Jaiwei Xu1,2, Haifang Zhao2, Tao Wang2,3. 1. College of Biological Sciences, China Agricultural University, China. 2. National Institute of Biological Sciences, China. 3. Tsinghua Institute of Multidisciplinary Biomedical Research, Tsinghua University, China.
Abstract
Mutations in the gene rhodopsin are one of the major causes of autosomal dominant retinitis pigmentosa (adRP). Mutant forms of Rhodopsin frequently accumulate in the endoplasmic reticulum (ER), cause ER stress, and trigger photoreceptor cell degeneration. Here, we performed a genome-wide screen to identify suppressors of retinal degeneration in a Drosophila model of adRP, carrying a point mutation in the major rhodopsin, Rh1 (Rh1G69D). We identified two novel E3 ubiquitin ligases SORDD1 and SORDD2 that effectively suppressed Rh1G69D-induced photoreceptor dysfunction and retinal degeneration. SORDD1/2 promoted the ubiquitination and degradation of Rh1G69D through VCP (valosin containing protein) and independent of processes reliant on the HRD1 (HMG-CoA reductase degradation protein 1)/HRD3 complex. We further demonstrate that SORDD1/2 and HRD1 function in parallel and in a redundant fashion to maintain rhodopsin homeostasis and integrity of photoreceptor cells. These findings identify a new ER-associated protein degradation (ERAD) pathway and suggest that facilitating SORDD1/2 function may be a therapeutic strategy to treat adRP.
Mutations in the gene rhodopsin are one of the major causes of autosomal dominant retinitis pigmentosa (adRP). Mutant forms of Rhodopsin frequently accumulate in the endoplasmic reticulum (ER), cause ERstress, and trigger photoreceptor cell degeneration. Here, we performed a genome-wide screen to identify suppressors of retinal degeneration in a Drosophila model of adRP, carrying a point mutation in the major rhodopsin, Rh1 (Rh1G69D). We identified two novel E3 ubiquitin ligases SORDD1 and SORDD2 that effectively suppressed Rh1G69D-induced photoreceptor dysfunction and retinal degeneration. SORDD1/2 promoted the ubiquitination and degradation of Rh1G69D through VCP (valosin containing protein) and independent of processes reliant on the HRD1 (HMG-CoA reductase degradation protein 1)/HRD3 complex. We further demonstrate that SORDD1/2 and HRD1 function in parallel and in a redundant fashion to maintain rhodopsin homeostasis and integrity of photoreceptor cells. These findings identify a new ER-associated protein degradation (ERAD) pathway and suggest that facilitating SORDD1/2 function may be a therapeutic strategy to treat adRP.
Misfolded membrane proteins, including G protein-coupled receptors (GPCRs), are often retained in the endoplasmic reticulum (ER) and an overabundance of ER-retained proteins is associated with many diseases. Rhodopsin is a GPCR and dominant mutations in the rhodopsin gene (Rho) are observed in 20–30% of all forms of autosomal dominant retinitis pigmentosa (adRP), the most common form of retinal degeneration [1-3]. Most biochemically-characterized Rho mutants associated with adRP are likely misfolded and accumulate in the ER of photoreceptor neurons [4]. Indeed, the Rho mutation most commonly associated with adRP is a proline to histidine mutation at position 23 (RhoP23H), which leads to Rho retention within the ER. This in turn leads to ERstress, activation of the unfolded protein response (UPR), and ultimately photoreceptor degeneration [2, 5–8]. This is seen in both humanpatients and animal models of the disease.In most cases, misfolded rhodopsins are inherently unstable and undergo ER-associated protein degradation (ERAD), a process by which substrates are recognized, ubiquitinated by E3 ligases, retro-translocated into the cytosol, and sent to proteasomes for degradation [8-11]. The UPR induces ERAD to promote the degradation of misfolded rhodopsin and to protect photoreceptor cells against ERstress signals [12-14]. Although it has been proposed that ERAD may disrupt Rho homeostasis earlier in development and contribute to retinal degeneration [15], studies in both Drosophila and mouse models suggest that increasing degradation of misfolded rhodopsin through ERAD and the proteasome is protective. Further, decreased efficiency of ERAD/proteasome function leads to the aggregation of rhodopsin and photoreceptor death [16-19]The E3 ubiquitin-protein ligase HRD1 (HMG-CoA reductase degradation protein 1) plays a central role in ERAD of membrane proteins (ERAD-M) such as rhodopsin. In a fly model of adRP, a glycine is mutated to an aspartate at position 69 within Rh1, the major rhodopsin in flies, which is encoded by the ninaE locus (ninaE) [20, 21]. Importantly, overexpression of HRD1 reduces Rh1G69D-induced ERstress and alleviates photoreceptor cell loss [19]. Despite the key role played by HRD1 in maintaining rhodopsin homeostasis, flies lacking HRD1 have normal rhodopsin and photoreceptor cell function [16], suggesting that another E3 ubiquitin ligase may help maintain rhodopsin homeostasis.Here we screened for additional genes that reduce Rh1G69D-induced photoreceptor cell degeneration, and identified two E3 ubiquitin ligases, SORRD1 and SORRD2, that strongly suppress retinal degeneration in Rh1G69D-expressing flies. We demonstrate that SORRD1/2 ubiquitinates misfolded Rh1 and promotes degradation of these proteins through valosin containing protein (VCP) and the proteasome, and that this process is completely independent of HRD1. Moreover, although null mutations in either sordd1/2 or hrd1 do not lead to photoreceptor cell dysfunction, animals in which both sordd1/2 and hrd1 are mutated exhibit severe retinal degeneration. Overall, this work identifies an important role for the previously uncharacterized E3 ubiquitin ligases, SORRD1 and SORRD2, in ERAD of misfolded rhodopsin and maintenance of rhodopsin homeostasis, independent of HRD1.
Results
SORDD1 and SORDD2 are new suppressors of Rh1G69D
To find factors other than HRD1 that limit retinal degeneration in adRP, we performed a gain-of-function screen using a Drosophila model in which Rh1G69D was ectopically overexpressed using the GMR-Gal4 system (GMR>Rh1) (Fig 1A–1D and S1A–S1B Fig). Overexpression of HRD1, the major E3 ubiquitin ligase of the ERAD pathway, ameliorated the glossy eye phenotype of GMR>Rh1 flies and restored ommatidia structures (based on SEM analysis), suggesting the viability of this genetic screen (Fig 1D and 1E, S1B, S1C and S1K Fig and S1 Data).
Fig 1
SORDD1 and SORDD2 suppress Rh1G69D-induced retinal degeneration.
(a) The genetic screen used to identify suppressors of Rh1G69D-induced retinal degeneration. The representative strategy of screening for UAS-cDNAs inserted on the 3rd chromosome is shown. (b-m) Light photomicrographs show the adult eye morphology of (b) GMR-gal4/+, (c) GMR-Gal4>GFP (GMR-Gal4/+;UAS-GFP/+) (d) GMR>Rh1 (GMR-Gal4 UAS-Rh1/+), (e) GMR>Rh1+hrd1 (GMR-Gal4 UAS-Rh-1/+;UAS-hrd1/+), (f) GMR>Rh1+sordd1 (GMR-Gal4 UAS-Rh-1/+;UAS-sordd1/+), (g) GMR>Rh1+sordd2 (GMR-Gal4 UAS-Rh-1/+;UAS-sordd2/+), (h) GMR>Rh1+GFP (GMR-Gal4 UAS-Rh-1/+;UAS-GFP/+), (i) GMR>Rh1+CG8141 (GMR-Gal4 UAS-Rh-1/+;UAS-CG8141/+), (j) GMR>Rh1+ CG32847 (GMR-Gal4 UAS-Rh-1/+;UAS-CG32847/+), (k) GMR>Rh1+SYVN1 (GMR-Gal4 UAS-Rh-1/+;UAS-SYVN1/+), (l) GMR>Rh1+RNF5 (GMR-Gal4 UAS-Rh-1/+;UAS-RNF5/+) and (m) GMR>Rh1+RNF185 (GMR-Gal4 UAS-Rh-1/+;GMR-RNF185/+). Scale bar, 100 μm.
SORDD1 and SORDD2 suppress Rh1G69D-induced retinal degeneration.
