood inoculation method. (A) Tobacco seedlings were inoculated by flooding 8×106 CFU mL–1 of the bacterial suspension of each strain followed by an incubation at 22°C. Photographs taken 3 and 7 dpi show representative results from three independent experiments. (B) The bacterial population was counted 3 hpi and 3 dpi. Bars represent standard errors from two independent experiments. Bacterial CFUs for each strain in one experiment were pooled from 3 (3 hpi) or 4 (3 dpi) individuals. Asterisks indicate significant differences from the WT strain (* P<0.05; *** P<0.001 by a two-way ANOVA followed by Dunnett’s multiple comparisons test).

A second virulence test was performed using the dip inoculation method with cut leaves. ΔmcpG caused milder disease symptoms than the WT strain (Fig. 6A), indicating that McpG is also required for the development of disease symptoms in the dip inoculation method. The virulence of WT and ΔmcpG was also investigated by directly infiltrating bacterial cells into 5-week-old tobacco leaves. An area of the ΔmcpG-infiltrated leaf showed disease symptom progression, although it was not as robust as WT (Fig. 6B). However, the complemented strain caused more extensive symptoms than ΔmcpG.
Fig. 6.

Inoculation test of WT and ΔmcpG strains by dip and infiltration methods. (A) Tobacco leaves were inoculated by dipping into 2×108 CFU mL–1 of the bacterial suspension of each strain followed by an incubation at 22°C. Photographs taken 5 and 10 dpi show representative results from three independent experiments. (B) Tobacco leaves were infiltrated by 2×105 CFU mL–1 of each strain and incubated at 22°C. Photographs taken 14 dpi show representative results from two independent experiments.