(a) The genetic screen used to identify suppressors of Rh1G69D-induced retinal degeneration. The representative strategy of screening for UAS-cDNAs inserted on the 3rd chromosome is shown. (b-m) Light photomicrographs show the adult eye morphology of (b) GMR-gal4/+, (c) GMR-Gal4>GFP (GMR-Gal4/+;UAS-GFP/+) (d) GMR>Rh1 (GMR-Gal4 UAS-Rh1/+), (e) GMR>Rh1+hrd1 (GMR-Gal4 UAS-Rh-1/+;UAS-hrd1/+), (f) GMR>Rh1+sordd1 (GMR-Gal4 UAS-Rh-1/+;UAS-sordd1/+), (g) GMR>Rh1+sordd2 (GMR-Gal4 UAS-Rh-1/+;UAS-sordd2/+), (h) GMR>Rh1+GFP (GMR-Gal4 UAS-Rh-1/+;UAS-GFP/+), (i) GMR>Rh1+CG8141 (GMR-Gal4 UAS-Rh-1/+;UAS-CG8141/+), (j) GMR>Rh1+ CG32847 (GMR-Gal4 UAS-Rh-1/+;UAS-CG32847/+), (k) GMR>Rh1+SYVN1 (GMR-Gal4 UAS-Rh-1/+;UAS-SYVN1/+), (l) GMR>Rh1+RNF5 (GMR-Gal4 UAS-Rh-1/+;UAS-RNF5/+) and (m) GMR>Rh1+RNF185 (GMR-Gal4 UAS-Rh-1/+;GMR-RNF185/+). Scale bar, 100 μm.We screened ~3,000 UAS-cDNA libraries from FlyORF [22] and EP collections, and identified three genes that strongly suppressed Rh1G69D -induced retinal degeneration. These were smg5 (UAS-Smg5.ORF), CG8974 (P[EP]CG8974), and CG32581 (P[EPgy2]EY20019). Since Smg5 may affect the stability of rh1 mRNA, we focused on CG8974 and CG32581, which each encode RING-domain E3 ubiquitin ligases. We verified that CG8974 and CG32581 could each suppress Rh1G69D-induced retinal degeneration by repeating the experiment using UAS-CG8974 or UAS-CG32581 overexpression lines (Fig 1H–1G, S1D, S1E and S1K Fig). We therefore named these proteins SORDD1 (Suppression Of Retinal Degeneration Disease 1 upon overexpression) and SORDD2, respectively. SORDD1 and SORDD2 share 92% protein sequence identity. RNA-sequencing and qPCR results indicated that while sordd1 is expressed ubiquitously, sordd2 is not expressed under normal conditions (S2B Fig, S2 Data). The sordd1 and sordd2 gene loci share 95% sequence identity and are adjacent in the genome (S2A Fig). This suggests that sordd2 may have resulted from gene duplication, and therefore may serve a largely, if not entirely, redundant role.Phylogenetic analysis indicated that sordd1 and sordd2, as well as the genes CG8141 and CG32847, each encode E3 ligases that contain both a RING-finger motif and a transmembrane domain [23]. We overexpressed CG8141 or CG32847 in the GMR>Rh1 retina, but they failed to prevent Rh1G69D-induced retinal degeneration, indicating a specific function for SORDD1/2 in degrading misfolded Rh1G69D (Fig 1I and 1J, S1F,S1G and S1K Fig, S1 Data). Moreover, the human homologs of SORDD1/2 or HRD1 (namely RNF5, RNF185, or SYVN1, respectively) each suppressed retinal cell degeneration in GMR>Rh1 flies, indicating conservation of function for these E3 ligases (Fig 1K–1M and S1H–S1K Fig).Previous studies reported that HRD1 can also recognize misfolded versions of wild-type Rh1, which are expressed in larval eye imaginal discs and earlier pupa eyes before the expression of chaperons for Rh1, and suppresses ERstress caused by this earlier expression of wild-type Rh1 [19]. We also found that SORDD1 and SORDD2 reduced retinal cell degeneration induced by the expression of wild-type Rh1 in larval eye imaginal discs (S2E Fig). Moreover, we expressed Rh1P37H (the equivalent of mammalian RhoP23H –the most common genetic mutation associated with ADRP) in larval eye imaginal discs using GMR-Gal4/UAS-rh1 and found that SORDD1 and SORDD2 largely suppressed Rh1P37H-mediated retinal damage [24] (S2E Fig). These results suggest that SORDD1/2 and HRD1 recognize the folding state of Rh1 rather than specific alterations/mutations in the Rh1 protein sequence.
The E3 ubiquitin ligases SORDD1/2 promote the degradation of Rh1G69D
Overexpression SORDD1/2 associate with the membrane fraction of S2 cells and colocalize with the ER protein Calnexin (S2C and S2D Fig). Moreover, RNF185, the human homolog of SORDD1/2 was found to be an ER resident E3 ligase and function in the degradation of transmembrane proteins in ER, suggesting that SORDD1/2 may be directly involved in degrading misfolded Rh1G69D in ER [25, 26]. To test this, we expressed a Myc-tagged version of Rh1G69D in the eye (GMR>Rh1-Myc), and found that overexpression of SORDD1 or SORDD2 could lower the level of Rh1G69D protein in both eye imaginal discs and pupa eyes (Fig 2A–2D, S3 Data and S4 Data). Accumulation of Rh1G69D induced ERstress and activated the UPR, as both Xbp1-EGFP and ATF4-mCherry, two independent UPR reporters, were activated in eye imaginal discs of GMR>Rh1 animals [19, 27]. However, Rh1G69D failed to activate Xbp1-EGFP and ATF4-mCherry when SORDD1 or SORDD2, but not CG8141, was overexpressed (Fig 2A and 2B and S3 Data). Thus, like HRD1, SORDD1/2 facilitates the degradation of misfolded Rh1G69D, suppressing Rh1G69D-induced ERstress and retinal degeneration.
Fig 2
The E3 ubiquitin ligases SORDD1/2 reduce the UPR by promoting the degradation of Rh1G69D.
(a) Fluorescence images of eye imaginal discs. The ER stress markers, Xbp1-EGFP and ATF4-mCherry (control, GMR-gla4 UAS-Xbp1 ATF4-mCherry/+), were induced by the expression of Rh1G69D–Myc (Rh1–Myc, GMR-gal4 UAS-Xbp1 ATF4-mCherry UAS-Rh1–Myc/+). Expressing SORDD1 (Rh1–Myc+sordd1, GMR-gla4 UAS-Xbp1 ATF4-mCherry UAS-Rh1–Myc/+;UAS-sordd1/+) or SORDD2 (Rh1–Myc+sordd2, GMR-gla4 UAS-Xbp1 ATF4-mCherry UAS-Rh1–Myc/+;UAS-sordd2/+) reduced Rh1G69D–Myc levels as well as Xbp1-EGFP and ATF4-mCherry signals. In contrast, expressing CG8141 (Rh1–Myc+CG8141, GMR-gla4 UAS-Xbp1 ATF4-mCherry UAS-Rh1–Myc/+;UAS-CG8141/+) did not affect levels of Rh1G69D–Myc, Xbp1-EGFP, or ATF4-mCherry. The Rh1G69D–Myc epitope is labeled white; spliced Xbp1-GFP is labeled green; mCherry under control of the ATF4 promoter/5’ UTR is labeled red. Scale bar, 50 μm. (b) Quantification of relative fluorescence from a; error bars indicate SEM (n = 4); ns, not significant; ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). (c) Western blot analysis shows the level of Rh1G69D–Myc is reduced by expressing SORDD1 and SORDD2 in pupa eyes. Note Rh1G69D can form a dimer. (d) Quantification of b, error bars indicate SEM; n = 3, **p<0.01, ***p<0.001 (one-way ANOVA, Sidak's multiple comparisons test). (e) E3 ubiquitin ligase activity of SORDD1, SORDD2 and HRD1 is essential for suppression of Rh1G69D induced cell degeneration. SORDD1 (sordd1), SORDD2 (sordd2) and HRD1 (hrd1) are inactivated by mutating the conserved Cys on the active site of the RING domain to Ser. Scale bar, 100 μm. (f) Ubiquitination of Rh1G69D by SORDD1 in vivo. Head lysate of Rh1–Myc (GMR-gla4 UAS-Rh1–Myc/rpn12) flies co-expressing SORDD1 (GMR-gla4 UAS-Rh1–Myc/rpn12;UAS-sordd1/+) or SORDD1C165S (GMR-gla4 UAS-Rh1–Myc/rpn12;UAS-sordd1/+) were immunoprecipitated with anti-Myc antibody, and stained against Myc (left) or ubiquitin (right). The proteasomal degradation of Rh1G69D was inhibited by knocking down the proteasome component Rpn12 (rpn12) [54]. (g) Quantification of relative ubiquitination levels of Rh1G69D–Myc from f, error bars indicate SEM; n = 3, ns, not significant, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test).
The E3 ubiquitin ligases SORDD1/2 reduce the UPR by promoting the degradation of Rh1G69D.
(a) Fluorescence images of eye imaginal discs. The ERstress markers, Xbp1-EGFP and ATF4-mCherry (control, GMR-gla4 UAS-Xbp1ATF4-mCherry/+), were induced by the expression of Rh1G69D–Myc (Rh1–Myc, GMR-gal4 UAS-Xbp1ATF4-mCherry UAS-Rh1–Myc/+). Expressing SORDD1 (Rh1–Myc+sordd1, GMR-gla4 UAS-Xbp1ATF4-mCherry UAS-Rh1–Myc/+;UAS-sordd1/+) or SORDD2 (Rh1–Myc+sordd2, GMR-gla4 UAS-Xbp1ATF4-mCherry UAS-Rh1–Myc/+;UAS-sordd2/+) reduced Rh1G69D–Myc levels as well as Xbp1-EGFP and ATF4-mCherry signals. In contrast, expressing CG8141 (Rh1–Myc+CG8141, GMR-gla4 UAS-Xbp1ATF4-mCherry UAS-Rh1–Myc/+;UAS-CG8141/+) did not affect levels of Rh1G69D–Myc, Xbp1-EGFP, or ATF4-mCherry. The Rh1G69D–Myc epitope is labeled white; spliced Xbp1-GFP is labeled green; mCherry under control of the ATF4 promoter/5’ UTR is labeled red. Scale bar, 50 μm. (b) Quantification of relative fluorescence from a; error bars indicate SEM (n = 4); ns, not significant; ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). (c) Western blot analysis shows the level of Rh1G69D–Myc is reduced by expressing SORDD1 and SORDD2 in pupa eyes. Note Rh1G69D can form a dimer. (d) Quantification of b, error bars indicate SEM; n = 3, **p<0.01, ***p<0.001 (one-way ANOVA, Sidak's multiple comparisons test). (e) E3 ubiquitin ligase activity of SORDD1, SORDD2 and HRD1 is essential for suppression of Rh1G69D induced cell degeneration. SORDD1 (sordd1), SORDD2 (sordd2) and HRD1 (hrd1) are inactivated by mutating the conserved Cys on the active site of the RING domain to Ser. Scale bar, 100 μm. (f) Ubiquitination of Rh1G69D by SORDD1 in vivo. Head lysate of Rh1–Myc (GMR-gla4 UAS-Rh1–Myc/rpn12) flies co-expressing SORDD1 (GMR-gla4 UAS-Rh1–Myc/rpn12;UAS-sordd1/+) or SORDD1C165S (GMR-gla4 UAS-Rh1–Myc/rpn12;UAS-sordd1/+) were immunoprecipitated with anti-Myc antibody, and stained against Myc (left) or ubiquitin (right). The proteasomal degradation of Rh1G69D was inhibited by knocking down the proteasome component Rpn12 (rpn12) [54]. (g) Quantification of relative ubiquitination levels of Rh1G69D–Myc from f, error bars indicate SEM; n = 3, ns, not significant, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test).Phylogenetic analysis indicated that SORDD1 and SORDD2 belong to conserved RING-finger motifs and transmembrane regions E3 ligase family, we then introduced a single mutation into the conserved RING finger domain, changing Cys-165 to Ser to potentially block enzymatic activity (SORDD1C165S and SORDD2C165S) (S2A Fig). As a positive control, we also mutated hrd1 (hrd1). As expected, SORDD1C165S, SORDD2C165S, and Hrd1C327S did not suppress Rh1G69D-induced retinal degeneration (Fig 2E). We then mutated all the potential ubiquitylated sites (cytosol and luminallysine residues) within Rh1G69D to generate a ubiquitylation-resistant form (Rh1G69D+KR). Eye damage was more severe in Rh1G69D+KR flies compared to Rh1G69D (S3A Fig). Importantly, overexpression of SORDD1/2 or HRD1 did not fully rescue Rh1G69D+KR-induced cell damage (S3A Fig). The partial rescue effect might be due to the three lysine residues remaining within the transmembrane domain of Rh1G69D+KR which could also be ubiquitylated by SORDD1/2.We next examined if Rh1G69D is the direct substrate of SORDD1 by immunoprecipitation of Rh1G69D-Myc. We found that the expression of SORDD1 but not SORDD1C165S significantly increased levels of ubiquitinated Rh1G69D-Myc (Fig 2F and 2G and S5 Data). Taking together, these data indicate that SORDD1/2 function as E3 ubiquitin ligases to ubiquitylate Rh1G69D
in vivo.
VCP and the proteasome but not the HRD1 complex are required for SORDD1-mediated degradation of Rh1G69D
To identify factors that function upstream or downstream of SORDD1/2, we conducted a genome-wide RNAi screen for lines that abolished the suppressive effects of SORDD1 on Rh1G69D-induced retinal degeneration. We expressed ~7,000 RNAi lines in flies that co-expressed SORDD1 and Rh1G69D and found 7 RNAi lines that reduced the effect of SORDD1 on Rh1G69D-induced retinal degeneration, but did not cause eye damage when knocked down alone (Fig 3A and Table 1).
Fig 3
Degradation of Rh1G69D by SORDD1 is dependent on VCP and proteasome, not dependent on the HRD1 complex.
(a) Schematic diagram of the genome-wide RNAi screen for modifiers of SORDD1-mediated Rh1G69D degradation. (b) Light photomicrographs show the adult eye was damaged when ufd1 (GMR>Rh1
sordd1 ufd1: GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-ufd1/+), ter94 (GMR>Rh1
sordd1 ter94: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-ter94/+ and GMR>Rh1
sordd1 ter94: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-ter94/+) and rpn12 (GMR>Rh1
sordd1 rpn12: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-rpn12/+) were knocked down by shRNA in GMR>Rh1
sordd1 background. Expressing ufd1 (GMR>ufd1: GMR-Gal4 /+;UAS-ufd1/+), ter94 (GMR>ter94: GMR-Gal4 /+;UAS-ter94/+) and rpn12 (GMR>rpn12: GMR-Gal4 /+;UAS-rpn12/+) alone have no obvious phenotype. Scale bar, 100 μm. (c) Mutations in hrd1 or hrd3 had no effect on eye morphology of GMR>Rh1, sordd1 flies, both under light microscopy (top) and transmission electron microscopy (bottom). Homozygous null mutants of hrd1 or hrd3 were generated using “ey-flp/hid” system. Genotypes: GMR>Rh1
sordd1 hrd1 (GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-hrd1/+), GMR>Rh1
sordd1;hrd1/hrd1(ey-flp;GMR-Gal4 UAS-Rh1
UAS-sordd1/+; FRT82B hrd1/FRT82B GMR-hid CL B), GMR>Rh1
sordd1 hrd3 (GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-hrd3/+) and GMR>Rh1
sordd1;hrd3/hrd3(ey-flp;GMR-Gal4 UAS-Rh1
UAS-sordd1/+;FRT82B hrd3
/FRT82B GMR-hid CL). LM scale bar, 100 μm, TEM scale bar, 2 μm. (d) Quantification of rhabdomere numbers per ommatidia in c; error bars indicate SEM; sections from three flies of each genotype were used for quantification; ns, not significant (one-way ANOVA, Sidak's multiple comparisons test).
Table 1
List of genes identified in RNAi screen for factors required for SORDD1’s function.
Stock NO.
Gene name
CG NO.
GO annotations
THU4245
ufd1
CG6233
Ubiquitin ligase binding
THU3262
ter94
CG2331
ATPase activity
THU3613
rpn12
CG4157
Ubiquitin-dependent protein degradation
THU2721
prsosα1
CG18495
Endopeptidase activity
TH03187.N
tsf1
CG6186
Metal ion binding
TH04520.N
CG9962
CG9962
Protein serine/threonine kinase activity
THU0769
amalgam
CG2198
-
Degradation of Rh1G69D by SORDD1 is dependent on VCP and proteasome, not dependent on the HRD1 complex.
(a) Schematic diagram of the genome-wide RNAi screen for modifiers of SORDD1-mediated Rh1G69D degradation. (b) Light photomicrographs show the adult eye was damaged when ufd1 (GMR>Rh1
sordd1 ufd1: GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-ufd1/+), ter94 (GMR>Rh1
sordd1 ter94: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-ter94/+ and GMR>Rh1
sordd1 ter94: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-ter94/+) and rpn12 (GMR>Rh1
sordd1 rpn12: GMR-Gal4 UAS-Rh1
UAS-sordd1/+;UAS-rpn12/+) were knocked down by shRNA in GMR>Rh1
sordd1 background. Expressing ufd1 (GMR>ufd1: GMR-Gal4 /+;UAS-ufd1/+), ter94 (GMR>ter94: GMR-Gal4 /+;UAS-ter94/+) and rpn12 (GMR>rpn12: GMR-Gal4 /+;UAS-rpn12/+) alone have no obvious phenotype. Scale bar, 100 μm. (c) Mutations in hrd1 or hrd3 had no effect on eye morphology of GMR>Rh1, sordd1 flies, both under light microscopy (top) and transmission electron microscopy (bottom). Homozygous null mutants of hrd1 or hrd3 were generated using “ey-flp/hid” system. Genotypes: GMR>Rh1
sordd1 hrd1 (GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-hrd1/+), GMR>Rh1
sordd1;hrd1/hrd1(ey-flp;GMR-Gal4 UAS-Rh1
UAS-sordd1/+; FRT82B hrd1/FRT82B GMR-hid CL B), GMR>Rh1
sordd1 hrd3 (GMR-Gal4 UAS-Rh-1
UAS-sordd1/+;UAS-hrd3/+) and GMR>Rh1
sordd1;hrd3/hrd3(ey-flp;GMR-Gal4 UAS-Rh1
UAS-sordd1/+;FRT82B hrd3
/FRT82B GMR-hid CL). LM scale bar, 100 μm, TEM scale bar, 2 μm. (d) Quantification of rhabdomere numbers per ommatidia in c; error bars indicate SEM; sections from three flies of each genotype were used for quantification; ns, not significant (one-way ANOVA, Sidak's multiple comparisons test).Knocking-down the proteasome component Rpn12, or the VCP components TER94/VCP or UFD1 (Ubiquitin Fusion-Degradation 1), which are required to extract substrate from the ER into the cytosol, caused eye damage in GMR>Rh1
sordd1 flies, but did not cause eye damage when knocked down alone (Fig 3B). Moreover, disruption of both VCP and the proteasome increased Rh1G69D protein levels in GMR>Rh1, sordd1 retinae (S3B and S3C Fig and S6 Data). Based on these results, we conclude that SORDD1-mediated degradation of Rh1G69D is dependent on the VCP/proteasome system.Degrading misfolded ER membrane proteins, which is called ERAD-M, requires proteins to be retro-translocated into the cytosol and subsequently poly-ubiquitinated [28]. HRD1, in addition to functioning as an E3 ubiquitin ligase, also complexes with the ERluminal protein HRD3 to form a retro-translocation channel for the movement and degradation of misfolded ER proteins. [29, 30]. However, knocking down hrd1 or hrd3 did not affect the eyes of GMR>Rh1
sordd1 flies, raising the possibility that SORDD1/2-dependent ERAD does not rely on retro-translocation of substrates by the HRD1/3 complex (Fig 3C). To confirm the dispensable role of the HRD1/3 complex in SORDD1-mediated protein degradation, we used the “ey-flp/hid” system to generated flies with eyes that were homozygous mutant for either hrd1 or hrd3 [16]. SORDD1 continued to suppress Rh1G69D-induced retinal degeneration in the absence of HRD1 or HRD3 (Fig 3C and 3D and S7 Data). Taken together, we conclude that SORDD1-mediated Rh1G69D degradation depends on VCP and the proteasome, but is independent of the HRD1/3 complex.
SORDD1/2 and Hrd1 function redundantly in promoting Rh1G69D degradation
Since the E3 ligases SORDD1/2 and HRD1 could independently reduce levels of Rh1G69D and mitigate associated cell damage when overexpressed, we next asked whether endogenous SORDD1 or Hrd1 are involved in degrading Rh1G69D. We expressed GFP-tagged Rh1G69D under its own promoter (ninaE, neither inactivation nor afterpotential E), and generated a deletion mutation that lacked both the sordd1 and sordd2 genes (sordd1/2) using the CRISPR/Cas9 system (S4 Fig). Homozygous sordd1/2 mutants were viable and levels of Rh1G69D were not altered in sordd1/2 or hrd1 flies. However, Rh1G69D protein accumulated in animals that lacked both sordd1/2 and hrd1 (Fig 4A and 4B and S8 Data), suggesting that SORDD1/2 and HRD1 function in two parallel ERAD pathways to degrade Rh1G69D.
Fig 4
SORDD1/2 and Hrd1 function redundantly in promoting Rh1G69D degradation.