Discussion

RS26685 (McpG) was identified as a GABA chemoreceptor in Pta6605 based on the results of the quantitative chemotaxis assay (Fig. 2 and 3AB) and qualitative swimming plate assay (Fig. 3C). Normal chemotaxis to 1% yeast extract (Fig. 2B), surface motility (Fig. 2C), and growth speed (Fig. S3) proved that its lost ability to sense GABA was not due to impaired motility or a growth defect. Therefore, the reduction in the virulence of the ΔmcpG mutant was principally due to the loss of GABA chemotaxis. PscC is a potential GABA receptor of PsaNZ-V13; however, it has not yet been confirmed with a quantitative chemotaxis assay, and its requirement in the infection process remains unknown (McKellar ). This present study is the first to demonstrate that GABA chemotaxis is required for infections by phytopathogens. The identification of a GABA chemoreceptor in the plant pathogen Pta6605 widened the relevance of GABA chemotaxis, not only for attraction to neurotransmitters by the animal pathogen P. aeruginosa PAO1 and root colonization in non-pathogenic P. putida KT2440 (Reyes-Darias ). Some GABA chemoreceptors recognize multiple amino acids. For example, the PctC of P. aeruginosa recognizes GABA, L-Pro, and L-His (Rico-Jiménez ), and the PscC of Psa binds GABA, L-Pro, and L-Ile (McKellar ). The McpG of P. putida is a specific GABA receptor (Reyes-Darias ). The McpG of Pta6605 also specifically mediates chemotaxis to GABA, similar to the McpG of P. putida KT2440, because the ΔmcpG mutant of Pta6605 strain was still attracted to 19 amino acids and SSA (Fig. 4). The presence of specific GABA receptors suggests the importance of GABA chemotaxis for Pta6605 infection. The plant-pathogenic bacterium Pta6605 apparently possesses three paralogs of McpG, RS26685, RS06980, and RS12400, among approximately 50 MCPs. They may have a similar function to the PctA, PctB, and PctC of PAO1, PsaA, PsaB, and PsaC of PsaNZ-V13, and CtaA, CtaB, and CtaC of P. fluorescens Pf0-1 (Kato ; Oku ; Rico-Jiménez ; McKellar ), further suggesting that Pta6605 responds to environmental signals, such as GABA and amino acids. Regarding the other two paralogs, both phylogenetic trees constructed from LBDs (Fig. 1B) and SDs (Fig. S4) suggested that RS06980 and RS12400 are MCPs involved in amino acid sensing based on close similarities to the amino acid chemoreceptors, McpA in P. putida KT2440 (Corral-Lugo ), Psc paralogs in PsaNZ-V13 and PtoDC3000 (McKellar ; Cerna-Vargas ), and Cta paralogs in P. fluorescens Pf0-1 (Oku ). However, the phylogenetic tree based on the sequence similarity of LBD suggests that the ability to sense GABA is not really reflected in the general sequence similarities of LBDs, thereby proving that the characterization of responsible chemoreceptors did not solely depend on sequences clustering from one or two strains of bacteria (Fig. 1B). Further studies are needed to clarify the functions of both chemoreceptor proteins. Bacteria often exhibit chemotaxis to molecules that they may utilize as growth substrates. The majority of chemical compounds that bacteria are attracted to are carbon or nitrogen sources, such as amino acids, sugars, organic acids, hydrocarbons, and oxygen (Sampedro ). Previous findings obtained on the fungal pathogen in tomato, Cladosporium fulvum (Solomon and Oliver, 2002), animal pathogen P. aeruginosa (Rico-Jiménez ), and saprophytic plant root-colonizing bacterium, P. putida (Reyes-Darias ) further support the concept that GABA is of physiological relevance in host-microbe interactions. Plant-related compounds are known to regulate virulence factors in addition to the attractants of chemotaxis (Leonard ). GABA is produced in plants infected by bacterial pathogens (Deeken ) and secreted to the apoplast and outer environment (Mei ). The Pta6605 GABA-sensing mutant, ΔmcpG, was shown to be significantly less virulent in host tobacco by the flood inoculation method (Fig. 5) and dip inoculation method using detached leaves (Fig. 6A). These results revealed the necessity of GABA chemotaxis in the early stage of infection when bacterial cells arrive on the leaf surface. Furthermore, ΔmcpG was less virulent than WT even with infiltration using a needleless syringe (Fig. 6B). This result suggests the involvement of GABA not only in early, but also in late infection stages because the virulence of ΔmcpG that entered plant apoplastic spaces by infiltration independent of chemotaxis was also reduced. GABA perception by Pta6605 via McpG may be required not only for chemotaxis, but also for the expression of virulence genes. Similarly, the pscA mutant of PtoDC3000 also impaired not only chemotaxis to L-Asp, L-‍Glu, and D-Asp, but also the regulation of some pathogenicity-related traits, such as biofilm formation, swarming motility, and the amount of c-di-GMP (Cerna-Vargas ). Therefore, some MPCs, including the McpG of Pta6605 and PscA in PtoDC3000, act as both chemoreceptors and regulators of pathogenicity. Since GABA is widely distributed, its physiological relevance as a signaling compound appears to be high. The accumulation of intracellular and extracellular GABA in plants is induced by biotic and abiotic stresses, such as nutrient depletion, mechanical wounding, pathogen infection, and a lack of oxygen (Allan ; Reyes-Darias ; Mei ; Seifikalhor ). Furthermore, the expression level of type III secretion system (T3SS) genes in plant pathogenic bacteria is higher in planta, indicating that the presence of plant-derived signals is required for the expression of T3SS genes and full virulence (Rahme ; Tang ). Therefore, it is plausible for a plant pathogen, such as Pta6605, to have a specific chemoreceptor for GABA for fitness in host plant infection. The restored ability of GABA sensing and virulence in the complemented strain on tobacco plants further demonstrated the significance of McpG for Pta6605. Consistent with the present results, previously studied plant pathogenic bacteria have exhibited chemotaxis abilities to various plant-related compounds (Matilla and Krell, 2018). Adding to the current theory, GABA plays a significant role in plant-microbe communication, either symbiotic or parasitic.

Citation

Tumewu, S. A., Matsui, H., Yamamoto, M., Noutoshi, Y., Toyoda, K., and Ichinose, Y. (2020) Requirement of γ-Aminobutyric Acid Chemotaxis for Virulence of Pseudomonas syringae pv. tabaci 6605. Microbes Environ 35: ME20114. https://doi.org/10.1264/jsme2.ME20114 Supplementary Material
  49 in total

1.  Two simple media for the demonstration of pyocyanin and fluorescin.

Authors:  E O KING; M K WARD; D E RANEY
Journal:  J Lab Clin Med       Date:  1954-08

2.  Identification of the mcpA and mcpM genes, encoding methyl-accepting proteins involved in amino acid and l-malate chemotaxis, and involvement of McpM-mediated chemotaxis in plant infection by Ralstonia pseudosolanacearum (formerly Ralstonia solanacearum phylotypes I and III).