(a) Western blot shows Rh1G69D-GFP accumulation in sordd1/2; hrd1 double mutants (ey-flp sordd1/2;FRT82B ninaE-Rh1-GFP hrd1/FRT82B GMR-hid CL), compared to sordd1/2 (sordd1/2;ninaE-Rh1-GFP) and hrd1 (ey-flp;FRT82B ninaE-Rh1-GFP hrd1/FRT82B GMR-hid CL) mutant alone. Rh1G69D-GFP is driven by an endogenous ninaE promoter. The higher molecular weight of Rh1G69D aggregates could be seen at the top of the lanes. (b) Quantification of a, error bars indicate SEM; n = 3, ns, not significant, ****p<0.0001 (ANOVA, Sidak's multiple comparisons test). (c) Quantification of the percentage of the deep pseudopupil in control (ey-flp;FRT82B), sordd1/2, hrd1 (ey-flp;FRT82B hrd1/FRT82B GMR-hid CL) and sordd1/2;hrd1 (ey-flp sordd1/2;FRT82B hrd1/FRT82B GMR-hid CL) flies at 0, 5, 10, 15 and 20 days old. At least ~100 flies in 3 groups were measured for each genotype. Error bars indicate SEM. (d) TEM images of 1-day-old and 20-day-old adult eye tangential sections. Genotypes are as indicated on the left side of the panels. R, rhabdomere. Scale bar, 2 μm. The sordd1/2;hrd1 double mutant flies show severe degeneration of photoreceptor cells at age of 20 days. All flies are in white eye background, and raised under 12 h light /12 h dark cycles. (e) Western blot analysis of Rh1, TRP, and INAD in control, sordd1/2, hrd1, and sordd1/2;hrd1 flies at 3 days old. (f) Quantification of relative protein levels of Rh1, TRP, and INAD in e; error bars indicate SEM (n = 3); ***p<0.001 (one-way ANOVA, Sidak's multiple comparisons test). (g) Proposed model of SORDD1/2 in the degradation of misfolded Rh1G69D parallel to HRD1 complex.
SORDD1/2 and Hrd1 function redundantly in promoting Rh1G69D degradation.
(a) Western blot shows Rh1G69D-GFP accumulation in sordd1/2; hrd1 double mutants (ey-flp sordd1/2;FRT82B ninaE-Rh1-GFP hrd1/FRT82B GMR-hid CL), compared to sordd1/2 (sordd1/2;ninaE-Rh1-GFP) and hrd1 (ey-flp;FRT82B ninaE-Rh1-GFP hrd1/FRT82B GMR-hid CL) mutant alone. Rh1G69D-GFP is driven by an endogenous ninaE promoter. The higher molecular weight of Rh1G69D aggregates could be seen at the top of the lanes. (b) Quantification of a, error bars indicate SEM; n = 3, ns, not significant, ****p<0.0001 (ANOVA, Sidak's multiple comparisons test). (c) Quantification of the percentage of the deep pseudopupil in control (ey-flp;FRT82B), sordd1/2, hrd1 (ey-flp;FRT82B hrd1/FRT82B GMR-hid CL) and sordd1/2;hrd1 (ey-flp sordd1/2;FRT82B hrd1/FRT82B GMR-hid CL) flies at 0, 5, 10, 15 and 20 days old. At least ~100 flies in 3 groups were measured for each genotype. Error bars indicate SEM. (d) TEM images of 1-day-old and 20-day-old adult eye tangential sections. Genotypes are as indicated on the left side of the panels. R, rhabdomere. Scale bar, 2 μm. The sordd1/2;hrd1 double mutant flies show severe degeneration of photoreceptor cells at age of 20 days. All flies are in white eye background, and raised under 12 h light /12 h dark cycles. (e) Western blot analysis of Rh1, TRP, and INAD in control, sordd1/2, hrd1, and sordd1/2;hrd1 flies at 3 days old. (f) Quantification of relative protein levels of Rh1, TRP, and INAD in e; error bars indicate SEM (n = 3); ***p<0.001 (one-way ANOVA, Sidak's multiple comparisons test). (g) Proposed model of SORDD1/2 in the degradation of misfolded Rh1G69D parallel to HRD1 complex.To further explore the physiological roles of SORDD1/2 and HRD1 in maintaining photoreceptor cell homeostasis, we examined photoreceptor cell integrity in sordd1/2 and hrd1 mutants that expressed wild-type rhodopsin. We first used deep pseudopupil analysis, which reflects the compact structure of photoreceptor cells, assess levels or retinal degeneration [31]. Animals lacking sordd1/2 or hrd1 had normal retinal cytoarchitecture across a broad range of ages, whereas double mutants lacking both sordd1/2 and hrd1 exhibited a gradual loss of the deep pseudopupil, indicating age-dependent retinal degeneration (Fig 4C and S9 Data).The rhabdomere is a microvilli structure that is functionally equivalent to the mammalian rod and cone outer segments. In wild-type ommatidia, all seven photoreceptor cells have intact rhabdomeres. To assay the detailed ultrastructure of photoreceptors in sordd1/2 and hrd1 mutants we used transmission electronic microscopy (TEM) (Fig 4D). Consistent with the pseudopupil analysis, both sordd1/2 and hrd1 mutant flies contained intact rhabdomeres and photoreceptor cells at 20 days of age, whereas 20-day-old sordd1/2;hrd1 flies exhibited severe retinal degeneration with prominent vacuoles and obvious loss of rhabdomeres and photoreceptors. To verify that age-dependent retinal degeneration in sordd1/2;hrd1 mutants results from the disruption of Rh1 homeostasis, we examined levels of Rh1 protein as well as levels of other phototransduction-related proteins such as TRP and INAD. In 3-day-old flies, both TRP and INAD levels were unaffected in sordd1/2, hrd1 and sordd1/2;hrd1 flies (compared with controls), indicating no retinal degeneration. However, Rh1 levels were significantly reduced in sordd1/2;hrd1 mutants, suggesting that disruption of Rh1 homeostasis may lead to age-dependent retinal degeneration in flies lacking both SORDD1/2 and HRD1(Fig 4E, 4F and S10 Data). These results demonstrate that SORDD1/2 and HRD1 play redundant roles in maintaining rhodopsin homeostasis in photoreceptor cells, and that loss of both can lead to retinal degeneration.
SORDD1 strongly suppresses retinal degeneration in the ninaE model of adRP
To validate that SORDD1/2 is a bona fide suppressor of adRP, we used a classic model in which the dominant ninaE mutation leads to age-dependent retinal degeneration [20, 21]. The ninaE heterozygous flies (ninaE/+) exhibit severe loss of rhabdomeres and photoreceptor cells ~25 days after eclosion (Fig 5A, 5B, 5E and S11 Data). Expression of Hrd1 (ninaE/GMR-hrd1) in these eyes improved photoreceptor cell survival (Fig 5C–5E), and expression of SORDD1 (ninaE/GMR-sordd1) completely rescued the phenotype (Fig 5D and 5E).
Fig 5
SORDD1 strongly suppresses retinal degeneration in the ninaE model of adRP.
(a-d) Representative TEM images of 25-day-old adult eye tangential sections of (a) wild type (canton S), (b) ninaE/+, (c) ninaE/GMR-hrd1 and (d) ninaE/GMR-sordd1 flies. Rhabdomeres are indicated by red arrows. Scale bar, 5 μm. (e) Quantification of a-d, Error bars indicate SEM; sections from three individual flies of each genotype were used for quantification. ns, not significant, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). (f) ERG recordings of 25-day-old and 32-day-old wild-type, ninaE/+, ninaE/GMR-hrd1 and ninaE/GMR-sordd1 flies. Flies were exposed to a 5-s pulse of orange light after 1 min of dark adaptation. (g) Statistic results of the amplitude of ERG recordings of flies at age of 25 days, Error bars indicate SEM; n = 6, *p<0.1, ***p<0.001, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). Red-eyed flies were raised under constant light conditions. All flies were in w background and were raised in 24 h constant light (~700 Lux) at 25°C.
SORDD1 strongly suppresses retinal degeneration in the ninaE model of adRP.
(a-d) Representative TEM images of 25-day-old adult eye tangential sections of (a) wild type (canton S), (b) ninaE/+, (c) ninaE/GMR-hrd1 and (d) ninaE/GMR-sordd1 flies. Rhabdomeres are indicated by red arrows. Scale bar, 5 μm. (e) Quantification of a-d, Error bars indicate SEM; sections from three individual flies of each genotype were used for quantification. ns, not significant, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). (f) ERG recordings of 25-day-old and 32-day-old wild-type, ninaE/+, ninaE/GMR-hrd1 and ninaE/GMR-sordd1 flies. Flies were exposed to a 5-s pulse of orange light after 1 min of dark adaptation. (g) Statistic results of the amplitude of ERG recordings of flies at age of 25 days, Error bars indicate SEM; n = 6, *p<0.1, ***p<0.001, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test). Red-eyed flies were raised under constant light conditions. All flies were in w background and were raised in 24 h constant light (~700 Lux) at 25°C.We examined the function of these photoreceptor neurons using an electroretinogram (ERG) assay, which is an extracellular recording that measures the summed light responses of photoreceptor cells. The ERG exhibits two primary features: a rapid corneal negative response, reflecting phototransduction; and on- and off-transients, which reflect synaptic transmission from photoreceptor cells [32]. Twenty-five-day-old ninaE/+ flies exhibited small ERG response amplitudes and a complete loss of transients, suggesting disruption of several neural functions (Fig 5F and 5G and S12 Data). Consistent with the results obtained via TEM, GMR-hrd1; ninaE/+ flies showed significant increased ERG amplitude at the age of 25 days relative to ninaE/+ flies, and expression of SORDD1 fully restored the ERG amplitude and on/off transients, indicating a complete rescue of photoreceptor function (Fig 5F and 5G and S12 Data). Furthermore, at 32 days, while ninaE flies had no ERG response, ERG responses and transients were detected in ninaE/GMR-sordd1 flies (Fig 5F).
Discussion
This work suggests a new ERAD-M pathway that depends on the E3 ubiquitin ligase SORDD1/2 (Fig 4G). Misfolded membrane proteins such as Rh1G69D may be ubiquitinated by two independent ER enzymes, HRD1 and SORDD1/2. The ubiquitylated protein is then transported out of the ER membrane via the VCP complex and degradation in cytosolic proteasomes. Although HRD1 also functions (in complex with HRD3) as a retro-translocation channel to facilitate removal of substrates from the ER [29, 30], HRD1 and HRD3 are dispensable for SORDD1-mediated degradation of Rh1G69D; thus, SORDD1 suppresses Rh1G69D-induced ERstress and cell damage independent of HRD1 and HRD3. Although we demonstrated that VCP complex components are essential for SORDD1-mediated degradation of Rh1G69D, we did not identify a candidate retro-translocation channel. One possibility is that Rh1G69D ubiquitinated by SORDD1 is removed directly from the ER membrane by the VCP complex without channels due to the plasticity of the ER membrane [33]. Alternatively, key translocation channels, such as Sec61, may serve dual functional roles and be essential for cell viability [34].Disrupting rhodopsin homeostasis–the most abundant protein in photoreceptors–induces severe stress and frequently results in the degeneration of photoreceptor neurons [35]. Degradation of misfolded rhodopsin via ERAD is one of several mechanisms that maintains rhodopsin homeostasis and normal photoreceptor function and viability. Despite HRD1 serving as a key E3 ligase in ERAD, null hrd1 mutants exhibit normal rhodopsin levels and light responses [16, 19]. One possibility is that, in addition to being degraded by ERAD, misfolded rhodopsin might also be targeted by autophagy pathways [36, 37]. However, recent reports argue against a complementary function of autophagy in degrading misfolded rhodopsin–inhibiting autophagy reduced retinal degeneration in Rho mice by promoting proteasomal degradation of misfolded mutant rhodopsin [17, 18, 38].Here we present data suggesting that SORDD1/2 functions in a similar, and independent, manner to degrade mutant Rh1G69D. While knocking out either hrd1 or sordd1/2 did not prevent the degradation of Rh1G69D protein, Rh1G69D accumulated in photoreceptors that lacked both E3 ubiquitin ligases. Moreover, flies lacking both hrd1 and sordd1/2 exhibit severe retinal degeneration, whereas photoreceptor cells remain intact in flies lacking either hrd1 or sordd1/2. Therefore, SORDD1 functions redundantly with HRD1 in ERAD of misfolded rhodopsin, thereby helping to maintain rhodopsin homeostasis. Two redundant ERAD pathways might be beneficial for the maximum clearance of misfolded rhodopsin and to maintain photoreceptor cell function.Because increasing the efficiency of protein folding in the ER by expressing BiP prevents retinal degeneration in RhoP23H models, chemical chaperones capable of reducing Rho misfolding are promising therapeutic interventions [5, 39–41]. However, the escape of mutant forms of rhodopsin from the ER might contribute to defects in the morphogenesis of rod photoreceptor cell outer segments [42]. Recently, it was shown that increasing proteasome-mediated degradation of misfolded rhodopsin protects against adRP [17, 18, 38]. However, induction of proteasomal activity might be problematic, since it impairs general cellular proteostasis. In a fly model of adRP, inhibition of VCP or the proteasome alleviated retinal degeneration caused by Rh1P37H, despite the fact the clearance of misfolded RH1P37H was disrupted [24]. This might be because inhibition of the VCP or the proteasome may suppress a cell death pathway that acts downstream of misfolded rhodopsin. Indeed, VCP is required for autophagy flux, and blocking autophagy suppresses retinal degeneration in Rho mice [38, 43, 44]. In flies co-expressing SORDD1 and Rh1G69D, disruption of VCP or the proteasome dramatically blocked SORDD1-accelerated degradation of Rh1G69D, thus reversing the suppression of Rh1G69D-induced eye damage by SORDD1. Given that E3 ubiquitin ligases are the rate-limiting step of ERAD, inducing ERAD by overexpression of HRD1 effectively reduces levels of misfolded Rh1G69D protein and suppresses retinal degeneration in this fly model of adRP. This raises the possibility that key ERAD components may be a promising therapeutic target for treating adRP. However, because ERAD regulates the turn-over of a variety of very important proteins [40, 45, 46], hrd1 mutations are lethal, as is the widespread overexpression of HRD1 (e.g., via the tubulin or actin promoter).Unlike HRD1, flies that lack both sordd1 and sordd2, or flies that express both SORDD1 and SORDD2 ubiquitously, do not exhibit obvious defects, suggesting that SORDD1 is more specific to misfolded proteins. Moreover, overexpression of SORDD1 efficiently degraded Rh1G69D and, therefore, better suppressed retinal degeneration and restored light response than HRD1. Furthermore, ERAD of misfolded proteins via SORDD1 is likely conserved in mammals, as RNF5 and RNF185 also suppressed Rh1G69D-induced retinal degeneration. Indeed, both E3 ligases have been implicated in ERAD of a misfolded version of the cystic fibrosis transmembrane conductance regulator, CFTRΔF508, which is associated with cystic fibrosis [25, 47]. However, unlike SORDD1, which suppressed Rh1G69D–associated retinal degeneration, genetic and pharmacological inhibition of RNF5 in vivo attenuates intestinal pathological phenotypes in a mouse model of cystic fibrosis without blocking degradation of CFTRΔF508 [48, 49]. This might be because RNF5 and RNF185 function redundantly to degrade CFTRΔF508 [25]. Moreover, RNF185 has recently been shown to target ER membrane proteins, including CYP51A1 and TMUB2 [26]. Since SORDD1 is ubiquitously expressed, it might also be involved in the degradation and turnover of a subset of membrane proteins. All the evidence strongly suggests that SORDD1 and its human homologs play roles in the quality control of membrane proteins. Overall, these data suggest that the facilitation of SORDD1-dependent ERAD of misfolded rhodopsin is a promising treatment for adRP.
Materials and methods
Fly stocks
UAS–xbp1–EGFP and UAS–hrd1 have been reported previously [19, 50]. The flyORF collection and EP collection for screening suppressors of Rh1G69D induced cell degeneration were obtained from the Zurich ORFeome Project (https://www.flyorf.ch) and Bloomington Drosophila Stock Center (https://bdsc.indiana.edu), respectively. The hrd3 mutant flies (P[RS3]hrd3) and ninaE flies were obtained from Bloomington Drosophila Stock Center. The transgenic RNAi lines for the in vivo RNAi screen were obtained from TsingHua Fly Center (http://fly.redbux.cn). The RNAi lines used in this work are as follows: P[TRiP. GL01251]attP2 (ufd1), P[TRiP. JF03402]attP2 (ter94), P[GD9777]v24354(ter94)P[TRiP. HMS01032]attP2 (rpn12), P[TRiP. JF02711]attP2 (prosα1), P[TRiP. HMS00297]attP2 (ama). The hrd1
FRT82B/TM3 flies was reported previously [16]. The ey-flp; FRT82B GMR-hid CL/TM3 flies were maintained in the laboratory of T. Wang. All flies were maintained under 12 h light /12 h dark cycles at 25°C unless mentioned.
Generation of transgenic flies
The cDNA sequences of Rh1, sordd1, sordd2, hrd1 and CG32847 were amplified from RH01460, GH14055, RE35552, GH11117 and FI06431 of DGRC gold cDNA collections, respectively (Drosophila Genomics Resource Center). cDNA of CG8141 was amplified from the RT-PCR products of w flies. The cDNA sequences of human genes HsSYVN1, HsRNF5 and HsRNF185 were amplified from ORF Clones IOH21699, IOH3743 and IOH14506 obtained from Thermo Fisher Scientific. These cDNA sequences were then subcloned into the pUAST-attB or GMR-attB vectors. Rh1 was mutated from the ninaE cDNA and subcloned into the pninaE-attB vector with a c-terminal GFP-tag. The constructs were injected into M(vas-int.Dm)ZH-2A;M(3xP3-RFP.attP)ZH-86Fb or M(vas-int.Dm)ZH-2A;M(3xP3-RFP.attP)ZH-51C embryos, and transformants were identified based on eye color. The 3XP3-RFP markers were eliminated by crossing to a Cre-expressing line.To generate UAS-Rh1 or UAS-Rh1-Myc flies, the Rh1 cDNA was subcloned to pUAST vector with or without Myc tag, and the constructs were injected into w embryos and transformants with random insertions were identified based on eye color. The 2nd chromosome insertions with weak Rh1 expressing were used for experiments.To generated the ATF4-mCherry reporter flies, the genomic DNA sequence with endogenous ATF4 promoter sequence (−906 bp upstream of the transcription starting site) and complete 5’UTR including starting ATG (1102 bp from the transcription starting site to the translation starting ATG) were fused with mCherry cDNA and replaced the UAS sequence of the pUAST-attB vector. The ATF4-mCherry constructs were injected into embryos of M(vas-int.Dm)ZH-2A;M(3xP3-RFP.attP)ZH-51C and M(vas-int.Dm)ZH-2A;M(3xP3-RFP.attP)ZH-86Fb, and transformants with eye colors were crossed with a Cre-expressing line to remove 3XP3-RFP and mini-white markers.
Generation of sordd1 and sordd2 knockout flies (sordd1/2)
The sordd1/2 mutations were generated by the Cas9/sgRNA system [51]. Two recognition sequences of guiding RNA to the sordd1 and sordd2 locus were designed (sgRNA1: 5′-GAGCGTGGACTTTGGTCCGG-3′; sgRNA2: 5′-AATACGAAAACAGCTTGGAC -3′) and cloned into the U6b-sgRNA-short vector. The plasmids were injected into the embryos of nos-Cas9 flies. The successful sordd1/2 deletion mutants (sordd1/2) were identified screened by PCR with a product of ~800 bp using a pair of primers (5′-GAAAACATCCTCTAGTTCGC-3′ and 5′- ATCAATCGAGGACTGATCACTGAT-3′) (S4B Fig). The transcription of sordd1 and sordd2 was completely absent in sordd1/2 mutants by RT-PCR using a pair of primers (5′-ATGGAGGAACCGAAAAGTGTAC-3′ and 5′- CTATGCATAGAACAGCCACAAT-3′) (S4C Fig).