Authors:  Akiko Hida; Shota Oku; Takeru Kawasaki; Yutaka Nakashimada; Takahisa Tajima; Junichi Kato
Journal:  Appl Environ Microbiol       Date:  2015-08-14       Impact factor: 4.792

3.  Role of type IV pili in virulence of Pseudomonas syringae pv. tabaci 6605: correlation of motility, multidrug resistance, and HR-inducing activity on a nonhost plant.

Authors:  Fumiko Taguchi; Yuki Ichinose
Journal:  Mol Plant Microbe Interact       Date:  2011-09       Impact factor: 4.171

Review 4.  Bacterial chemoreceptors and chemoeffectors.

Authors:  Shuangyu Bi; Luhua Lai
Journal:  Cell Mol Life Sci       Date:  2014-11-06       Impact factor: 9.261

5.  Identification of a chemoreceptor for tricarboxylic acid cycle intermediates: differential chemotactic response towards receptor ligands.

Authors:  Jesús Lacal; Carlos Alfonso; Xianxian Liu; Rebecca E Parales; Bertrand Morel; Francisco Conejero-Lara; Germán Rivas; Estrella Duque; Juan L Ramos; Tino Krell
Journal:  J Biol Chem       Date:  2010-05-24       Impact factor: 5.157

6.  GABA, A Primary Metabolite Controlled by the Gac/Rsm Regulatory Pathway, Favors a Planktonic Over a Biofilm Lifestyle in Pseudomonas protegens CHA0.

Authors:  Kasumi Takeuchi
Journal:  Mol Plant Microbe Interact       Date:  2017-11-30       Impact factor: 4.171

7.  Arabidopsis seedling flood-inoculation technique: a rapid and reliable assay for studying plant-bacterial interactions.

Authors:  Yasuhiro Ishiga; Takako Ishiga; Srinivasa R Uppalapati; Kirankumar S Mysore
Journal:  Plant Methods       Date:  2011-10-06       Impact factor: 4.993

8.  Early changes in apoplast composition associated with defence and disease in interactions between Phaseolus vulgaris and the halo blight pathogen Pseudomonas syringae Pv. phaseolicola.

Authors:  Brendan M O'Leary; Helen C Neale; Christoph-Martin Geilfus; Robert W Jackson; Dawn L Arnold; Gail M Preston
Journal:  Plant Cell Environ       Date:  2016-07-25       Impact factor: 7.228

9.  Chemoperception of Specific Amino Acids Controls Phytopathogenicity in Pseudomonas syringae pv. tomato.

Authors:  Jean Paul Cerna-Vargas; Saray Santamaría-Hernando; Miguel A Matilla; José Juan Rodríguez-Herva; Abdelali Daddaoua; Pablo Rodríguez-Palenzuela; Tino Krell; Emilia López-Solanilla
Journal:  mBio       Date:  2019-10-01       Impact factor: 7.867

10.  Identification of a Chemoreceptor in Pseudomonas aeruginosa That Specifically Mediates Chemotaxis Toward α-Ketoglutarate.

Authors:  David Martín-Mora; Alvaro Ortega; José A Reyes-Darias; Vanina García; Diana López-Farfán; Miguel A Matilla; Tino Krell
Journal:  Front Microbiol       Date:  2016-11-29       Impact factor: 5.640

View more
  2 in total

1.  Identification of Aerotaxis Receptor Proteins Involved in Host Plant Infection by Pseudomonas syringae pv. tabaci 6605.

Authors:  Stephany Angelia Tumewu; Yuta Watanabe; Hidenori Matsui; Mikihiro Yamamoto; Yoshiteru Noutoshi; Kazuhiro Toyoda; Yuki Ichinose
Journal:  Microbes Environ       Date:  2022       Impact factor: 2.912

2.  Pseudomonas syringae pv. tomato infection of tomato plants is mediated by GABA and l-Pro chemoperception.

Authors:  Saray Santamaría-Hernando; Álvaro López-Maroto; Clara Galvez-Roldán; Martí Munar-Palmer; Elizabet Monteagudo-Cascales; José-Juan Rodríguez-Herva; Tino Krell; Emilia López-Solanilla
Journal:  Mol Plant Pathol       Date:  2022-06-10       Impact factor: 5.520

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.