RNA extraction and quantitative real-time PCR analysis
Larvae or adult flies were dissected to obtain the different tissues and tissue-specific RNA was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer’s protocol. Total RNA was reverse-transcribed using PrimeScript RT-PCR kit (Takara). qRT-PCR was performed using SYBR Premix Ex Taq (Takara) on a CFX96 real time PCR detection system (Bio-Rad). The average threshold cycle value (CT) was calculated from at least three replicates per sample. Expression of sordd1 and sordd2 was standardized relative to rp49.Relative expression values were determined by the △△CT method. Primers:sordd1-f: CTAATCGGGGAACAAGGCAATACG, sordd1-r: CTATGCATAGAACAGCCACAATAT;sordd2-f: ATATTAGAAGGCTACACGAAGATG, sordd2-r: TTATCGGGATGATCCGTGCACTAT;rp49-f: CAGTCGGATCGATATGCTAAGCTG, rp49-r: TAACCGATGTTGGGCATCAGATAC
Immunofluorescence staining
Third instar larva imaginal eye discs were dissected and fixed in PBS with 4% paraformaldehyde (Sigma) for 1h at room temperature, followed by incubation with primary antibodies including mouse anti-Myc (1:200; Santa Cruz), rabbit anti–GFP (1:200; Invitrogen), rat anti–RFP antibody (1:200; Chromotek) overnight at 4°C. Then incubated samples were washed in PBST (0.3% Triton X-100) buffer 5 times. Finally, samples were incubated with Alexa Fluor 488–conjugated, Alexa Fluor 568–conjugated, Alexa Fluor 647–conjugated secondary antibodies (1:500; Invitrogen), and 20 nM DAPI (Invitrogen) for 1 h at room temperature. Fluorescence images were acquired at room temperature with an A1 confocal laser scanning microscope (Nikon) using a 20x objective (Plan Fluor NA 1.30; Nikon) and an A1+ camera (Nikon).To examine the cellular localization of SORDD1, S2 cells were seeded onto coverslips coated with concanavalin A and transformed with Myc-tagged SORDD1 plasmid. After 36 h of transformation, the cells were fixed using 4% paraformaldehyde in PBS for 0.5 h, followed by incubation with primary antibodies including mouse anti-Myc (1:200; Santa Cruz) and anti-Calnexin (1:100; Developmental Studies Hybridoma Bank) for 1.5 h at room temperature. Samples were incubated with Alexa Fluor 488–conjugated, Alexa Fluor 568–conjugated secondary antibodies (1:500; Invitrogen) with 20 nM DAPI (Invitrogen) for 1 h at room temperature. Fluorescence images were acquired at room temperature with an A1 confocal laser scanning microscope (Nikon) using a 60x objective.
Fractionation assay
Fractionation assays were performed with a Membrane and Cytosol Protein Extraction Kit (Beyotime Biotechnology) according to the manufacturer’s protocol. Briefly, S2 cells were grown in 6 cm dishes and transformed with Myc-tagged SORDD1 plasmid. After 48 h of transformation, the cells were harvested and lysed with Buffer A, followed by centrifugation at 14,000g for 30 min at 4°C. The supernatant (S) was collected, and the pellet was lysed again by Buffer B, followed by centrifugation at 14,000g for 5 min at 4°C to collect the pellet (P). S and P fractions were analyzed by western blot.
Immunoprecipitation and western blots
Mashed fly heads were lysed with 10 mM Tris-HCl lysis buffer (pH 7.4, 150 mM NaCl, 0.5 mM EDTA, 0.5% NP-40 with 1× proteinase inhibitor cocktail [Roche]) for 30 min, and centrifuged at 16,100 g. The supernatant was used for subsequent immunoprecipitation with anti-Myc beads (Chromotek). Beads were washed in TBS buffer with NP-40 (10 mM Tris–Cl (pH7.4), 150 mM NaCl, 0.5 mM EDTA, and 50 nM NP-40 with 1× proteinase inhibitor cocktail) three times, and boiled in SDS loading buffer for standard western blot assays.For western blot assays, dissected pupa eyes or adult fly heads were homogenized in SDS loading buffer for SDS-PAGE. The blots were probed with primary antibodies against Myc (rabbit, 1:1000; Santa Cruz), mouse anti-β-actin (1:2000; Santa Cruz), mouse anti-ubiquitin (1:1000; Santa Cruz), rabbit anti-GFP (1:2000; Origene), followed by incubation with IRDye 680 goat anti-mouse IgG (1:10000, LI-COR Biosciences) and IRDye 800 goat anti-rabbit IgG (1:10000, LI-COR Biosciences). Signals were detected using an Odyssey infrared imaging system (LI-COR Biosciences).
Scanning electron microscopy
Dissected adult fly eyes were fixed in 2.5% glutaraldehyde at 4°C overnight followed by incubation in 1% osmium tetroxide for 1 h at room temperature. Samples were dehydrated in a series of ethanol dilutions (20, 35, 50, 70, and 100% ethanol), and substituted by liquid carbon dioxide. After the liquid carbon dioxide gasified, samples were scanned using a ZEISS EVOL LS10 scanning electron microscope at room temperature. The number of ommatidia in the middle 3 rows in each sample was counted to assess the damage degree, and images from 5 flies were used for quantification.
Transmission electron microscopy
TEM was performed with standard methods as described [52]. Dissected adult fly eyes were fixed in 4% paraformaldehyde and 2.5% glutaraldehyde at 4°C overnight followed by incubation in 1% osmium tetroxide for 1 h at room temperature. Then samples were dehydrated in a series of ethanol dilutions (20, 35, 50, 70, 80, 90, and 100% ethanol) and embedded in LR White resin (Polysciences, Inc.). Thin sections (80 nm) were stained with 0.06% uranyl acetate and 0.1% lead citrate (Sigma, St. Louis, MO) and examined using a JEM-1400 transmission electron microscope (JEOL) at room temperature. The images were acquired using a Gatan camera (model 794; Gatan, Inc.).
Electroretinogram recordings
Electroretinogram (ERG) recordings were performed as described [53]. Microelectrodes filled with Ringer’s solution were placed onto the surface of the compound eye and the thorax of a fixed fly. A Newport light projector (model 765) was used for stimulation. After 1 min of dark adaptation, red-eyed flies were exposed to a 5-s pulse of ~2000 lux orange light (source light was filtered using a FSR-OG550 filter, Newport). ERG signals were amplified with a Warner electrometer IE-210 and recorded with a MacLab/4 s analogue-to-digital converter and the clampelx10.2 program (Warner Instruments, Hamden, USA). All the flies used in ERG assay were raised under constant white light of ~700 Lux at 25°C.
Statistics
Statistical results were generated by GraphPad Prism 8 and statistical significance was assessed through Ordinary one-way ANOVA, Sidak's multiple comparisons test analyses. All error bars represent S.E.M.(a-j) Scanning electron microscopy images show eye morphology of (a) control (GMR-gal4/+), (b) GMR>Rh1, (c) GMR>Rh1+hrd1, (d) GMR>Rh1+sordd1, (e) GMR>Rh1+sordd2, (f) GMR>Rh1+CG8141, (g) GMR>Rh1+ CG32847, (h) GMR>Rh1+SYVN1, (i) GMR>Rh1+RNF5 and (j) GMR>Rh1+RNF185. Scale bar, 100 μm. (k) Quantification of the number of ommatidia in the middle 3 rows of a-j (relevant rows are indicated in a). Error bars indicate SEM (n = 5); ns, not significant; ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test).(TIF)Click here for additional data file.
SORDD1 is an ER-associated E3 ligase.
(a) Protein sequence alignment between SORDD1 and SORDD2 showed they share 92.4% amino acid identity, and the differences mainly reside in the C terminus near the transmembrane region. Both of SORDD1 and SORDD2 are predicted to have a typical C3HC4 RING domain and position C165 is predicted to be the active center. (b)RNA sequencing and qPCR results of w flies show the expression of sordd1 and sordd2 in different tissues. (c) Fractionation assay to show SORDD1 is a membrane protein. A Myc tag was fused to the N terminus of SORDD1 and S2 cells were transiently transfected with Myc-tagged SORDD1.S, supernatant. P, pellet. (d) Confocal images show the cellular localization of SORDD1.S2 cells were transiently transfected with Myc-tagged SORDD1 (red), and labeled with ER marker Calnexin (green) and DAPI (blue). Scale bar, 10 μm. (e) SORDD1/2 also suppresses retinal degeneration induced by earlier expression of wild-type Rh1 and Rh1P37H. Light photomicrographs show adult eye morphology of control (GMR-Gal4/+), and flies overexpressing wild-type Rh1 (GMR-Gal4/UAS-Rh1) or Rh1P37H (GMR-Gal4/UAS-Rh1), together with SORDD1 (GMR-Gal4/UAS-Rh1;UAS-sordd1/+ and GMR-Gal4/UAS-Rh1;UAS-sordd1/+) or SORDD2 (GMR-Gal4/UAS-Rh1;UAS-sordd2/+ and GMR-Gal4/UAS-Rh1;UAS-sordd2/+). Scale bar, 100 μm.(TIF)Click here for additional data file.
Ubiquitination sites of Rh1G69D are essential for suppression of Rh1G69D induced cell degeneration by SORDD1/2 and HRD1.
Potential ubiquitination sites of Rh1G69D are mutated by substitution of all 15 cytosol lysines and 2 luminal lysines with arginines (Rh1G69D+KR). (a) the adult eye morphology of wild type (GMR-gal4/+) and flies overexpressing Rh1G69D (GMR-Gal4/UAS-Rh1), Rh1G69D+KR (GMR-Gal4/UAS-Rh1) together with sordd1 (GMR-Gal4/UAS-Rh1;UAS-sordd1/+), sordd2 (GMR-Gal4/UAS-Rh1;UAS-sordd2/+) or hrd1 (GMR-Gal4/UAS-Rh1;UAS-hrd1/+). Scale bar, 100 μm. (b) Blocking VCP and proteasome components lead to the accumulation of Rh1G69D when SORDD1 are expressed. Western blot analysis of head extracts from 1-day-old flies shows the levels of Rh1G69D–Myc in GMR>Rh1-Myc sordd1 (GMR-Gal4 UAS-Rh1-Myc UAS-sordd1/+) flies increase by knocking down proteasome subunits Prosα1 (prosα1, GMR-Gal4 UAS-Rh1-Myc UAS-sordd1/+;UAS-prosα1/+) or Rpn12 (rpn12, GMR-Gal4 UAS-Rh1-Myc UAS-sordd1/+;UAS-rpn12/+), component of VCP complex UFD1 (ufd1, GMR-Gal4 UAS-Rh1-Myc UAS-sordd1/+;UAS-ufd1/+) or Amalgam (Ama), one of the genes identified in the RNAi screen (ama, GMR-Gal4 UAS-Rh1-Myc UAS-sordd1/+;UAS-ama/+). Note Rh1G69D can form dimer. (c) Statistic results of b, Error bars indicate SEM; n = 3, *p<0.1, ***p<0.001, ****p<0.0001 (one-way ANOVA, Sidak's multiple comparisons test).(TIF)Click here for additional data file.
Generation of sordd1/2 deletion (sordd1/2) mutants.
(a) Scheme for generating the sordd1/2 deletion by CRISPR-Cas9 system, the two sgRNA recognition sites and positions of the DNA primers used for PCR (arrows) are indicated. (b) PCR products of ~800 bp were obtained from sordd1/2 mutants with successful deletion of sordd1 and sordd2 loci. (c) The verification of sordd1/2 by RT-PCR.RT-PCR products of 834 bp were obtained from full-length sordd1 cDNA in wild type while absent in sordd1/2.(TIF)Click here for additional data file.
SEM quantification data.
(XLSX)Click here for additional data file.
sordd1 and sordd2 mRNA expression level relative to rp49 in different tissues.
(XLSX)Click here for additional data file.
Larval eye discs fluorescence of Rh1G69D, XBP1 and ATF4 in different genotypes.
(XLSX)Click here for additional data file.
Pupa eye western blots data.
(XLSX)Click here for additional data file.
In vivo ubiquitination assay data.
(XLSX)Click here for additional data file.
Relative Rh1G69D protein levels under different gene knockdown backgrounds.
(XLSX)Click here for additional data file.
TEM quantification data of number of rhabdomere per ommatidia under hrd1/hrd3 knockdown or knockout backgrounds.
(XLSX)Click here for additional data file.
Relative Rh1G69D protein levels under sordd1/2 mutants, hrd1 mutants and sordd1/2;hrd1 mutants backgrounds.
(XLSX)Click here for additional data file.
Deep pseudopupil analysis data.
(XLSX)Click here for additional data file.
Relative Rh1, INAD, TRP protein levels under sordd1/2 mutants, hrd1 mutants and sordd1/2;hrd1 mutants backgrounds.
(XLSX)Click here for additional data file.
TEM quantification data of number of rhabdomere per ommatidia of ninaEG69D under hrd1 or sordd1 overexpression backgrounds.
(XLSX)Click here for additional data file.
Quantification data of ERG amplitude of ninaEG69D under hrd1 or sordd1 overexpression backgrounds.
(XLSX)Click here for additional data file.8 Jun 2020Dear Dr Wang,Thank you very much for submitting your Research Article entitled 'Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila.' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by three independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time.Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Hyung Don RyooGuest EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: In their article Wang and colleagues investigate the role of 2 ER resident E3 ubiquitin ligase SORDD1 and SORDD2 in retinal degeneration induced by Rh1G69D mutation, a model of adRP. By using a gain of function screen in animal expressing Rh1G69D, they have identified SORDD1/2 as suppressor of retinal degeneration. They further show that overexpression SORDD1/2 reduce ERstress and promote the degradation of Rh1G69D. Genome wide RNAi revealed that SORDD1 function requires VCP and the proteasome but not Hrd1 complex. Finally, crispr generated deletion of SORDD1/2 show no phenotype on its own but combined with hrd1 mutant exhibited enhanced degeneration and photoreceptor dysfunction in Rh1G69D mutant. This suggests that SORDD1/2 work in parallel with Hrd1 to degrade Rh1G69D.The paper is interesting and the data are novel. However, some of the claims are not sufficiently supported by the data. In several cases, I was not fully convinced by the data provided and several data are not quantified.Major commentsIn figure 1, the authors state that Rh1G69D is overexpressed weakly by GMR promoter. I am surprised by this statement because GMR is a strong pan retinal driver expressed not only in photoreceptors but in all retinal cells. The authors should support their claim by showing expression level.In figure 1b-k, the level of protection is not quantified here. Eye size and photoreceptor number should be quantified. The authors should also include a control with an overexpression control line such as UAS-GFP.What is the contribution of retinal pigment cell versus photoreceptor in this phenotype.Interestingly SORDD1 is expressed ubiquitously but its role seems restricted to photoreceptor cells. Could SORDD1 play a role in other cell types or other misfolded proteins?At this stage, there is not enough evidence to claim that SORDD1 act in the ERAD complex. All is based on the localization at the ER with calreticulin. However the images provided does not allow to see if there is any cytoplasmic localization of SORDD1/2. These ubiquitin E3 ligases could simply be required for ubiquitination and proteasome function in the cytoplasm. What is the global protein ubiquitination profile on SORDD1/2 mutants?Figure 2a should be quantified.Figure 3b, c. Photoreceptor degeneration can sometimes undergo below an intact cornea so the authors should show photoreceptor count for these conditions.Figure 4c. Deep pseudopupil can be difficult to distinguish in particular for quantification. Please show raw images or use an alternative for quantification such as cornea neutralization technique.Minor commentsIn first paragraph the authors use "glassy eye phenotype" I think we use glossy instead.Reviewer #2: The submitted work by Xu et al. proclaimed the identification of novel E3 ligases, SORDD1/2, facilitating Rhodopsin 1 (Rh1) homeostasis in a Drosophila model and prevent mutant Rh1 induced retinal degeneration. Several rh1 mutations that fail to be correctly folded and transported to the apical membrane of photoreceptor cells could accumulate in the ER and trigger ERstress. The authors provide some evidence to argue that SORDD1/2 function in parallel with the HRD1 E3 ligase, whose action and other cofactor help mark the ubiquitin chains and provide a channel to allow the retrotranslocation of that misfolded rhodopsin to the cytoplasm. While this study's finding might be potentially significant, several issues need to be resolved before publication.Major points:1. The most puzzling question in the paper is that their finding contradicts to a prior report by Gricius et al. (2010) PLoS Genet. 6(8):e1001075. In that paper, authors used Rh1P37H to model a common ADRP mutation that mimicking a typical class II rod opsin mutation P23H, which is misfolded in the ER and processed by ERAD. However, they showed that by knocking down VCP/TER94, or by pharmacological treatment of either VCP or proteasome inhibitors, the retinal degeneration caused by Rh1P37H was suppressed. Although this study is using a different ADRP allele, the effect of VCP/TER94 is the opposite. Given that both alleles showed ERstress, the discrepancy shall be resolved experimentally. The authors should test Rh1P37H allele to demonstrate that SORDD1/2 are indeed genuine E3 ligases that function to process Rh1. Importantly, the authors shall bring this issue in the discussion. Furthermore, the only result that links TER94 function in SORDD1-mediated Rh1 degradation is a single RNAi allele analysis in Figure 3b, which is insufficient. TER94 has been shown to interact with several ER membrane components, the authors shall evaluate additional TER94 alleles and test if TER94 could physically interact with SORDD1.2. Another concern is the data used to prove that SORDD1 is an ER membrane protein (Figure S1b). As this study claims, SORDD1 is an ER membrane component for the first time, and there is no prior report of this E3 ligase, robust analyses are required for scrutinizing. The image of the S2 cell shown in S1b has some caveats. First, the manuscript didn’t mention how eGFP was tagged to SORDD1. Second, the authors didn’t prove that the localization of SORDD1-GFP fusion protein remains the same as the endogenous SORDD1. Third, the GFP signals from the fusion protein and anti-Calnexin staining were exceedingly saturated. It is risky to use that overlapping to suggest SORRD1 is an ER membrane component. To convince readers that this E3 ligase indeed resides in the ER membrane, an antibody that could recognize the endogenous SORDD1 is preferable. Alternatively, if the antibody is not available or not work, it is necessary to provide either co-IP or proximity-based labeling results with a smaller tag to demonstrate that SORDD1 is indeed associated with a prominent ER protein.3. The manuscript indicated that overexpression of E3 ligase CG8141 did not suppress Rh1G69D-induced eye phenotype. As both CG8141 and sordd1 are orthologous to RNF185 and RNF5, it will be more convincing to show that CG8141 has functionally deviated from sordd1/2 on the issue of Rh1 processing. The ERAD reporters used in Figure 2a should include GMR>Rh1G69D+ CG8141.4. The manuscript underscores SORDD1/2 E3 ligase activity involves in Rh1 homeostasis. Interestingly, Figure S2a showed that SORDD1 expression still partially suppresses Rh1G69D-KR-induced rough eye phenotype. As the authors noted that Rh1G69D-KR is ubiquitin-resistant, several issues need to be clarified for this data. First, the authors didn’t mention what lysine residues of this transgenic fly have been changed. The detail of generating this ubiquitin-resistant allele should be included. Second, an IP experiment with anti-ubiquitin detection is essential to demonstrate that this KR allele is free from ubiquitination. Third, because the authors indicated that Rh1G69D-KR is ubiquitin-resistant, the authors should explain how does SORDD1 remains capable of the partial rescue?5. The authors should experimentally clarify whether the modulation of sordd1 would affect endogenous hrd1 expression or vice versa, given that these two E3 ligases serve in a complementary manner.6. There are several issues in those compound eye micrographs. First, I am troubled by the scale bar throughout the manuscript. If the scale bar is correct, the A-P dimension of a fruit fly eye is greater than 3 mm, which is impossible. Second, the micrographs of the same genotype often showed inconsistent morphology. For example, while both Figure 1d and Figure 2d showed the external eye morphology of GMR>Rh1G69D+hrd1, one can tell that in Figure 1d showed mild roughness, but the panel showed the same genotype in Figure 2d looked normal. Another example has to do with GMR>Rh1G69D+sorrd1 (Figure 1e) or sorrd2 (Figure 1f), which showed normal external eye morphology. However, when looking at the same genotype from the corresponded panels in Figure 2d, the rough eye phenotype was evident. Such irregularity of phenotype from the same fly strain raises great concerns, especially for interpreting the issue regarding hrd1 and sorrd1 function in parallel to processing Rh1, as shown in Figure 3c. The authors shall adopt methods with either a better resolution or with a quantifiable measurement to improve the quality.7. The IP data in Figure 2e suggests the expression of SORRD1C165S could lower the ubiquitination level of Rh1G69D-Myc. However, it is apparent that anti-Myc IP result also showed much lower Rh1G69D-Myc protein levels. Because the experiment was performed in rpn12 knockdown background, the authors were awarded this problem, but chosen this data to argue the E3 ligase activity of SORRD1 is crucial for Rh1 processing does raise some concerns. The authors should provide data with a comparable amount of Rh1G69D-Myc in wild type SORRD1 and SORRD1C165S background to substantiate their findings.8. One highlighted point in the manuscript is that SORDD1/2 and Hrd1 function in parallel and complementary to maintain Rh1 homeostasis. While the authors showed that loss of all three genes leads to age-dependent photoreceptor cell degeneration (Figure 4d), it is not clear whether this is due to the disturbance of Rh1 homeostasis. Furthermore, the main text or the figure legend didn't indicate whether these panels in Figure 4d are from wild type or Rh1G69D backgrounds. If this is from the wild type background, the authors should compare the endogenous Rh1 protein levels right before the onset of photoreceptor degeneration to address this issue.9. Figure 1a is incorrect because the EP lines of SORDD1/2 are in the X chromosome. This kind of error shall avoid.Minor points:1. In the first Result section, the authors stated – "Rh1G69D was weakly expressed in undifferentiated photoreceptor neurons (GMR>Rh1G69D)"– is misleading. First of all, GMR-Gal4 is considered a strong driver, and there is no quantitative index or means to make such a statement. Second, GMR-Gal4 drives UAS transgene expression in all cells of differentiating ommatidia posterior to the morphogenetic furrow, not limiting to photoreceptor neurons.2. The molecular weight of Rh1G69D in Figure S2b and Figure 2b seems quite a different judging from the marked MWs. A major band (blow 37 kD mark) could be found in the third and the fourth lanes of S2b. Is that an unspecific band or a processed Rh1?3. Figure 2e and 2f appeared in the text without mention anything about rpn12, which only seemed later. The writing flow should be fixed.4. Toward the end of the first paragraph in the third section of the Result, it should be “when knocked down alone” instead of “when expressed alone” because the corresponded experiments were using the RNAi approach.5. The authors should provide a citation of experimental data to demonstrate that rpn12 knockdown would affect proteasome function.6. The authors shall avoid using “cell death” in their text because none of the provided data includes any cell death assay. An example could be found to the end of section 3 in the Result.7. The genotypes in Figure 3b and 3c are confusing. While the labeling of sordd1 was no difference in all panels, the genotypes stated in the Figure legend were either UAS-sordd1 or simply sordd1 (is this indicating the EP line?). The authors need to make sure the genotype is correctly described.Reviewer #3: The manuscript by Jaiwei Xu, Haifang Zhao, and Tao Wang used an overexpression screen to identify two redundant ubiquitin ligases SORDD1/2 as additional factors that contribute to the degradation of misfolded opsins. By-and-large the experiments are well controlled and the data convincing. Identification of this novel HRD1/3 independent ER degradation pathway is intriguing and an important. I have just a few comments that should be straightforward to address.1. For the ERG analysis (fig. 5) the flies were maintained under constant light.It seems important to note that constant light treatment triggers elevated ERstress (PMID: 30015618). Is that elevated ERstress necessary to achieve the strong ERG phenotype reported? Was the same pre-treatment used for the deep pseudo pupil analysis?2. The title is a bit misleading, as it is only the overexpression of SORDD1 that results in suppression of the retinal degeneration phenotype. Related to this; it may be old-fashioned, but the name SORDD1/2 seems a bit unfortunate. Classically, fly genes have been named for their loss-of-function rather than their overexpression phenotypes.3. I do not understand why HRD1-independence of SORDD1 activity disproves that "that HRD1 may work as the retro-translocation channel for this kind of multi-span membrane substrate". author statement). It just seems to prove that it is not the only one especially given that the endogenous HRD1 and SORDD1 genes appear to be part of two redundant pathways for Rho[G69D] degradation (Figure 4)4. There is a significant literature on the mammalianRNF5 / RNF185 homologs of SORDD1/2, for example in the context of cystic fibrosis or immunity. Given the functional conservation shown by the authors, known functions of these mammalian homologs should be discussed and compared to the current findings.5. Regarding the Western blots shown in Figure 2e: Elevated ubiquitination of Rh1G69D–Myc in the SORDD1 Wt compared to SORDD1-C165S expressing flies is clear, but how do the authors explain that Rh1G69D–Myc is not accumulating to the same level given that proteasomal degradation is inhibited. This should be addressed.Minor details:6. The EM procedure mentions 4% paraformaldehyde and 2.5% pentanediol as fixativePresumably the authors mean pentanedial more commonly referred to as glutaraldehyde.7. lots of typos and grammar errors e.g.:- Amalgam (Ama) one of gene identified in RNAi screen (Figure legend S2)- Presumably statistical significance was assessed rather than "applied" (Statistics section)- SORDD1 function dependently on VCP and the proteasome but independently on the RD1 complex (section 3)- Degrading misfolded ER membrane proteins, as called ERAD-M,- Mutations in hrd1 or hrd3 have no effect in eye morphology**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No16 Sep 2020Submitted filename: Response to reviewers 2020 Xu et al.docxClick here for additional data file.28 Sep 2020* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. *Dear Dr Wang,Thank you very much for submitting your Research Article entitled 'Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila.' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved.We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer.In addition we ask that you:1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]Please let us know if you have any questions while making these revisions.Yours sincerely,Hyung Don RyooGuest EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsDear Dr. Wang,Thank you for submitting a revised version of your manuscript entitled 'Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila' to PLOS Genetics. Your manuscript was evaluated by two of the three original referees. I also read your manuscript to evaluate your responses.As you see, the reviewers found that your revised manuscript addresses most of the concerns that they had raised. You will also find that there are three relatively minor points that they ask you to address before publication. These are:1. Reviewer 2 is asking why a panel in Figure 2a (that over expressing CG8141 has bright GFP signal that is not reflected in the quantified graph in Figure 2b. It appears to me that the specific Figure that you displayed shows episode-fluorescence and is not a representative one. Please choose a representative image to replace that panel.2. Reviewer 2 also asks you to state in the main text that Rh1G69D-KR has three lysine residues in the transmembrane region.3. Reviewer 3 insists that you cannot conclude ER localization of SORDD1/2 based on over expression experiments. In my view, this could be readily addressed by deleting conclusions based on your own over expression experiments, and instead, cite other studies concluding that the mammalian SORDD1/2 homolog acts in the ER.Yours sincerely,Hyung Don RyooReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2: The revised manuscript by Xu et al. has made significant improvements. However, the following issues need to be resolved before acceptance for publication.1. The authors have responded to my earlier concern regarding the functional deviation of SORDD1/2 and another E3 ligase CG8141. The revised manuscript has included the CG8141 overexpression allele in ERstress reporters assay. As seen in Figure 2a, the signals of XBP1-EGFP and ATF4-mCherry in the bottom row (Rh1G69D-Myc + CG8141) appeared significantly enhanced and did not follow Rh1G69D-Myc's staining pattern as compared to Rh1G69D-Myc alone (2nd row from top). Because CG8141 overexpression did not worsen eye degeneration, how do the authors explain this observation? While the authors showed quantitative data in Figure 2b, given the intensity difference of the represented image in Figure 2a, and the N value was 4 in Figure 2b, the data require careful review.2. According to the authors’ response, Rh1G69D-KR has three lysine residues within the transmembrane domain that were not mutated to Arginine, which might explain why the expression of sordd1/2 could still partially rescue the Rh1G69D-KR-caused rough eye phenotype. This information, while no clear mechanistic insight, should be revealed in the main text.Reviewer #3: The authors have appropriately addressed the majority of concerns raised by the previous round of reviews. The exception is their conclusion that SORD1/2 are ER proteins.This is entirely based on the analysis of overexpressed SORD1/2 proteins in S2 cells. Accumulation of overexpressed proteins in the ER is not unusual. Therefore, the authors' conclusion that endogenous SORD1/2 are ER proteins is not convincingly supported by the data and the conclusion should be modified accordingly.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: NoReviewer #3: No2 Oct 2020Submitted filename: Response to reviewers Xu et al.docxClick here for additional data file.5 Oct 2020Dear Dr Wang,We are pleased to inform you that your manuscript entitled "Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila." has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Hyung Don RyooGuest EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-20-00745R2More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.22 Oct 2020PGENETICS-D-20-00745R2Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila.Dear Dr Wang,We are pleased to inform you that your manuscript entitled "Suppression of retinal degeneration by two novel ERAD ubiquitin E3 ligases SORDD1/2 in Drosophila." has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Jason NorrisPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: T P Dryja; T L McGee; E Reichel; L B Hahn; G S Cowley; D W Yandell; M A Sandberg; E L Berson Journal: Nature Date: 1990-01-25 Impact factor: 49.962
Authors: Stefan Schoebel; Wei Mi; Alexander Stein; Sergey Ovchinnikov; Ryan Pavlovicz; Frank DiMaio; David Baker; Melissa G Chambers; Huayou Su; Dongsheng Li; Tom A Rapoport; Maofu Liao Journal: Nature Date: 2017-07-06 Impact factor: 49.962
Authors: Laura Fernández-Sánchez; Irene Bravo-Osuna; Pedro Lax; Alicia Arranz-Romera; Victoria Maneu; Sergio Esteban-Pérez; Isabel Pinilla; María Del Mar Puebla-González; Rocío Herrero-Vanrell; Nicolás Cuenca Journal: PLoS One Date: 2017-05-25 Impact factor: 3.240
Authors: Ekaterina S Lobanova; Stella Finkelstein; Jing Li; Amanda M Travis; Ying Hao; Mikael Klingeborn; Nikolai P Skiba; Raymond J Deshaies; Vadim Y Arshavsky Journal: Nat Commun Date: 2018-04-30 Impact factor: 14.919